Rice RNA epigenetic modification related gene osref and its application in improving yield and stress resistance

Abstract

The application discloses an OsREF protein, a coding gene and application thereof. The protein is any one of the following: (a1) a protein with an amino acid sequence shown in sequence 2; (a2) a protein with the amino acid sequence shown in sequence 2 after substitution, deletion and / or addition of one or more amino acid residues and with the same function; (a3) a protein with more than 80% identity with the amino acid sequence defined in any one of (a1)-(a2) and with the same function; and (a4) a fusion protein obtained after connecting a tag to the end of the protein defined in any one of (a1)-(a3). The protein can be used for improving various traits of plants.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to OsREF protein, its encoding gene and application. BACKGROUND

[0002] Rice (Oryzasativa) is one of the important food crops, feeding about one-half of the world's population. In the 1960s, the promotion of semi-dwarf breeding made the world's rice production significantly improved.

[0003] In the past 30 years, although the utilization of heterosis and the breeding of new varieties have made great progress in improving rice yield, the yield improvement rate still cannot meet the growing demand for food by the increasing population. It is estimated that the population will reach 8.9 billion in 2050, which means that food production needs to be increased by 50% in 2050. In the face of the grim situation of rapid population growth, environmental degradation, and decreasing arable land, how to effectively improve rice yield has become a very important task in agricultural production.

[0004] And stress is the main reason for the reduction of grain yield and quality in China, which seriously restricts the sustainable development of agriculture in our province and even the whole country. In the current understanding, resistance and high yield are often incompatible. However, the goal of laboratory researchers is to "get both" - combining reality and demand, exploring crop resistance gene resources, and cultivating new varieties with resistance and high yield and quality.

[0005] Epigenetics refers to the occurrence of heritable changes in gene expression without changing the sequence of DNA, RNA or protein. Methylation can occur on DNA and RNA, and is involved in growth and development, gene expression regulation, response to environmental signals, and other aspects, and is the basis of biological trait diversity. DNA methylation and mRNA methylation are the research hotspots of new epigenetic modifications. At present, the intelligent design breeding system centered on epigenetic theory and technology provides a new way for cultivating excellent crop varieties. SUMMARY

[0006] One of the purposes of the present application is a protein.

[0007] The present application provides a protein, which is any one of the following proteins,

[0008] (a1) the protein with the amino acid sequence shown in SEQ ID NO: 2;

[0009] (a2) the protein with the amino acid sequence shown in SEQ ID NO: 2 after substitution, deletion and / or addition of one or more amino acid residues and having the same function;

[0010] (a3) is a protein that has more than 80% identity with any of the amino acid sequences defined in (a1)-(a2) and has the same function;

[0011] (a4) A fusion protein obtained by attaching a tag to the end of any of the proteins defined in (a1)-(a3).

[0012] The protein mentioned above was named OsREF protein.

[0013] Biomaterials related to the aforementioned proteins also fall within the scope of protection of this invention, and such biomaterials are any of the following:

[0014] c1) The nucleic acid molecule that encodes the above protein;

[0015] c2) An expression cassette containing the nucleic acid molecule described in c1);

[0016] c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);

[0017] c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3);

[0018] c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2);

[0019] c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2);

[0020] c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2);

[0021] c8) Reduce or inhibit the expression of nucleic acid molecules described in c1);

[0022] c9) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in c8).

[0023] Optionally, based on the aforementioned biological materials,

[0024] c1 refers to any of the following DNA molecules:

[0025] d1) The nucleotide sequence is the DNA molecule shown in Sequence 1 of the sequence listing;

[0026] d2) The coding sequence is the DNA molecule shown in sequence 3 of the sequence listing;

[0027] d3) has 90% or more identity with the nucleotide sequence defined by d1) or d2), and is derived from rice and is a DNA molecule encoding the protein of claim 1;

[0028] d4) Hybridizes under stringent conditions to a nucleotide sequence defined by d1) or d2) and encodes a DNA molecule that encodes the protein of claim 1.

[0029] Optionally, the recombinant vector described in c3) is a plasmid having a DNA molecule as shown in sequence 1 or sequence 3, such as the recombinant plasmid OE-REF prepared in the following examples.

[0030] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0031] In the aforementioned proteins, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0032] In this article, identity refers to the similarity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage.

[0033] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0034] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0035] The stringent conditions can be hybridization and washing of the membrane at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0036] The applications of the aforementioned proteins also fall within the scope of protection of this invention, specifically any of the following applications:

[0037] (1) Regulating plant developmental traits;

[0038] (2) Regulating the chlorophyll content of plants;

[0039] (3) Regulate the level of plant RNA epigenetic modification.

[0040] The application of the aforementioned biomaterials also falls within the scope of protection of this invention, specifically in any of the following applications:

[0041] (1) Regulating plant developmental traits;

[0042] (2) Regulating the chlorophyll content of plants;

[0043] (3) Regulate the level of plant RNA epigenetic modification;

[0044] (4) Plant breeding.

[0045] Plant breeding can be used to cultivate plants with low chlorophyll expression.

[0046] Optionally, according to the above application, the plant developmental trait is selected from at least one of plant height, yield, and salt stress tolerance.

[0047] The present invention also provides a method for plant breeding, wherein the method is M1, M2 or M3, wherein M1 includes increasing and / or enhancing the expression of the coding gene of the above-mentioned protein and / or the content and / or activity of the above-mentioned protein in the starting plant, to obtain a plant having at least one of the following characteristics:

[0048] 1) Compared to the original plant, the plant height is increased;

[0049] 2) Compared to the starting plant, the plant yield increased;

[0050] 3) Compared with the starting plant, the plant's salt stress tolerance was improved;

[0051] 4) Compared with the original plant, the chlorophyll content of the plant is increased;

[0052] 5) Compared with the starting plant, the level of epigenetic modification of plant RNA was increased.

[0053] The enhancement and / or increase of the expression of the coding gene of the aforementioned protein in the starting plant may include introducing a substance into the starting plant that enhances and / or increases the expression of the coding gene of the aforementioned protein, such as the nucleic acid molecule described in c1), the expression cassette described in c2), the recombinant vector described in c3), and / or the recombinant microorganism described in c4).

[0054] The M2 includes inhibiting or reducing the expression of the coding gene for the aforementioned protein and / or the content and / or activity of the aforementioned protein in the starting plant, to obtain a plant having at least one of the following characteristics:

[0055] 1) Compared to the original plant, the plant height is reduced;

[0056] 2) Compared to the starting plant, the plant yield is reduced;

[0057] 3) Compared with the starting plant, the plant's salt stress tolerance was reduced;

[0058] 4) Compared to the original plant, the chlorophyll content of the plant is reduced;

[0059] 5) Compared with the starting plant, the level of epigenetic modification of plant RNA was reduced.

[0060] The inhibition or reduction of the expression of the coding gene of the above-mentioned protein in the starting plant may include introducing a substance into the starting plant that reduces and / or decreases the expression of the coding gene of the above-mentioned protein, such as the nucleic acid molecule described in c8), the expression cassette described in c9), the recombinant vector, or the recombinant microorganism.

[0061] The M3 includes either a deletion of G at position 210 or an insertion of A after position 210 in the coding sequence as described in Sequence 3 of the starting plant genomic DNA to obtain a plant having at least one of the following characteristics:

[0062] 1) Compared to the original plant, the plant height is reduced;

[0063] 2) Compared to the starting plant, the plant yield is reduced;

[0064] 3) Compared with the starting plant, the plant's salt stress tolerance was reduced;

[0065] 4) Compared to the original plant, the chlorophyll content of the plant is reduced;

[0066] 5) Compared with the starting plant, the level of epigenetic modification of plant RNA was reduced.

[0067] The present invention also provides a method for preparing transgenic plants, wherein the preparation method is M4 or M5, wherein M4 includes the step of introducing a substance into the starting plant to enhance and / or increase the expression of the coding gene of the above-mentioned protein and / or the content and / or activity of the above-mentioned protein, thereby obtaining transgenic plants;

[0068] Compared with the original plant, the transgenic plant has at least one of the following characteristics:

[0069] 1) Compared with the original plant, the transgenic plant has increased plant height;

[0070] 2) Compared to the original plant, the transgenic plant yielded increased;

[0071] 3) Compared with the original plant, the transgenic plant showed increased salt stress tolerance;

[0072] 4) Compared with the original plant, the transgenic plant has increased chlorophyll content;

[0073] 5) Compared with the original plant, the transgenic plant showed an increased level of RNA epigenetic modification;

[0074] The M5 includes the step of introducing a substance into the starting plant that reduces and / or decreases the expression of the coding gene of the above-mentioned protein and / or the content and / or activity of the above-mentioned protein to obtain a transgenic plant.

[0075] Compared with the original plant, the transgenic plant has at least one of the following characteristics:

[0076] 1) Compared with the original plant, the transgenic plant has a reduced plant height;

[0077] 2) Compared to the original plant, the yield of the transgenic plant was reduced;

[0078] 3) Compared with the original plant, the transgenic plant showed reduced salt stress tolerance;

[0079] 4) Compared with the original plant, the transgenic plant has a lower chlorophyll content;

[0080] 5) Compared with the original plant, the transgenic plant showed a lower level of RNA epigenetic modification.

[0081] Any of the above-mentioned plants are monocotyledonous or dicotyledonous. Any of the above-mentioned plants belong to the Poaceae family. Any of the above-mentioned plants belong to the Oryza genus. Any of the above-mentioned plants are rice, such as Nipponbare rice.

[0082] The OsREF protein and related biomaterials provided by this invention can be used to improve various traits of plants and have significant application and promotion value for plant breeding. Attached Figure Description

[0083] Figure 1 To create mutant lines of the OsREF gene in Nipponbare rice using CRISPR-Cas9 editing.

[0084] Figure 2 Photos of mature Nipponbare and mutant plants, and plant height statistics.

[0085] Figure 3 The chlorophyll content of leaves of mature plants of various strains was measured.

[0086] Figure 4 Statistics were compiled on the spike phenotype and plant yield traits (number of grains per spike, seed setting rate, number of 1 / 2 grade branches, and thousand-grain weight) for each line.

[0087] Figure 5 These are the mature grains of each strain.

[0088] Figure 6The OsREF gene expression site, subcellular localization, and GUS histochemical staining were determined.

[0089] Figure 7 To detect the level of RNA epigenetic modification in Nipponbare, mutants, and overexpressing plants.

[0090] Figure 8 This is the result of the salt tolerance test. Detailed Implementation

[0091] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0093] The nucleotide sequence of the OsREF gene is shown in Sequence 1 of the sequence listing. This gene encodes four different transcripts: LOC_Os08g33120.1, LOC_Os08g33120.2, LOC_Os08g33120.3, and LOC_Os08g33120.5. The overexpression material constructed in this invention is based on the protein amino acid sequence encoded by the LOC_Os08g33120.1 transcript, as shown in Sequence 2 of the sequence listing, and its CDS is shown in Sequence 3 of the sequence listing.

[0094] Example 1: Creation of a mutant strain of the Nipponbare rice gene

[0095] I. Construction of recombinant plasmids

[0096] Using BGK032 (purchased from Baige Gene, catalog number BGK032) as the starting vector, the guide RNA sequence corresponding to the target gene OsREF, GCAGAACCAAAGACATGACC, was inserted downstream of the rice OsU6 promoter to obtain the recombinant plasmid REF. The recombinant plasmid sequence REF is shown in Sequence 4 of the sequence listing.

[0097] II. Performing genetic transformation and obtaining regenerated plants

[0098] The recombinant plasmid REF was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. Using the Agrobacterium infection method, the recombinant Agrobacterium was used to genetically transform embryogenic callus tissue of Nipponbare rice. Resistant callus tissue was then screened (resistance screening used 100 mg / L hygromycin), followed by differentiation and regeneration culture, and then rooting culture to obtain regenerated plants.

[0099] III. Obtaining transgenic plants and their progeny

[0100] The regenerated plants obtained in step two were identified as follows: leaves were taken, genomic DNA was extracted, and PCR amplification was performed using primer pairs consisting of primers GP7406-6345-F and GP7406-6345-R. The PCR amplification products were then sequenced.

[0101] GP7406-6345-F: GCACGACACATATTGCGACC.

[0102] GP7406-6345-R:AATGGACTTCTCCCAGCACG.

[0103] Based on the above identification, two homozygous mutant plants (i.e., the mutations on the two chromosomes are consistent) were screened from the regenerated plants obtained in step two, and were named line1 plant and line2 plant, respectively.

[0104] like Figure 1 As shown in Figure A, compared with the genomic DNA of Wildtype, the only difference between line 1 plants and OsREF gene is the deletion of one nucleotide, specifically the deletion of G at position 210 of the nucleotide sequence shown in the CDS sequence of sequence 3; the only difference between line 1 plants and OsREF gene is the insertion of one nucleotide, specifically the insertion of A after position 210 of the nucleotide sequence shown in the CDS sequence of sequence 3.

[0105] Plants from line 1 or line 2 that have been self-pollinated and have their seeds harvested are then cultivated into plants, which are called T1 generation plants. Plants from line 1 that have been self-pollinated and have their seeds harvested are then cultivated into plants, which are called T2 generation plants. Plants from line 1 and their self-pollinated offspring are called line 1 lines. Plants from line 2 and their self-pollinated offspring are called line 2 lines.

[0106] Example 2: Creation of rice Nipponbare OsREF gene overexpression line plant material

[0107] I. Construction of recombinant plasmids

[0108] Using BGV002 as the starting vector (purchased from Baige Gene, catalog number BGV002), the CDS sequence (as shown in Sequence 3) was inserted into the multiple cloning site downstream of the CaMV35S promoter to obtain the recombinant plasmid OE-REF. The sequence of the recombinant plasmid OE-REF is shown in Sequence 5 of the sequence listing.

[0109] II. Performing genetic transformation and obtaining regenerated plants

[0110] The recombinant plasmid was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. Using the Agrobacterium infection method, the recombinant Agrobacterium was used to genetically transform embryogenic callus tissue of Nipponbare rice. Resistant callus tissue was then screened (resistance screening used 100 mg / L hygromycin), followed by differentiation and regeneration culture, and then rooting culture to obtain regenerated plants.

[0111] III. Obtaining transgenic plants and their progeny

[0112] The regenerated plants obtained in step two were then identified as follows:

[0113] Leaves were collected, genomic DNA was extracted, and PCR amplification was performed using primer pairs consisting of primers BS2-F and BS2-R. The PCR amplification products were then sequenced.

[0114] OE-F:ATGACGCACAATCCCAC.

[0115] OE-R:ACGTCGCCGTCCAGCTC.

[0116] Based on the above identification, plants overexpressing the OsREF gene were screened from the regenerated plants obtained in step two and named OE plants.

[0117] OE plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T1 generation plants. T1 generation plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T2 generation plants. OE plants and their self-pollinated offspring are called OE lines.

[0118] Example 3: Comparison of rice Nipponbare OsREF gene mutant lines and gene overexpression lines

[0119] I. Comparison of traits

[0120] The tested plants were: Nipponbare rice (denoted by Nip), T2 generation plants of Line1 (Line1), T2 generation plants of Line2 (Line2), and T2 generation plants of OE (OE).

[0121] The test plants were cultured under parallel field growing conditions. The leaves of the main tillers of each plant were measured directly in the field, and the middle part of each leaf was measured. 30 plants were measured for each line.

[0122] The chlorophyll content of leaves was measured using a Konica Minolta SPAD-502PLUS chlorophyll meter.

[0123] At maturity, the plant height was recorded, and the average height of 30 plants from each line was taken.

[0124] At the rice maturity and harvest period, the panicle phenotype and yield traits of the plants were statistically analyzed, and the average value of 30 plants for each line was taken.

[0125] Mature plants such as Figure 2 As shown in the left figure, the plant height statistics are as follows: Figure 2 As shown in the right figure, the mutants Line1 and Line2 are shorter than the control strain Nipponbare Nip.

[0126] Chlorophyll content determination of leaves of mature plants of various strains as follows: Figure 3 As shown, from left to right, the images depict leaf photographs, relative chloroplast content, and net photosynthetic rate. Within the leaf photographs, from left to right, are the control line Nipponbare (Nip), mutant Line1, mutant Line2, and overexpression line OE. Statistics on relative chloroplast content and net photosynthetic rate are also presented. Compared to Nipponbare, the OsREF gene mutant line showed decreased chloroplast content and net photosynthetic rate, while the OsREF gene overexpression line showed increased chloroplast content and net photosynthetic rate.

[0127] The statistics of ear phenotype and plant yield traits (number of grains per ear, number of 1 / 2-level branches, and thousand-grain weight) for each line are as follows: Figure 4 As shown, the top figure displays the ear phenotypes of the control line Nipponbare (Nip), mutant Line1, mutant Line2, and overexpression line OE. The bottom figure shows the statistics of 1000-grain weight, seed setting rate, number of grains per ear, and number of secondary branches. Data analysis showed that compared with the control line, the mutant and overexpression lines had P < 0.05, indicating that each group of measurements was significantly different from the control line. Specifically, compared with the control line, the mutant showed significantly lower 1000-grain weight, seed setting rate, number of grains per ear, and number of secondary branches, while the overexpression line showed significantly higher 1000-grain weight, seed setting rate, number of grains per ear, and number of secondary branches.

[0128] Figure 5 To compare the mature grain size of each line, data analysis showed that, compared with the control line, the mutant and overexpression lines had a P<0.05, indicating that each group of measurements was significantly different from the control line. Specifically, compared with the control line, the grain size of the mutants was significantly smaller, while that of the overexpression lines was significantly larger.

[0129] II. Detection of OsREF gene expression sites

[0130] The samples used in the following methods were all Nipponbare rice.

[0131] The specific staining method is as follows:

[0132] GUS staining buffer: 22.912g Na2HPO4, 3.722g Na2EDTA, 0.16462g K3Fe(CN)6, 4.89924g KH2PO4, 0.21119g K4Fe(CN)6, 1mL Triton X-100, 100mL methanol, and deionized water to a final volume of 1L. Store at room temperature.

[0133] Rice materials or tissues were fixed with 90% acetone on ice for 15 min, then rinsed twice with staining buffer, placed in staining solution (containing 0.25 mg / mL X-Gluc), vacuumed for 30 min, and stained at 37°C. The staining time was determined based on gene expression levels. After staining, the material was destained with 70% ethanol, observed, and photographed.

[0134] The specific subcellular localization methods are as follows:

[0135] The CDS sequence of OsREF was fused with the PAN580 subcellular localization vector, with green fluorescent protein at the C-terminus. The GFP fusion plasmid was transformed into rice protoplasts, and H2A-mcherry was used as the nuclear marker. The fluorescence signal was detected using a ZEISS LSM980 confocal microscope.

[0136] The specific method for detecting gene expression levels by RT-PCR is as follows:

[0137] RNA samples were extracted from different developmental stages of Nipponbare rice (roots at 3 weeks, aboveground parts, flag leaf, stem, and panicles at 1cm, 4cm, 5cm, 10cm, 15cm, and 20cm), and cDNA was obtained after reverse transcription. UBQ was used as an internal reference gene for quantitative real-time PCR.

[0138] The results are as follows Figure 6 As shown, Figure 6 From top to bottom, the results show subcellular localization, RT-PCR statistical results, and GUS histochemical staining results. RT-PCR and GUS histochemical staining results indicate that the OsREF gene is highly expressed in young panicles. To verify the subcellular localization pattern of OsREF, the p35S::OsREF-GFP vector (i.e., the PAN580 subcellular localization vector fused with the CDS sequence of OsREF) was transiently expressed in rice protoplasts. This showed that the OsREF-GFP fusion protein co-localized with the nuclear marker, indicating that OsREF functions in the nucleus.

[0139] III. Detection of RNA m5C and m6A epigenetic modification levels

[0140] The nucleic acid samples were RNA extracted from T2 generation plants of the Nipponbare rice (represented by Nip), including Line 1, Line 2, and OE, using an RNA extraction kit (TIANGEN, DP432).

[0141] Dot-blot hybridization is a rapid nucleic acid hybridization technique for detecting specific nucleic acid (DNA or RNA) molecules. This method involves directly transferring nucleic acid samples onto an appropriate hybridization membrane, and then utilizing the specific binding of antibodies to nucleic acid modifications to achieve qualitative detection of specific modifications in the nucleic acid sample.

[0142] The specific operating steps are as follows:

[0143] (1) Set up a nucleic acid concentration gradient in a 200 μl PCR tube using ddH2O. After denaturing at 95 °C for 3 min in the PCR instrument, immediately remove the PCR tube and place it on ice for at least 3 min.

[0144] (2) Place an NC membrane of appropriate size in a plastic culture dish and spot 1 μl of RNA sample onto the NC membrane.

[0145] (3) After the membrane dries, adjust the UV crosslinker to 200 KJ / cm2, open the lid of the culture dish and place it in the crosslinker for UV crosslinking. It can be taken out after 20 seconds.

[0146] (4) Add 20ml of 5% skim milk powder to the dish and seal for 1 hour.

[0147] (5) Discard the skim milk powder in the culture dish and wash the membrane 3 times with PBST solution for 1 minute each time.

[0148] (6) Dilute the anti-m6A (Synaptic Systems, catalog number: 202003) / anti-m5C (Diagenode, catalog number: C15200081-100) antibody with 5 ml PBST solution at a ratio of 1:1000, add it to the culture dish, and incubate overnight at 4°C.

[0149] (7) Recover the primary antibody into a centrifuge tube and store at 4°C. Wash the membrane three times with PBST solution for 1 min each time.

[0150] (8) Dilute the horseradish peroxidase-labeled IgG antibody (Kangwei Century, catalog number: CW0103S) with 10ml PBST solution at a ratio of 1:5000, add it to a culture dish, and incubate at room temperature for 1h.

[0151] (9) Wash the membrane three times with PBST solution, 1 min each time.

[0152] (10) After wiping the liquid on the membrane dry with a clean paper, take 500 μl of ECL luminescent substrate solution A and solution B (Biorad, catalog number: 1705061) and mix them thoroughly. Then immerse the membrane in the luminescent substrate and react for 2 min.

[0153] (11) Use a chemiluminescence detection imaging system to detect signals and take pictures for analysis.

[0154] The results are as follows Figure 7 As shown, from top to bottom, the results indicate the detection of RNA m5C and RNA m6A modification levels. The results show that the modification of RNA m5C and m6A is significantly downregulated in OsREF mutants Line 1 and Line 2, and upregulated in OsREF overexpressing plants OE.

[0155] IV. Salt Tolerance Testing of Transgenic Plants

[0156] To investigate the response of the OsREF gene to salt stress, germinated seeds were arranged in 96-well plates, with 30 seedlings per line. 250 mL of rice nutrient solution (Coolaber, NSP1040) was added to the bottom of the plate, and the solution was changed every three days. After three weeks of normal growth, the OsREF mutants Line1 and Line2, and the OsREF overexpressing plants OE and Nip were treated with a 150 mM NaCl solution as controls. Photos were taken after 7 days of treatment, and plant survival rates were measured.

[0157] The results are as follows Figure 8 As shown, compared with Nip plants (90% survival rate), the OsREF mutant exhibits a salt-intolerant phenotype with a survival rate of 10-20%, while the OE mutant exhibits a salt-tolerant phenotype with a survival rate of 95%.

[0158] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. An application of a protein, characterized in that: For any of the following applications, (1) Regulating plant yield; (2) Regulating plant salt stress tolerance; (3) Regulate the chlorophyll content of plants; The protein is any one of the following: (a1) The amino acid sequence of the protein is shown in sequence 2; (a2) The fusion protein obtained by attaching a tag to the end of the protein defined in (a1); The plant in question is rice.

2. The application of biomaterials, characterized by: For any of the following applications, (1) Regulating plant yield; (2) Regulating plant salt stress tolerance; (3) Regulate the chlorophyll content of plants; The biomaterial is any one of the following: c1) A nucleic acid molecule encoding the protein described in claim 1; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2); c8) Reduce or inhibit the expression of nucleic acid molecules described in c1); c9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in c8); The plant in question is rice.

3. The application according to claim 2, characterized in that: c1) The nucleic acid molecule is the DNA molecule shown in sequence 3.

4. A method for plant breeding, characterized by: The method is M1, M2, or M3. M1 includes increasing and / or enhancing the expression of the gene encoding the protein of claim 1 and / or the content of the protein of claim 1 in the starting plant, to obtain a plant having at least one of the following characteristics: 1) Compared to the starting plant, the plant yield increased; 2) Compared with the original plant, the plant's salt stress tolerance was improved; 3) Compared with the original plant, the chlorophyll content of the plant is increased; The M2 includes inhibiting or reducing the expression of the gene encoding the protein of claim 1 and / or the content of the protein of claim 1 in the starting plant, to obtain a plant having at least one of the following characteristics: 1) Compared to the original plant, the plant height is reduced; 2) Compared to the starting plant, the plant yield is reduced; 3) Compared with the starting plant, the plant's salt stress tolerance was reduced; 4) Compared to the original plant, the chlorophyll content of the plant is reduced; The M3 includes deleting G at position 210 or inserting A after position 210 in the coding sequence as described in sequence 3 of the starting plant genomic DNA to obtain a plant having at least one of the following characteristics: 1) Compared to the original plant, the plant height is reduced; 2) Compared to the starting plant, the plant yield is reduced; 3) Compared with the starting plant, the plant's salt stress tolerance was reduced; 4) Compared to the original plant, the chlorophyll content of the plant is reduced; The plant in question is rice.

5. A method for preparing transgenic plants, characterized in that: The preparation method is M4 or M5. The M4 step includes introducing a substance into the starting plant that enhances and / or increases the expression of the gene encoding the protein of claim 1 and / or the content of the protein of claim 1, thereby obtaining a transgenic plant; the transgenic plant, compared with the starting plant, has at least one of the following characteristics: 1) Compared to the original plant, the transgenic plant yielded increased; 2) Compared with the original plant, the transgenic plant showed increased salt stress tolerance; 3) Compared with the original plant, the transgenic plant has increased chlorophyll content; The M5 step includes introducing a substance into the starting plant that reduces and / or decreases the expression of the gene encoding the protein of claim 1 and / or the content of the protein of claim 1, thereby obtaining a transgenic plant; the transgenic plant, compared with the starting plant, has at least one of the following characteristics: 1) Compared with the original plant, the transgenic plant has a reduced plant height; 2) Compared to the original plant, the yield of the transgenic plant was reduced; 3) Compared with the original plant, the transgenic plant showed reduced salt stress tolerance; 4) Compared with the original plant, the transgenic plant has a lower chlorophyll content; The plant in question is rice.

Images