A method for in situ high-throughput detection of RNA-ribosome interaction and application thereof

The rolling circle amplification technique, which combines a lock-in probe with an 18S rRNA primer probe, solves the problems of limited throughput and low signal-to-noise ratio in the detection of RNA-ribosome interactions in existing technologies. It achieves high-throughput, subcellular resolution RNA translation status detection with high signal-to-noise ratio and simple operation.

CN116042781BActive Publication Date: 2026-04-21HEFEI BEIMING SPACE BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HEFEI BEIMING SPACE BIOTECHNOLOGY CO LTD
Filing Date
2023-02-16
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing in situ detection methods for RNA-ribosome interactions suffer from limitations in throughput, operational complexity, and low signal-to-noise ratio, failing to achieve high-throughput, high-specificity, and high-signal-noise-ratio detection.

Method used

A combination of lock-on probes and 18S rRNA primers and probes, along with rolling circle amplification technology, was used to achieve high-throughput detection of RNA-ribosome interactions via fluorescence in situ hybridization. The lock-on probes specifically bind to the target RNA, while the 18S rRNA primers and probes specifically bind to the ribosomes. The signals were decoded and amplified using decoding probes and fluorescent probes.

Benefits of technology

It achieves high-throughput, subcellular resolution RNA translation status detection, preserves the original spatial location of RNA, has a high signal-to-noise ratio, is easy to operate, and can detect the translation status of dozens to hundreds of genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116042781B_ABST
    Figure CN116042781B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of genetic engineering, and provides a method for detecting RNA and ribosome interaction in situ, and a probe combination of a padlock probe and an 18S rRNA primer probe, a decoding probe and a fluorescent probe used in the detection process. The detection method of the present application has the advantages of high signal-to-noise ratio, high throughput coding capacity, subcellular resolution, low cost, simple operation and the like, and is significantly superior to traditional translational omics research technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to detection techniques for RNA-ribosome interactions, and particularly to a method and application for in situ high-throughput detection of RNA-ribosome interactions, belonging to the field of genetic engineering. Background Technology

[0002] Gene expression is regulated at both the transcriptional and translational levels. For many genes, changes in RNA and protein levels are not strongly correlated, and protein abundance is typically dominated by translation rather than transcription. Translational regulation is essential for coordinating the timing, quantity, and location of protein synthesis, and is also necessary for biological processes including cell morphogenesis and migration, organismal development, cellular stress responses, and memory formation.

[0003] In the past, knowledge about translation mechanisms largely came from standard and complex biochemical and molecular biological methods. Various proteins and nucleic acids involved in translation were purified and recombined in vitro for mechanistic studies. Recently, some sequencing-based high-throughput analysis methods, such as Ribosome Profiling, have revolutionized our understanding of translation by revealing RNA translation information at the omics level. However, translation exhibits spatial heterogeneity, and the aforementioned methods require cells to be dissected from natural tissues, lacking spatial location information of translation events within complex tissues. Therefore, how to detect intracellular translational activity in situ is receiving increasing attention.

[0004] Currently, the mainstream method for in situ detection of translation events uses radiolabeled puromycin or puromycin antibodies to label nascent polypeptides. Because puromycin indiscriminately incorporates into all nascent polypeptide chains, these methods reflect the overall situation of all translation events within the cell. Recently developed methods for studying translation of specific RNAs at sites adjacent to puromycin incorporated into nascent polypeptide chains are severely limited in throughput and complex to operate, limiting their application to live cells. In situ hybridization-based techniques for visualizing specific RNA-ribosome interactions have been developed for translation studies: Fluorescence Imaging of Ribosome-RNA Interactions (FLAIRM), which uses hybridization chain reaction (HCR) to detect target RNA molecules bound to ribosomes. However, due to the inherently strong nonspecificity of HCR, FLAIRM suffers from significant false-positive signals caused by probe nonspecific binding, hindering high-throughput applications. Summary of the Invention

[0005] To address the aforementioned deficiencies in the prior art, this invention provides a high-throughput, high-specificity, and high signal-to-noise ratio method for in situ detection of RNA-ribosome interactions.

[0006] To this end, the present invention provides a probe assembly comprising a lock probe and an 18S rRNA primer probe, wherein the lock probe specifically binds to the target RNA targeting sequence.

[0007] In a preferred embodiment of the present invention, the locking probe is a padlock-shaped single-stranded DNA that binds to the target RNA molecule in the form of a nicked circular single-stranded DNA.

[0008] In a further preferred embodiment of the present invention, the RNA targeting sequence is divided into two parts, A and B. The locking probe consists of an A' sequence, an RNA characteristic sequence, a primer region sequence C, and a B' sequence from the 5' end to the 3' end. The A' and B' sequences specifically bind to the RNA targeting sequences A and B, respectively. The 5' end of the locking probe is phosphorylated.

[0009] In a preferred embodiment of the present invention, the target RNA targeting sequence is 32 nt in length.

[0010] In a more preferred embodiment of the present invention, both parts A and B are 16nt in length.

[0011] In a preferred embodiment of the present invention, the length of the RNA characteristic sequence is 25 nt.

[0012] In a preferred embodiment of the present invention, the primer region sequence C is 8 nt in length.

[0013] In a further preferred embodiment of the present invention, the sequence of the locking probe is shown in SEQ ID No. 1-8.

[0014] In a preferred embodiment of the present invention, the 18S rRNA primer probe has a sequence that specifically binds to the target sequence of the naked 18S rRNA region of the ribosomal, and a sequence that specifically binds to the aforementioned lock probe.

[0015] In a preferred embodiment of the present invention, the 18S rRNA primer probe has a sequence C' that specifically binds to the lock-type probe primer region sequence C.

[0016] In a preferred embodiment of the present invention, the 18S rRNA primer probe is a universal probe suitable for detecting any gene in eukaryotes.

[0017] In a preferred embodiment of the present invention, the target sequence of the naked ribosomal 18S rRNA is 25 nt in length.

[0018] In a further preferred embodiment of the present invention, the sequence of the 18S rRNA primer probe is shown in SEQ ID No. 9-32.

[0019] Another aspect of the present invention provides a decoding probe that specifically binds to RNA feature sequences and has flanking sequences for decoding the identity of RNA.

[0020] In a further preferred embodiment of the present invention, the sequence of the decoding probe is shown in SEQ ID No. 33-34.

[0021] Another aspect of the present invention provides a fluorescent probe that specifically binds to the flanking sequence of a decoding probe, and whose 3' end is fluorescently labeled.

[0022] In a preferred embodiment of the present invention, the fluorescent markers include AF488, AF568, AF647, Cy2, Cy3, Cy5 and Cy7.

[0023] In a preferred embodiment of the present invention, the fluorescent probe is a universal probe suitable for detecting any gene in eukaryotes.

[0024] In a further preferred embodiment of the present invention, the sequence of the fluorescent probe is shown in SEQ ID No. 35-36.

[0025] Another aspect of the present invention provides the application of the probe combination, the decoding probe, or the fluorescent probe described in the present invention in the in situ detection of RNA-ribosome interaction.

[0026] Another aspect of the present invention provides a detection kit comprising the probe combination described in the present invention, the decoding probe described in the present invention, and the fluorescent probe described in the present invention.

[0027] Another aspect of the present invention provides the application of the detection kit described herein in the in situ detection of RNA-ribosome interaction.

[0028] Another aspect of the present invention provides a method for in situ detection of RNA-ribosome interaction, comprising the following steps:

[0029] 1. The locking probe in the probe combination described in this invention specifically binds to the target RNA targeting sequence;

[0030] 2. Using the target RNA sequence as a clamp, the lock-lock probe is ligated into a circular single-stranded DNA molecule using DNA ligase;

[0031] 3. The 18S rRNA primers and probes in the probe combination described in this invention specifically bind to the target sequence of the naked 18S rRNA region of the ribosome, and specifically bind to the lock-type probes in the probe combination described in this invention.

[0032] 4. Using the above-mentioned circular single-stranded DNA molecule as a template and 18S rRNA primers and probes as primers, rolling circle amplification was performed.

[0033] 5. Using the decoding probe and the fluorescent probe described in this invention, hybridization imaging is performed through single-molecule fluorescence in situ hybridization to detect the spatial location information of RNA-ribosome interaction.

[0034] In a preferred embodiment of the present invention, the DNA ligase is Splint R ligase.

[0035] By adopting the above technical solution, the present invention achieves the following beneficial effects:

[0036] 1. This invention has spatial location information: Compared with sequencing-based translatome detection technology, this invention preserves the original spatial location of RNA.

[0037] 2. This invention has subcellular resolution: Based on imaging, this invention can achieve single-molecule detection of RNA being translated at the single-cell level.

[0038] 3. This invention has high-throughput detection capability: This invention can perform multiple rounds of perfusion, and combined with multi-round combined coding imaging, it can realize the translation status detection of dozens to hundreds of genes.

[0039] 4. This invention has an extremely high signal-to-noise ratio: The signal is significantly amplified by rolling circle amplification, which is also very effective for detecting translation of shorter RNAs.

[0040] 5. The present invention is simple to operate: The present invention only requires a few steps of probe hybridization and enzymatic reaction to realize the in situ RNA detection in the translational state.

[0041] In summary, this invention applies rolling circle amplification to the detection of the proximity of ribosomes and RNA. The RNA signal bound to ribosomes is amplified thousands of times by rolling circle amplification, detecting the translational status of RNA while preserving its spatial location, thus promoting the development of high-throughput spatial translationomics. Attached Figure Description

[0042] Figure 1 This is a schematic diagram illustrating the principle of RiboFISH detection of a single gene and a negative control diagram of the present invention.

[0043] Figure 2 The figure shows the results of in situ detection of eEF2 RNA and Malat1 RNA translation status in Hek293T cells by RiboFISH according to the present invention, and the negative control results.

[0044] Figure 3Figures showing the results of in situ detection of eEF2 RNA using HybISS before and after treatment of Hek293T cells with the translation inhibitor puromycin, and the results of in situ detection of eEF2 RNA in translational state using RiboFISH according to this invention. Detailed Implementation

[0045] The present application will now be described in further detail with reference to the accompanying drawings and embodiments. Through these descriptions, the features and advantages of the present application will become clearer and more apparent.

[0046] Example 1: In situ detection of eEF2 RNA and Malat1 RNA translation in Hek293T cells using RiboFISH of the present invention.

[0047] The experimental principle of this embodiment is as follows: Figure 1 As shown, the specific steps are as follows:

[0048] (I) Probe Design

[0049] 1. Lock-on probe design

[0050] The housekeeping gene eEF2 and the non-coding RNA (ncRNA) Malat1 from Hek293T cells were selected as the target genes. RNA sequences with high specificity, moderate GC content, and no significant secondary structure were screened as target sequences. Different characteristic sequences were assigned to each RNA for signal readout and RNA recognition. Lock-lock probe sequences were designed based on the characteristic sequences of each RNA. These lock-lock probe sequences specifically bind to the target sequence of the target gene RNA. The lock-lock probe sequences are shown in Table 1 (SEQ ID NO. 1-8).

[0051] Table 1 Lock-type probe sequence list

[0052] Lock probe probe sequence Modification eEF2-1 TTGTCGGAGGTTGGCATAGAAACGGCCGGCTGACTAGCTCGAGGACAGTAGCAGACGTGAAGGCGTAGAACCGACCT 5’P eEF2-2 TCGGTGAGGATGTTGGTAGAAACGGCCGGCTGACTAGCTCGAGGACAGTAGCAGACGTGAACACACCCTTGGTGATG 5’P eEF2-3 TTCAGGCCCTTGCGCTTAGAAACGGCCGGCTGACTAGCTCGAGGACAGTAGCAGACGTGAAGGCAGGGATGCCTTCT 5’P eEF2-4 CCCTACTAAGAGGGCGTAGAAACGGCCGGCTGACTAGCTCGAGGACAGTAGCAGACGTGAAGACCGGCCCATTAAGT 5’P Malat1-1 TGCAGGGACGGTTGAGACGAGTACGTCGGCATTCGACCTGAAGGACAGTAGCAGACGTGAAAACTGAGCCCCAGCCT 5’P Malat1-2 AAGCCGCCTGCTACCTACGAGTACGTCGGCATTCGACCTGAAGGACAGTAGCAGACGTGAAGTGTGGTTGCCAAGCC 5’P Malat 1-3 GGAAGGCTCCATGGTTACGAGTACGTCGGCATTCGACCTGAAGGACAGTAGCAGACGTGAATGTCTCTCCTGCCACA 5’P Malat 1-4 AAAGCCCTCTCAGCCAACGAGTACGTCGGCATTCGACCTGAAGGACAGTAGCAGACGTGAATTTGCATTCCCACCCA 5’P

[0053] 2. 18S rRNA primer and probe design

[0054] Twenty-four ribosomal 18S rRNA naked region targeting sequences were screened, and ribosomal 18S rRNA primer probes were designed as primers for rolling circle amplification. In addition to a sequence that specifically binds to the ribosomal 18S rRNA naked region targeting sequence, the probe also has a primer sequence that specifically binds to the lock-type probe sequence. The 18S rRNA primer probe sequences are shown in Table 2 (SEQ ID NO. 9-32).

[0055] Table 2 18S rRNA primer and probe sequence listing

[0056]

[0057]

[0058] The above-mentioned lock-type probe and 18S rRNA primer probe are combined to form a probe combo.

[0059] 3. Decoding probe design

[0060] Based on the RNA characteristic sequence and its flanking sequences, decoding probe sequences were designed. These probes specifically bind to the RNA characteristic sequence to decode the RNA identity. The decoding probe sequences are shown in Table 3 (SEQ ID NO. 33-34).

[0061] Table 3 Decoding probe sequence list

[0062] Decoding probe probe sequence eEF2-e561 TAGAAACGGCCGGCTGACTAGCTCGAGGACTGTGATGGAAGTTAGAGGGT Malat1-e647 ACGAGTACGTCGGCATTCGACCTGAAGGACTGAAAGGAATGGGTTGTGGT

[0063] 4. Fluorescent probe design

[0064] Based on the decoding probe sequence, a fluorescent probe sequence was designed that specifically binds to the flanking sequence of the decoding probe, and fluorescent labeling was applied to the 3' end of the fluorescent probe sequence. The fluorescent probe sequences are shown in Table 4 (SEQ ID NO. 35-36).

[0065] Table 4. List of fluorescent probe sequences

[0066] fluorescent probe probe sequence Modification R561 ACCCTCTAACTTCCATCACA Cy3 R647 ACCACAACCCATTCCTTTCA Cy5

[0067] (II) Cell Culture and Drug Treatment

[0068] Hek293T cells were seeded onto poly-L-lysine-pretreated slides and cultured at 37°C in a 5% CO2 incubator for 24 h; the cells were then treated with 200 μg / ml puromycin for 1 h.

[0069] (III) Cell Fixation

[0070] Cells were fixed by treating them with 4% paraformaldehyde (PFA) for 10 min, and then washed three times with PBS supplemented with 2 mM VRC (PBSV) to thoroughly remove residual PFA.

[0071] (iv) Cell permeability

[0072] Pre-cooled methanol at -20℃ and treated cells at -80℃ for 15 min, then restored to room temperature for 5 min, supplemented with 2 mM VRC with PBS, and washed 3 times with 0.1% Triton (PBSTV).

[0073] (V) Lock-in probe hybridization

[0074] Washing buffer a: 20% formamide, 2x SSC, 2mM VRC, pre-treat cells for 5 min; add 100 nM lock probe to washing buffer a, add to the sample reaction system, and hybridize in a 37℃ incubator for 24 h; treat cells with washing buffer a at 37℃ for 30 min, twice, to remove unhybridized lock probes.

[0075] (vi) Connection reaction

[0076] Splint R ligase was added to the ligase reaction system at a ratio of 1:20, and the samples were incubated at 37°C for 2 hours for lock-lock probe ligation. The cells were then washed three times with 0.5% mouse RNase inhibitor (PBSR) supplemented with PBS.

[0077] (vii) 18S rRNA primer and probe incubation

[0078] Wash buffer b: 30% formamide, 2x SSC, 2mM VRC, pre-treat cells for 30 min, add 20 nM 18S rRNA primer probe to wash buffer b, add to the sample reaction system, and hybridize in an incubator at 37℃ for 12 h; treat cells with wash buffer b at 37℃ for 30 min to remove unhybridized 18S rRNA primer probe.

[0079] (viii) Rolling ring reaction

[0080] Phi29 DNA polymerase was added to the polymerase reaction system at a ratio of 1:50, and the samples were incubated at 30°C for 2 hours for rolling circle amplification; the cells were washed three times with PBS.

[0081] (ix) Spatial location of in situ nucleic acid hybridization detection

[0082] Washing buffer c: 10% formamide, 2x SSC, pre-treated cells for 5 min, washing buffer c was supplemented with 50 nM eEF2 and Malat1 corresponding decoding probes, added to the sample reaction system, and hybridized in a 37℃ incubator for 2 h; washing buffer c was used to treat cells at 37℃ for 30 min to remove unhybridized decoding probes.

[0083] Washing buffer c was added to the sample reaction system with 50 nM eEF2 and Malat1 corresponding fluorescent probes and 0.1 μg / ml DAPI. The samples were hybridized for 1 h, washed 3 times with PBS to remove unhybridized fluorescent probes, and then subjected to dual-color imaging using a rotating confocal microscope. The eEF2 signal channel was set at 561 nm and the Malat1 signal channel was set at 647 nm. The Z stack step size was set to 1 μm for multi-layer imaging and in-situ signal readout.

[0084] (X) Results Analysis

[0085] As per the instruction manual Figure 2 As shown, the RiboFISH of this invention detected a significant eEF2 RNA signal in the translated state. For the non-translated ncRNA Malat1, the probability of RiboFISH detecting the translated Malat1 signal is extremely low. Two negative control experiments further demonstrate the accuracy of the RiboFISH signal of this invention.

[0086] As per the instruction manual Figure 3 As shown, after treatment of cells with the translation inhibitor puromycin, the number of eEF2 signals in the translation state detected by RiboFISH of the present invention was significantly reduced, indicating that RiboFISH of the present invention can detect changes in the translation state of various RNAs in cells.

[0087] The present application has been described above with reference to preferred embodiments; however, these embodiments are merely exemplary and illustrative. Various substitutions and modifications can be made to the present application based on these embodiments, all of which fall within the protection scope of the present application.

Claims

1. A probe assembly comprising a locking probe and an 18S rRNA primer probe, wherein the locking probe specifically binds to a target RNA targeting sequence, the locking probe being a padlock-like single-stranded DNA that binds to the target RNA molecule as a notched circular single-stranded DNA, the target RNA targeting sequence being divided into two parts, A and B, the locking probe comprising, from the 5' end to the 3' end, a sequence A', an RNA characteristic sequence, a primer region sequence C, and a sequence B', wherein the A' and B' sequences specifically bind to the RNA targeting sequences A and B, respectively, and the 5' end of the locking probe is phosphorylated; the 18S rRNA primer probe has a sequence specifically binding to the ribosomal 18S rRNA naked region targeting sequence and a sequence specifically binding to the locking probe, the 18S rRNA primer probe having a sequence C' specifically binding to the primer region sequence C of the locking probe.

2. The probe combination according to claim 1, wherein the target RNA targeting sequence is 32 nt in length, and both parts A and B are 16 nt in length.

3. The probe assembly according to claim 1, wherein the RNA feature sequence is 25 nt in length.

4. The probe combination according to any one of claims 1-3, wherein the primer region sequence C is 8 nt in length.

5. The probe assembly according to claim 1, wherein the sequence of the locking probes is shown in SEQ ID No. 1-8.

6. The probe combination according to claim 1, wherein the 18S rRNA primer probe is a universal probe suitable for detecting any gene in eukaryotes.

7. The probe combination according to claim 1, wherein the ribosomal 18S rRNA naked region targeting sequence is 25 nt in length.

8. The probe combination according to claim 1, wherein the sequence of the 18S rRNA primer probe is shown in SEQ ID No. 9-32.

9. The use of the probe combination according to any one of claims 1-8 in in situ detection of RNA-ribosome interaction.

10. A detection kit comprising the probe combination according to any one of claims 1-8.

11. The application of the detection kit according to claim 10 in in situ detection of RNA-ribosome interaction.

12. A method for in situ detection of RNA-ribosome interaction, comprising the following steps: (1) The locking probe in any one of the probe combinations of claims 1-8 specifically binds to the target RNA targeting sequence; (2) Using the target RNA targeting sequence as a clamp, the lock probe is ligated into a circular single-stranded DNA molecule by DNA ligase; (3) The 18S rRNA primer probe in any one of the probe combinations of claims 1-8 specifically binds to the target sequence of the naked 18S rRNA of the ribosome, and specifically binds to the lock probe in any one of the probe combinations of claims 1-8; (4) Using the above-mentioned circular single-stranded DNA molecule as a template and 18S rRNA primer probe as primers, rolling circle amplification was performed; (5) Using decoding probes and fluorescent probes, hybridization imaging is performed through single-molecule fluorescence in situ hybridization to detect the spatial location information of RNA-ribosome interaction; in, The decoding probe specifically binds to the RNA characteristic sequence of the lock probe in any one of the probe combinations of claims 1-8, and has flanking sequences for decoding the identity of the RNA; the fluorescent probe specifically binds to the flanking sequences of the decoding probe, and its 3' end is fluorescently labeled.

13. The method of claim 12, wherein the sequence of the decoding probe is as shown in SEQ ID No. 33-34.

14. The method of claim 12, wherein the fluorescent markers include AF488, AF568, AF647, Cy2, Cy3, Cy5 and Cy7.

15. The method of claim 14, wherein the fluorescence is a universal probe suitable for detecting any gene in eukaryotes.

16. The method of claim 15, wherein the sequence of the fluorescent probe is shown in SEQ ID No. 35-36.

17. The method according to claim 12, wherein the DNA ligase is Splint R ligase.