Mycobacterium tuberculosis Ag85B DNA vaccine and preparation method and application thereof
By constructing the eukaryotic expression plasmid pcD-sRv1886c, a Mycobacterium tuberculosis Ag85B DNA vaccine was prepared, which solved the problem of insufficient protective efficacy of existing vaccines, achieved a sustained humoral and cellular immune response, and significantly enhanced the killing effect on Mycobacterium tuberculosis.
Patent Information
- Application Number
- CN202211481525.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-24
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2042-11-24
AI Technical Summary
Existing tuberculosis vaccines, such as BCG, offer limited immune protection, especially against adult pulmonary tuberculosis, and there are few DNA vaccines with high safety profiles.
A eukaryotic expression plasmid pcD-sRv1886c was constructed, and the HSV2gD signal peptide gene and the Rv1886c gene were linked to pcDNA3.1+ to prepare a Mycobacterium tuberculosis Ag85B DNA vaccine. Through muscle immunization, CD4+T and CD8+T cells secrete IFN-γ, stimulate the proliferation of splenic lymphocytes, and express Ag85B protein to kill Mycobacterium tuberculosis.
This vaccine can effectively induce a long-lasting humoral and cellular immune response, significantly enhance the killing effect against Mycobacterium tuberculosis, with CD4+T and CD8+T cell ratios of 2.03% and 1.05%, respectively, and a spleen lymphocyte proliferation index of 5.02, providing significant immune protection.
Smart Images

Figure CN116059332B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological vaccine technology, specifically to a Mycobacterium tuberculosis Ag85B DNA vaccine, its preparation method, and its application. Background Technology
[0002] Tuberculosis (TB) is a serious chronic infectious disease caused by Mycobacterium tuberculosis (M.tb), posing a significant threat to human health. Approximately 90% of TB patients are adults. Therefore, the prevention and treatment of this infectious disease is extremely urgent. Bacillus Calmette-Guerin (BCG) is currently the only clinically used anti-TB vaccine. Studies have shown that BCG immunity only lasts for 10-15 years, offering good protection for newborns but with limited protection against adult pulmonary tuberculosis. Given this situation, the development of a vaccine for this disease is of great significance.
[0003] DNA vaccines can induce more effective and durable broad-spectrum cellular immunity. In recent years, DNA vaccines constructed based on Mycobacterium tuberculosis immunoprotective antigen genes have been among the most studied novel vaccines. Most DNA vaccines targeting tuberculosis target antigens highly expressed during the early growth and logarithmic growth phases of tuberculosis, i.e., the infectious period. However, there are still relatively few existing DNA vaccines with high safety profiles for tuberculosis prevention. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a method for preparing a Mycobacterium tuberculosis Ag85B DNA vaccine. The protein expressed by the pcD-sRv1886c recombinant plasmid of this invention can effectively induce CD4+ secretion of IFN-γ. + T and CD8 + T cells accounted for 2.03% and 1.05%, respectively. Furthermore, the plasmid stimulated splenic lymphocyte proliferation, with a proliferation stimulation index of 5.02. Finally, the immune response stimulated by the protein expressed by this plasmid showed a significant killing effect against Mycobacterium tuberculosis H37Ra infection.
[0005] This invention provides a method for preparing a Mycobacterium tuberculosis Ag85B DNA vaccine. The HSV2gD signal peptide gene and a partial gene sequence of Rv1886c are first synthesized into nucleotide chains, and then linked to HindⅢ / Xbal on the vector pcDNA3.1+ to obtain the pcD-sRv1886c plasmid, which is the Mycobacterium tuberculosis Ag85B DNA vaccine.
[0006] The nucleotide chain gene sequence is shown in SEQ ID NO.3.
[0007] Furthermore, the HSV2gD signal peptide gene sequence is shown in SEQ ID NO.1.
[0008] Furthermore, the Rv1886c gene sequence is shown in SEQ ID NO.2.
[0009] This invention provides a Mycobacterium tuberculosis Ag85B DNA vaccine prepared by the above method.
[0010] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine is formulated with pharmacologically acceptable excipients.
[0011] This invention provides the application of the aforementioned Mycobacterium tuberculosis Ag85B DNA vaccine in the manufacture of drugs for the treatment or prevention of pulmonary tuberculosis.
[0012] Furthermore, the Ag85B DNA vaccine can be used to prepare CD4 cells that secrete IFN-γ. + T and CD8 + T cell inducers.
[0013] Furthermore, the Ag85B DNA vaccine can be used to prepare drugs that stimulate the proliferation of splenic lymphocytes.
[0014] Furthermore, the Ag85B DNA vaccine can specifically express the Ag85B protein, which can be used to prepare drugs that inhibit tuberculosis infection.
[0015] Furthermore, the tuberculosis bacillus is H37Ra.
[0016] This invention provides the application of the aforementioned Mycobacterium tuberculosis Ag85B DNA vaccine in the manufacture of drugs used as carriers or adjuvants.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0018] 1. This invention uses molecular biology techniques to link a total of 963 bp nucleotide sequences of the HSV2-gD signal peptide gene and the Rv1886c gene to pcDNA3.1+, which has a strong promoter, to construct the eukaryotic expression plasmid pcD-sRv1886c, which is a Mycobacterium tuberculosis Ag85B DNA vaccine.
[0019] 2. This invention successfully constructed the eukaryotic expression plasmid pcD-sRv1886c and detected specific expression of Ag85B protein. Preliminary evaluation of the humoral and cellular immune effects induced by intramuscular immunization with the pcD-sRv1886c recombinant plasmid at an immunization dose of 50 μg / animal was conducted. Fourteen days post-immunization, the pcD-sRv1886c recombinant plasmid induced the production of IgG and IgG1 specific antibodies, and the antibody titers of IgG and IgG1 increased over time. The IgG and IgG1 titers on day 42 were significantly higher than those on day 28, indicating that Ag85B stimulates a sustained humoral immune effect. Since *M. tb.* is an intracellular parasite, cellular immunity against *M. tb.* infection is crucial. IFN-γ is mainly produced by activated T cells and can upregulate the activity of NK cells and CD8+ T cells. The results of this invention show that, 42 days after immunization, the pcD-sRv1886c recombinant plasmid can effectively induce CD4+ secretion of IFN-γ. + T and CD8 + T cells accounted for 2.03% and 1.05%, respectively. Furthermore, the plasmid stimulated splenic lymphocyte proliferation, with a proliferation stimulation index of 5.02, indicating that the plasmid can effectively induce and promote cellular immune responses. Finally, the immune response stimulated by the protein expressed by this plasmid showed a significant killing effect against Mycobacterium tuberculosis H37Ra infection. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 This image shows an electrophoresis diagram of the recombinant eukaryotic expression plasmid pcD-sRv1886c identified by enzyme digestion in this invention.
[0022] The meanings of each lane are as follows: M: 15kb DNA marker; 1: pcDNA3.1+ empty plasmid; 2: pcD-sRv1886c recombinant plasmid; 3: HindIII single enzyme digestion product of the plasmid; 4: Xbal single enzyme digestion product of the plasmid; 5: HindIII / Xbal double enzyme digestion product of the plasmid.
[0023] Figure 2 This indicates the Western blot detection results after plasmid transfection in this invention;
[0024] The meanings of each lane are as follows: M: protein marker; 1: pcD-sRv1886c recombinant plasmid transfected into CHO cells; 2: pcDNA3.1+ empty plasmid transfected into CHO cells.
[0025] Figure 3 This indicates the detection result of antibody titer in this invention.
[0026] Figure 4 This invention demonstrates the effect of recombinant plasmid pcD-sRv1886c on CD4+ T and CD8+ T cells that secrete IFN-γ. n=5);
[0027] Figure A shows the CD3+CD4 group in the PBS group. + IFN-γ + Cell proportion flow cytometry, with the IFN-γ secreting lymphocyte population circled in Figure A;
[0028] Figure B shows the CD3+CD4+ group of the pcD-sRv1886c immunization group. + IFN-γ + Cell proportion flow cytometry, Figure B circles CD3 + T cell population;
[0029] Figure C shows the CD3+ levels in the pcD-sRv1886c immunized group. + CD4 + IFN-γ + Cell ratio and CD3 + CD8 + IFN-γ + Cell proportion flow cytometry statistical analysis.
[0030] Figure 5 This invention demonstrates the effect of recombinant plasmid pcD-sRv1886c on the proliferation of splenic lymphocytes. (n=5).
[0031] Figure 6 This indicates the killing effect of the recombinant plasmid pcD-sRv1886c on Mycobacterium tuberculosis H37Ra in this invention. Detailed Implementation
[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0033] Example 1
[0034] I. Materials and Methods
[0035] 1. Construction of cells, strains, and plasmids
[0036] Chinese hamster ovary cells (CHO-K1) were purchased from the Chinese Academy of Medical Sciences. The cloned strain E. coli DH5α was kindly provided by Professor Ma Guorong. The 963 bp nucleotide sequence of the HSV2gD signal peptide gene and the Rv1886c gene was synthesized by Shanghai Sangon Biotech Co., Ltd. and linked between HindⅢ / Xbal on pcDNA3.1+.
[0037] The HSV2gD signal peptide gene sequence is shown in SEQ ID NO.1;
[0038] SEQ ID NO.1:
[0039] AAGCTTACCATGGGGCGTTTGACCTCCGGCGTCGGGACGGCGGCCCTGCTAGTTGTCGCGGTGGGACTCCGCGTCGTCTGCGCC
[0040] The Rv1886c gene sequence is shown in SEQ ID NO.2;
[0041] SEQ ID NO.2:
[0042] TTCTCCCGGCCGGGGCTGCCGGTCGAGTACCTGCAGGTGCCGTCGCCGTCGATGGGCCGCGACATCAAGGTTCAGTTCCAGAGCGGTGGGAACAACTCACCTGCGGTTTATCTGCTCGACGGCCTGCGCGCCCAAGACGACTACAACGGCTGGGATATCAACACCCCGGCGTTCGAGTGGTACTACCAGTCGGGACTGTCGATAGTCATGCCGGTCGGCGGGCAGTCCAGCTTCTACAGCGACTGGTACAGCCCGGCCTGCGGTAAGGCTGGCTGCCAGACTTACAAGTGGGAAACCTTCCTGACCAGCGAGCTGCCGCAATGGTTGTCCGCCAACAGGGCCGTGAAGCCCACCGGCAGCGCTGCAATCGGCTTGTCGATGGCCGGCTCGTCGGCAATGATCTTGGCCGCCTACCACCCCCAGCAGTTCATCTACGCCGGCTCGCTGTCGGCCCTGCTGGACCCCTCTCAGGGGATGGGGCCTAGCCTGATCGGCCTCGCGATGGGTGACGCCGGCGGTTACAAGGCCGCAGACATGTGGGGTCCCTCGAGTGACCCGGCATGGGAGCGCAACGACCCTACGCAGCAGATCCCCAAGCTGGTCGCAAACAaCACCCGGCTATGGGTTTATTGCGGGAACGGCACCCCGAACGAGTTGGGCGGTGCCAACATACCCGCCGAGTTCTTGGAGAACTTCGTTCGTAGCAGCAACCtGAAGTTCCAGGATGCGTACAACGCCGCGGGCGGGCACAACGCCGTGTTCAACTTCCCGCCCAACGGCACGCACAGCTGGGAGTACTGGGGCGCTCAGCTCAACGCCATGAAGGGTGACCTGCAGAGTTCGTTAGGCGCCCATCATCACCATCACCATTAATCTAGA
[0043] The nucleotide chain gene sequence obtained by synthesis is shown in SEQ ID NO.3;
[0044] SEQ ID NO.3:
[0045] AAGCTTACCATGGGGCGTTTGACCTCCGGCGTCGGGACGGCGGCCCTGCTAGTTGTCGCGGTGGGACTCCGCGTCGTCTGCGCCTTCTCCCGGCCGGGGCTGCCGGTCGAGTACCTGCAGGTGCCGTCGCCGTCGATGGGCCGCGACATCAAGGTTCAGTTCCAGAGCGGTGGGAACAACTCACCTGCGGTTTATCTGCTCGACGGCCTGCGCGCCCAAGACGACTACAACGGCTGGGATATCAACACCCCGGCGTTCGAGTGGTACTACCAGTCGGGACTGTCGATAGTCATGCCGGTCGGCGGGCAGTCCAGCTTCTACAGCGACTGGTACAGCCCGGCCTGCGGTAAGGCTGGCTGCCAGACTTACAAGTGGGAAACCTTCCTGACCAGCGAGCTGCCGCAATGGTTGTCCGCCAACAGGGCCGTGAAGCCCACCGGCAGCGCTGCAATCGGCTTGTCGATGGCCGGCTCGTCGGCAATGATCTTGGCCGCCTACCACCCCCAGCAGTTCATCTACGCCGGCTCGCTGTCGGCCCTGCTGGACCCCTCTCAGGGGATGGGGCCTAGCCTGATCGGCCTCGCGATGGGTGACGCCGGCGGTTACAAGGCCGCAGACATGTGGGGTCCCTCGAGTGACCCGGCATGGGAGCGCAACGACCCTACGCAGCAGATCCCCAAGCTGGTCGCAAACAaCACCCGGCTATGGGTTTATTGCGGGAACGGCACCCCGAACGAGTTGGGCGGTGCCAACATACCCGCCGAGTTCTTGGAGAACTTCGTTCGTAGCAGCAACCTGAAGTTCCAGGATGCGTACAACGCCGCGGGCGGGCACAACGCCGTGTTCAACTTCCCGCCCAACGGCACGCACAGCTGGGAGTACTGGGGCGCTCAGCTCAACGCCATGAAGGGTGACCTGCAGAGTTCGTTAGGCGCCCATCATCACCATCACCATTAATCTAGA。
[0046] 2. Experimental Animals: First batch: 10 female SPF-grade C57BL / 6J mice, 6-7 weeks old, weighing (18±1) g. Second batch: 12 female SPF-grade C57BL / 6J mice, 6-7 weeks old, weighing (19±2) g. Both were purchased from the Experimental Animal Center of Ningxia Medical University (Certificate No.: SCXK(Ning)2020-0001). All treatments of the C57BL / 6J mice in this experiment were for research purposes and were carried out in accordance with the relevant animal ethics regulations of Ningxia Medical University (2021-N019).
[0047] 3. Main reagents
[0048] DL15000 DNA Marker (Takara Bio), restriction endonucleases HindIII and XbaI (NEB); kanamycin sulfate (Kan), IPTG, agarose, trypsinized peptone and yeast extract (Ningxia Kebo Biotechnology Co., Ltd.); plasmid micro-extraction kit and gel extraction kit (Tiangen Biotech Co., Ltd.); endotoxin-free plasmid large-scale extraction kit (Omega Bio-Tek); mouse anti-Ag85B monoclonal antibody (Beijing Biosen Biotechnology Co., Ltd.); Lipofectamine TM 3000 transfection reagent (Thermo Fisher); protein marker (Beijing TransGen Biotech Co., Ltd.); 1.25% afodin anesthesia (Nanjing Aibei Biotechnology Co., Ltd.); HRP-labeled goat anti-mouse IgG secondary antibody (Merck); HRP-labeled goat anti-mouse IgG1 secondary antibody (Abcam); intracellular fixation and permeabilization solution; Protein Transport Inhibitor Cocktail (500X); PE Anti-Mouse CD8a; FITC Anti-Mouse CD4; eFluor 450 Anti-Mouse CD3e; APC Anti-Mouse IFN-γ (Thermo Fisher); CCK8 kit (Beyotime).
[0049] 4. Identification of eukaryotic expression plasmids
[0050] The constructed plasmid was transformed into DH5α competent cells and plated on LB agar plates containing kanamycin resistance. The cells were incubated overnight at 37°C. Single white colonies were selected from the transformed kanamycin-containing LB agar plates and inoculated into LB liquid medium containing kanamycin for overnight incubation. The plasmid was extracted using a small-batch plasmid extraction kit, identified by double enzyme digestion, and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. The expression plasmid was named pcD-sRv1886c.
[0051] 5. Transfection of CHO cells with eukaryotic expression plasmids
[0052] (1) Large-scale extraction of pcD-sRv1886c plasmid: Endotoxin-free plasmid was extracted using an endotoxin-free plasmid extraction kit. The correctly identified eukaryotic expression plasmid pcD-sRv1886c and empty vector plasmid pcDNA3.1+ were extracted, and their concentration and purity were determined. The concentration was adjusted to 1 μg / μL with PBS and stored at -20℃ for later use.
[0053] (2) Plasmid transfection of CHO cells: CHO cells were seeded in 12-well cell culture plates and cultured in DMEM medium containing 10% fetal bovine serum. When the cells reached 80%-90% confluence, the supernatant was discarded, and the cells were washed 2-3 times with PBS buffer. Following the instructions of the liposome transfection reagent, the recombinant plasmid pcD-sRv1886c and the empty plasmid pcDNA3.1+ were transfected into CHO cells. The cells were cultured at 37°C in a 5% CO2 incubator for 5 hours, then the medium was replaced with fresh DMEM medium containing 5% fetal bovine serum and cultured for another 48 hours.
[0054] 6. Western blot detection of recombinant protein expression
[0055] Collect 40 μL of CHO cell culture medium 48 h after transfection, add 5× sample buffer at a volume ratio of 1:4, boil in water for 5 min, load the sample, separate by 12% SDS-PAGE, transfer to PVDF membrane using a semi-dry electroporation apparatus, block with 5% skim milk powder for 1 h, wash with TBST for 10 min for a total of 3 times, add mouse anti-Ag85B monoclonal antibody (1:1000 dilution), add HRP-labeled rabbit anti-mouse IgG (1:2000), shake at 37℃ for 60 min, add ECL chemiluminescence solution, and analyze the results after development and fixing.
[0056] 7. Animal immunization
[0057] (1) First immunization: After one week of acclimatization, the first batch of mice were randomly divided into two groups of five mice each. The groups were the PBS group and the pcD-sRv1886c recombinant plasmid immunization group (50 μg / mouse). Mice were immunized via intramuscular injection in the thigh. A second immunization was administered two weeks after the first immunization, for a total of two immunizations. Blood was collected from the retro-orbital venous plexus at 14, 28, and 42 days after the first immunization, and serum was separated.
[0058] (2) Second time: After one week of acclimatization, the second batch of mice were randomly divided into two groups of six each. The groups were PBS+H37Ra infection group and pcD-sRv1886c immunization+H37Ra infection group.
[0059] 8. Antibody titer detection
[0060] Indirect ELISA was used. Ag85B protein prepared in the previous experiment was prepared into a 2 μg / mL solution and coated onto multiple 96-well microplates (0.1 mL / well), incubated overnight at 4°C; 2% BSA blocking buffer was added (0.1 mL / well), and the plates were incubated at 37°C for 2 h; the plates were washed 4 times with TBST, and immune serum (final concentrations of 1:100, 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, 1:51200) was added, with a PBS negative control in column 1, and incubated at 37°C for 1 h; HRP-labeled goat anti-mouse IgG (1:1000 dilution) and HRP-labeled goat anti-mouse IgG1 (1:1000 dilution) were added respectively. (0.000 dilution), 0.1 mL / well, incubate at 37℃ for 40 min; wash plate with PBST, add substrate, 0.1 mL / well, incubate at 37℃ in the dark for 15 min; stop the reaction by adding 50 μL 2mol / L H2SO4 to each well, and measure the A450 OD value using a microplate reader. The highest sample dilution where the OD value of the test well / negative control OD value is >2.1 times is defined as the antibody titer.
[0061] 9. Flow cytometry (FCM) detection of CD4+ secreted by mouse spleen for IFN-γ + T and CD8 + T lymphocytes
[0062] After blood collection, mice were euthanized by cervical dislocation, and their spleens were harvested to prepare single-cell suspensions. The lymphocyte separation solution was prepared strictly according to the instructions, and the final cell concentration was adjusted to 2 × 10⁻⁶. 6 Cells / mL. Take 100 μL of cell suspension and add it to 1 mL of culture medium. Stimulate with 2 μg / mL Ag85B protein and culture for 24 h. Centrifuge at 500g for 5 min at room temperature, discard the supernatant, resuspend the cells in 100 μL of flow cytometry staining solution, and add 4 μL LeFluor450-CD3, 0.5 μL FITC-CD4, and 1.25 μL... PE-CD8 cells were incubated at 4°C in the dark for 30 min. 400 μL of flow cytometry staining solution was added, and the cells were centrifuged at 400 g for 5 min at room temperature. The supernatant was discarded, and 500 μL of cell permeabilizing agent was added to resuspend the cells. The cells were incubated at 4°C in the dark for 1 h, and centrifuged at 400 g for 5 min at room temperature. The cells were then centrifuged at 300 g for 5 min at room temperature. The supernatant was discarded, and the cells were resuspended in 100 μL of flow cytometry staining solution. 2.5 μL of APC-IFN-r antibody was added, and the cells were incubated at room temperature in the dark for 30 min. 400 μL of cell permeabilizing washing solution was added, and the cells were centrifuged at 300 g for 5 min at room temperature. The supernatant was discarded, and the cells were resuspended in 300 μL of flow cytometry staining solution before being analyzed.
[0063] 10. Spleen lymphocyte proliferation experiment
[0064] The cell density prepared in the above 9 methods was 2×10⁹ / L. 6Lymphocytes were seeded at a concentration of 2 μg / mL in 96-well plates. Each experimental well was stimulated with 2 μg / mL Ag85B protein, while no protein was added to the negative control wells, and no lymphocytes were seeded in the zeroing wells. Six replicates were set up, and the plates were incubated at 37°C for 24 h. Four h before the end of the incubation period, 10 μL of CCK8 solution was added to each well. After incubation, the OD value at 450 nm was measured using a microplate reader, and the lymphocyte proliferation stimulation index (Simulation Index SI) was calculated using the formula: Experimental group OD value / Control group OD value.
[0065] 11. Culture and infection experiment of Mycobacterium tuberculosis H37Ra
[0066] H37Ra, preserved in Löwenstein-Gödel, was inoculated into 7H9 liquid medium (containing 100 g / L LOADC) and cultured at 37°C with shaking for 3 weeks. The bacteria were then collected by centrifugation at 5000 rpm for 10 min and stored at -20°C for later use. After 42 days of normal feeding, the H37Ra-infected group was treated with a dose of 10... 6 CFU / mouse H37Ra was administered via tail vein infection. For mice in the pcD-sRv1886c immunized + H37Ra infected group, immunization was performed via intramuscular injection in the thigh (100 μg / mouse), once weekly for three consecutive weeks. Forty-two days after the first immunization, mice were infected via tail vein infection using the same dose of H37Ra as the PBS + H37Ra infected group. Twenty-eight days after infection, mice in all groups were euthanized by cervical dislocation. Lung tissue was fixed in formaldehyde for 24 hours, then embedded in paraffin and sectioned for acid-fast staining to observe the number of tuberculosis bacteria in the lung tissue sections.
[0067] 12. Statistical Analysis
[0068] GraphPad-Prism 5 statistical plotting software and SPSS 20.0 statistical analysis software were used to analyze and process the experimental data. Quantitative data are expressed as mean ± standard deviation. For normally distributed quantitative data with homogeneous variances, a two-sample t-test was used for comparisons between two groups. For log-normally distributed data—antibody titer detection—a t-test was performed after logarithmic transformation. Flow cytometry results were analyzed using Flowjo software. P < 0.05 was considered statistically significant.
[0069] II. Results
[0070] 1. Enzyme Digestion Identification of Eukaryotic Expression Plasmid: The double digestion (HindIII and Xbal) product of the eukaryotic recombinant expression plasmid pcD-sRv1886c was analyzed by 1% agarose gel electrophoresis. A band of approximately 1000 bp was observed, consistent with the expected size (963 bp). Figure 1 The gene sequencing results were completely consistent with the HSV2gD signal peptide gene and the M.tb Rv1886c gene sequence, indicating that the plasmid was constructed correctly.
[0071] 2. Expression of recombinant proteins
[0072] Forty-eight hours after transfection of CHO cells with the recombinant plasmid pcD-sRv1886c, the cell supernatant was collected for Western blot analysis. The results showed a band at approximately 35 kDa, consistent with the predicted size, while the empty vector did not produce this band. Figure 2 .
[0073] 3. Effects of recombinant plasmids on serum IgG and IgG1 antibody titers
[0074] Indirect ELISA results showed that on day 14 post-immunization, specific IgG and IgG1 antibodies were detected in the serum of immunized mice, with antibody titers of 1:1720 and 1:460, respectively; on day 28, the IgG and IgG1 antibody titers were 1:5760 and 1:2560, respectively; and on day 42, the IgG and IgG1 antibody titers were 1:6080 and 1:2720, respectively. (See attached data). Figure 3 The results showed that the pcD-sRv1886c plasmid could sustainably induce humoral immunity.
[0075] 4. Plasmids on CD4 cells that secrete IFN-γ + T and CD8 + The effect of T cells
[0076] FCM results showed that CD3+CD4 in the pcD-sRv1886c immunization group and the PBS group + IFN-γ + The cell proportions were 2.03% ± 0.23% and 0.14% ± 0.02%, respectively, both with highly significant differences (p < 0.001). (CD3+CD8) + IFN-γ + The cell proportions were 1.05% ± 0.11% and 0.13% ± 0.01%, respectively, with significant differences (p < 0.01). (See attached table). Figure 4 .
[0077] 5. Effects of recombinant plasmids on the proliferation of splenic lymphocytes
[0078] The results showed that spleen lymphocytes in the pcD-sRv1886c immunization group exhibited significant proliferative capacity after stimulation with the Ag85B specific antigen. The spleen lymphocyte proliferation stimulation index in the pcD-sRv1886c immunization group was 5.02, which was statistically significant compared with the PBS group (P<0.01). Figure 5 .
[0079] 6. Experiment on the killing effect of recombinant plasmid on Mycobacterium tuberculosis H37Ra
[0080] Four weeks after H37Ra infection in mice, the bacterial count (Gram staining red) was significantly reduced in the pcD-sRv1886c immunization + H37Ra infection group compared to the PBS + H37Ra infection group. Figure 6 .
[0081] In summary, the results of this invention demonstrate the successful construction of the eukaryotic expression plasmid pcD-sRv1886c and the detection of specific expression of Ag85B protein. This invention preliminarily evaluated the humoral and cellular immune responses induced by intramuscular immunization with the pcD-sRv1886c recombinant plasmid at an immunization dose of 50 μg / animal. Fourteen days post-immunization, the pcD-sRv1886c recombinant plasmid induced the production of IgG and IgG1 specific antibodies, and the antibody titers of IgG and IgG1 increased over time. The IgG and IgG1 titers on day 42 were significantly higher than those on day 28, indicating that Ag85B stimulates a sustained humoral immune response. Since *M. tb.* is an intracellular parasite, cellular immunity against *M. tb.* infection is crucial. IFN-γ is mainly produced by activated T cells and can upregulate the activity of NK cells and CD8+ T cells. The results of this study show that 42 days after immunization, the pcD-sRv1886c recombinant plasmid can effectively induce CD4+ secretion of IFN-γ. + T and CD8 + T cells accounted for 2.03% and 1.05%, respectively. Furthermore, this plasmid could stimulate the proliferation of splenic lymphocytes, with a proliferation stimulation index of 5.02, indicating that the plasmid can effectively induce and promote cellular immune responses. The immune response stimulated by the protein expressed by the plasmid pcD-sRv1886c constructed in this invention has a significant killing effect on Mycobacterium tuberculosis H37Ra infection.
[0082] It should be noted that the Ag85B DNA vaccine prepared by this invention can also be used in model organisms closely related to humans, such as rats, rabbits, pigs, and dogs. Therefore, the Ag85B DNA vaccine prepared by this invention has the potential for human application.
[0083] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.
[0084] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of a Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of drugs for the prevention of pulmonary tuberculosis, characterized in that, The Mycobacterium tuberculosis Ag85B DNA vaccine is prepared by first synthesizing the HSV2gD signal peptide gene sequence and a partial Rv1886c gene sequence into nucleotide chains, and then linking them to the vector pcDNA3.1+. Hind Ⅲ / Xbal In between, obtain pcD-sRv1886c The plasmid is the Mycobacterium tuberculosis Ag85B DNA vaccine; The HSV2gD signal peptide gene sequence is shown in SEQ ID NO.1; The partial gene sequence of Rv1886c is shown in SEQ ID NO.2; The nucleotide chain gene sequence is shown in SEQ ID NO.
3.
2. The application of the Mycobacterium tuberculosis Ag85B DNA vaccine according to claim 1 in the preparation of drugs for the prevention of pulmonary tuberculosis, characterized in that, The Mycobacterium tuberculosis Ag85B DNA vaccine is formulated with pharmacologically acceptable excipients.
Citation Information
Patent Citations
Mycobacterial antigen composition
CN106102768A
Genes of IL-12p40 subunit mutated for improving theactivity of IL-12 and use thereof for DNA vaccineadjuvant
KR1020010103577A