Specific primer of molecular marker of sheep fecundity related gene INHA and application of specific primer
By designing specific primers to detect INHA gene mutations in the genomes of Gobi Short-tailed Sheep and Ujumqin Sheep, and screening CC genotypes as breeding parents, the gap in research on the correlation between reproductive capacity and breeding capacity of distinctive sheep breeds was filled, and a significant improvement in the trait of multiple births was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INNER MONGOLIA UNIVERSITY
- Filing Date
- 2026-04-12
- Publication Date
- 2026-05-15
AI Technical Summary
Existing studies have failed to effectively reveal the association between INHA gene polymorphism and fertility in distinctive sheep breeds such as Gobi Short-tailed Sheep and Ujumqin Sheep, thus affecting breeding efficiency.
Specific primers were designed to detect the T→C mutation at 180bp in the 3′UTR region of the INHA gene in the genomes of Gobi Short-tailed Sheep and Ujumqin Sheep. Individual genotypes were determined by PCR amplification and sequencing, and CC genotypes were screened as breeding parents to improve reproductive capacity.
This has effectively improved the reproductive capacity of Gobi short-tailed sheep and Ujumqin sheep, increased the number of lambs per litter through genotype screening, and enhanced the scientific nature and efficiency of breeding.
Smart Images
Figure CN122038602A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology, specifically relating to specific primers for molecular markers of the sheep reproductive gene INHA and their applications. Background Technology
[0002] The Gobi Short-tailed Sheep is a new short-fat-tailed meat sheep breed selected from the Sunite sheep (Gobi Mongolian sheep) breed, retaining the original breed's characteristics of delicious and juicy meat. This breed is characterized by low tail fat weight (averaging about 1 kg), high production performance, and strong adaptability. By reducing tail energy consumption, feeding efficiency is increased by 50%, effectively alleviating grassland ecological pressure while maintaining carrying capacity.
[0003] The Ujumqin sheep originates from the Ujumqin grassland in eastern Xilingol League, Inner Mongolia, mainly distributed in East Ujumqin Banner and West Ujumqin Banner. Suitable for year-round grazing, they are characterized by rapid weight gain, strong fat accumulation, high meat yield, and early sexual maturity. They are well-suited for grazing and fattening during the peak pasture growth period, or for planned lamb production. Furthermore, Ujumqin sheep are excellent recipients for purebred embryo transfer, producing offspring with robust constitutions, strong disease resistance, and good adaptability. The Ujumqin sheep breed has been selectively bred locally for a long period, resulting in a superior population.
[0004] The INHA (Inhibin Subunit Alpha) gene in sheep is located on chromosome 2, containing two exons and a coding region of 1083 bp, encoding 361 amino acids. Its encoded product is the α subunit essential for the formation of inhibin hormone activity. INHA primarily regulates the synthesis and secretion of pituitary FSH through negative feedback, playing a central role in maintaining reproductive axis homeostasis and regulating follicle development. In female reproductive regulation, inhibin is mainly synthesized and secreted by ovarian granulosa cells. Its core physiological function is to act on the anterior pituitary gland through a negative feedback mechanism, specifically inhibiting the synthesis and secretion of follicle-stimulating hormone (FSH), thereby precisely regulating follicle development, selection, and dominance. Furthermore, INHA also acts as an important local regulatory factor within the follicle, participating in the regulation of granulosa cell proliferation, differentiation, and steroid hormone production through paracrine or autocrine mechanisms.
[0005] Existing research has focused on traditional breeds such as the Small-tailed Han sheep and the Sunite sheep, while research on the association between INHA gene polymorphism and fertility in distinctive sheep breeds such as the Gobi Short-tailed sheep and the Ujumqin sheep is still lacking. Summary of the Invention
[0006] The purpose of this invention is to provide a specific primer for a molecular marker of the reproductive-related gene INHA in sheep (Gobi short-tailed sheep and Ujumqin sheep).
[0007] Another object of the present invention is to provide applications of the above-mentioned specific primers.
[0008] This invention uses DNA sequencing technology to detect whether a T→C mutation exists at 180 bp in the 3′UTR region of the INHA gene in the sheep genome (Gobi Short-tailed Sheep and Ujumqin Sheep). By determining the genotype of Gobi Short-tailed Sheep and Ujumqin Sheep individuals at this locus, single nucleotide polymorphism (SNP) detection is performed on the INHA gene c.*180 T>C to compare the polymorphism of INHA gene c.*180 T>C in Gobi Short-tailed Sheep and Ujumqin Sheep breeds, and to determine that c.*180 T>C is a molecular marker associated with the polyfertility trait of Gobi Short-tailed Sheep and Ujumqin Sheep.
[0009] The nucleotide sequence of the INHA gene c.*180 T>C in Gobi Short-tailed Sheep and Ujumqin Sheep is NC_056055.1 in the region from 221497625bp to 221497887bp on chromosome 2 of sheep.
[0010] Specific primers for molecular markers of the sheep fertility-related gene INHA according to a specific embodiment of the present invention, the primer sequences of which are as follows: SEQ ID NO.1: 5'-GCTTGCATCTAAGGGAATCC-3'; SEQ ID NO. 2: 5'-TGAGGCTAAGTGACGTGAGA-3'.
[0011] Preferably, the sheep is a Gobi short-tailed sheep or a Ujumqin sheep.
[0012] The specific primers for the molecular marker of the reproductive gene INHA of the present invention can be used in kits for detecting the polyfertility trait of Gobi Short-tailed Sheep or Ujumqin Sheep, or in assisting the breeding of Gobi Short-tailed Sheep and Ujumqin Sheep.
[0013] According to a specific embodiment of the present invention, a method for improving the fertility of Gobi Short-tailed Sheep and Ujumqin Sheep includes the step of amplifying the genomic DNA of Gobi Short-tailed Sheep and Ujumqin Sheep using the aforementioned specific primers.
[0014] Specifically, according to a specific embodiment of the present invention, a method for improving the fertility of Gobi short-tailed sheep and Ujumqin sheep includes the following steps: (1) Extract genomic DNA from the sheep to be tested; (2) Using the sheep genomic DNA extracted in step (1) as a template, PCR amplification was performed using specific primers to obtain the amplification product; (3) Determine the genotype of the 180th nucleotide in the 3′UTR region of the INHA gene in the sheep genome of the amplified product, and select sheep with the CC genotype at the 180th nucleotide in the 3′UTR region of the INHA gene as the parent for breeding.
[0015] The detection method for the c.*180 T>C SNP of the INHA gene in the genomes of Gobi Short-tailed Sheep and Ujumqin Sheep is as follows: A nucleotide fragment from position 221497625bp to 221497887bp of the INHA gene in Gobi short-tailed sheep and Ujumqin sheep (GenBank Accession Number NC_056055.1) was amplified using PCR, and the amplified product was sequenced. If a single peak appears at position 221,497,810 of chromosome 2 and the genotype is T, then the genotype is TT. If a peak appears at the position of the 221,497,810th base on chromosome 2, the genotype is TC. If a single peak appears at the position of the 221,497,810th base on chromosome 2 and the genotype is C, the genotype is CC.
[0016] The average number of lambs born to Gobi short-tailed sheep and Ujumqin sheep with the CC genotype is higher than that of sheep with the CT genotype, while the average number of lambs born to Ujumqin sheep with the CT genotype is higher than that of sheep with the TT genotype.
[0017] In this invention, the reproductive capacity of Gobi short-tailed sheep or Ujumqin sheep is specifically reflected in the number of lambs produced per litter.
[0018] According to the specific embodiments of the present invention, the method for improving the reproductive capacity of Gobi short-tailed sheep or Ujumqin sheep, in step (2) PCR amplification, the total volume of the amplification system is 20 μL, including 1 μL each of upstream and downstream primers, 1 μL of template, 10 μL of premixed solution, and 7 μL of deionized water.
[0019] According to the specific embodiments of the present invention, the method for improving the reproductive capacity of Gobi short-tailed sheep or Ujumqin sheep, step (2) PCR amplification program is as follows: 95℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 56℃ annealing for 15 s, 68℃ extension for 21 s, 35 cycles, 68℃ extension for 7 min, storage at 4℃, and then sequencing.
[0020] The beneficial effects of this invention are: This invention reveals for the first time the association between INHA gene polymorphism and fertility in two important sheep breeds, Gobi Short-tailed Sheep and Ujumqin Sheep. The nucleotide sequence of INHA gene c.*180 T>C is NC_056055.1. Molecular markers associated with the polyfertility trait in Gobi Short-tailed Sheep and Ujumqin Sheep are found in the region from 221497625bp to 221497887bp on chromosome 2 of sheep.
[0021] This invention designs specific primers and uses DNA sequencing technology to detect whether there is a T→C mutation at 180bp in the 3′UTR region of the INHA gene in the genomes of Gobi Short-tailed Sheep and Ujumqin Sheep. This allows for the determination of the genotype of individual Gobi Short-tailed Sheep and Ujumqin Sheep at this locus, enabling the detection of single nucleotide polymorphism (SNP) of the INHA gene c.*180 T>C, and comparison of the polymorphism of INHA gene c.*180 T>C in Gobi Short-tailed Sheep and Ujumqin Sheep breeds.
[0022] Statistical results show that the specific primers of this invention can detect the molecular marker, and thus can be used to assist in the breeding of Gobi Short-tailed Sheep or Ujumqin Sheep, increase the number of lambs born in Gobi Short-tailed Sheep and Ujumqin Sheep. The method of this invention can be used as an effective method to assist in improving the polyfertility trait of Gobi Short-tailed Sheep or Ujumqin Sheep. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This is a sequencing result diagram of INHA NC_056055.1:c.*180 T>C in this invention; Figure 2 This is a PCR product diagram of INHA NC_056055.1:c.*180 T>C of the present invention; Figure 3 This is the genotyping electrophoresis diagram of INHA NC_056055.1:c.*180 T>C in this invention. Detailed Implementation
[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0026] Example 1: Establishing a method for detecting the polyfertility trait in Gobi short-tailed sheep and Ujumqin sheep. 1) Template material preparation Blood samples were collected from Gobi short-tailed sheep and Ujumqin sheep, and the number of lambs and parity were recorded. The Gobi short-tailed sheep were collected from Siziwang Banner, Ulanqab City, Inner Mongolia, and the Ujumqin sheep were collected from East Ujumqin Banner, Xilingol League, Inner Mongolia. The blood samples were stored in anticoagulant tubes for later use.
[0027] 2) Sequencing of PCR products Twelve Gobi short-tailed sheep (six consecutive twin-lambing ewes and six consecutive single-lambing ewes) and twelve Ujumqin sheep (six consecutive twin-lambing ewes and six consecutive single-lambing ewes) were randomly selected for PCR product sequencing. The SNP site located in the coding region of the INHA gene, namely NC_056055.1:c.*180 T>C, was found.
[0028] 3) Primer design Based on the sheep gene sequence reported in GeneBank (GeneBank accession number: NC_056055.1), this invention designed upstream and downstream primers F and R. Through comparison and screening, the final primer sequences are as follows: F:5'-GCTTGCATCTAAGGGAATCC-3'; R:5'-TGAGGCTAAGTGACGTGAGA-3'.
[0029] Using genomes extracted from experimental materials of Gobi short-tailed sheep and Ujumqin sheep as templates, amplification was performed using the primers described above.
[0030] The amplification system for the upstream and downstream primers is consistent, with a total volume of 20 μL, including 1 μL each of the upstream and downstream primers, 1 μL of the template, 10 μL of premix, and 7 μL of deionized water.
[0031] The amplified products were subjected to 35 cycles of pre-denaturation at 95℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 56℃ for 15 s, extension at 68℃ for 21 s, followed by a final extension at 68℃ for 7 min. The amplified products were then stored at 4℃ and sequenced.
[0032] The PCR amplification results of INHA's NC_056055.1:c.*180 T>C are shown below. Figure 2 .
[0033] The nucleotide sequence of the PCR product is shown in SEQ ID NO.3: GCTTGCATCTAAGGGAATCCCACTGATGCCCGAGCCCCCATGGTCACCAGCCTGGAGGAAGGGCAGGCTGCCCGCTCCCTCTCTCTCTGCCCAGAGGCTCCCCTCTCCCCATTCCTGCCGCTTGCATCTAAGGGAATCCAAATGACATAGTGCATATGACTTGGCGTGTCTTCTCAAGCTTC T CTGATAAGTGTTTTTGTCAGGGGTGAGGTCTAGGCCCTGGGAGCATGGGATTGTGGGGTCTCACGTCACTTAGCCTCA.
[0034] See sequencing results Figure 1 If a single peak appears at the position of the 221,497,810th base on chromosome 2 and the genotype is T, then the genotype is TT. If a double peak appears at the position of the 221,497,810th base on chromosome 2, then the genotype is TC. If a single peak appears at the position of the 221,497,810th base on chromosome 2 and the genotype is C, then the genotype is CC.
[0035] Example 2: Statistical analysis of INHA genotype and its relationship with polyfertility traits in Gobi short-tailed sheep and Ujumqin sheep populations. Genetic testing was performed on Gobi short-tailed sheep and Ujumqin sheep using the primers designed in Example 1. The genotype frequencies and allele frequencies of Gobi short-tailed sheep and Ujumqin sheep were calculated. The statistical results are shown in Tables 1 and 2.
[0036] Note: The number in parentheses is the sample size.
[0037] Table 1. Statistical results of genotype and allele frequencies in Gobi short-tailed sheep.
[0038] The results are shown in Table 1. The genotype frequencies of CC, CT and TT in Gobi short-tailed sheep were 0.050, 0.419 and 0.531, respectively. The allele frequencies of C and T were 0.259 and 0.741, respectively, with the T allele being the dominant allele.
[0039] Table 2. Statistical results of genotype and allele frequencies in Ujumqin sheep.
[0040] The results are shown in Table 1. The genotype frequencies of CC, CT and TT in Ujumqin sheep were 0.081, 0.378 and 0.541, respectively. The allele frequencies of C and T were 0.270 and 0.730, respectively, with the T allele being the dominant allele.
[0041] The INHA genotype and its association with the polyfertility traits of Gobi short-tailed sheep and Ujumqin sheep were analyzed. The specific experiments are as follows: (1) Individual genotype analysis was performed on some loci in the selected experimental sample population to calculate allele frequencies and genotype frequencies, and χ² was performed. 2 test.
[0042] (2) Based on the experimental results, the gene frequency and genotype frequency of the locus were calculated, and the Hardy-Weinberg equilibrium chi-square test was performed on the distribution of genotypes at the locus. SPSS 19.0 software was used to analyze the association between the polyfertility trait and genotype in the Ujumqin sheep population. The statistical model included genotype as a fixed effect and rams as a random effect. A mixed linear model (MLM) was constructed as follows: Y = µ + G + R + e Where: Y is the recorded number of lambs; µ is the population mean; G is the genotype effect; R is the ram effect; e is the random residual effect.
[0043] The average number of lambs born to different genotypes in Ujumqin sheep and the standard error are shown in Tables 3 and 4.
[0044] Note: a, c: p < 0.01.
[0045] Table 3. Statistical results of average and standard error of lambing number for different genotypes in Gobi short-tailed sheep.
[0046] The results are shown in Table 3. The CC and CT genotypes had 0.41 and 0.36 more lambs per litter than the TT genotype, respectively. This indicates that the mutation of the C allele to the T allele has a certain impact on the lambing trait of Gobi short-tailed sheep, and the differences in lambing number between different genotypes at this locus are statistically significant. P <0.01). The results indicate that the genetic diversity at this locus can be used to screen for breeding sheep that improve the prolificacy trait of Gobi short-tailed sheep.
[0047] Table 4. Statistical results of the average and standard error of lambing number in Ujumqin sheep with different genotypes.
[0048] The results are shown in Table 4. The CC and CT genotypes had 0.44 and 0.30 more lambs per litter than the TT genotype, respectively. This indicates that the mutation of the C allele to the T allele has a certain impact on the lambing trait of Ujumqin sheep, and the differences in lambing number between different genotypes at this locus are statistically significant. P <0.01). The results indicate that the genetic diversity at this locus can be used to screen for breeding sheep that improve the multiparity trait of Ujumqin sheep.
[0049] Example 3: Methods to improve the reproductive capacity of Gobi Short-tailed Sheep and Ujumqin Sheep The method for improving the fertility of Gobi Short-tailed Sheep or Ujumqin Sheep in this embodiment includes the following steps: (1) Extract genomic DNA from the sheep to be tested. The sheep to be tested are Gobi short-tailed sheep or Ujumqin sheep; (2) Perform PCR amplification using specific primers; The genomes extracted from experimental materials of Gobi short-tailed sheep and Ujumqin sheep were used as templates and amplified using the primers described in Example 1. The total volume of the amplification system was 20 μL, including 1 μL each of upstream and downstream primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water. After 35 cycles of pre-denaturation at 95℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 56℃ for 15 s, extension at 68℃ for 21 s, and extension at 68℃ for 7 min, the product was subjected to the following process: (3) Determine the genotype of the 180th nucleotide in the 3′UTR region of the INHA gene in the genomes of Gobi short-tailed sheep and Ujumqin sheep. If a single peak appears at the position of the 221,497,810th base on chromosome 2 and the genotype is T, then the genotype is TT. If a double peak appears at the position of the 221,497,810th base on chromosome 2, then the genotype is TC. If a single peak appears at the position of the 221,497,810th base on chromosome 2 and the genotype is C, then the genotype is CC. Gobi short-tailed sheep and Ujumqin sheep with the CC genotype at position 180 of the 3′UTR region of the INHA gene were selected as breeding parents.
[0050] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. Specific primers for the molecular marker of the sheep fertility-related gene INHA, characterized in that, The specific primer sequences are as follows: SEQ ID NO.1: 5'-GCTTGCATCTAAGGGAATCC-3'; SEQ ID NO. 2: 5'-TGAGGCTAAGTGACGTGAGA-3'.
2. The specific primers for the molecular marker of the sheep fertility-related gene INHA according to claim 1, characterized in that, The sheep in question are either Gobi short-tailed sheep or Ujumqin sheep.
3. The application of the specific primers for the molecular marker of the sheep fertility-related gene INHA as described in claim 1.
4. The application of the specific primers for the molecular marker of the sheep fertility-related gene INHA as described in claim 1 in assisted sheep breeding.
5. The application according to claim 4, characterized in that, The sheep in question are either Gobi short-tailed sheep or Ujumqin sheep.
6. A method for improving sheep fertility, characterized in that, The method includes the step of amplifying the sheep genomic DNA to be tested using the specific primers as described in claim 1.
7. The method for improving sheep fertility according to claim 6, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the sheep to be tested; (2) Using the sheep genomic DNA extracted in step (1) as a template, PCR amplification was performed using specific primers to obtain the amplification product; (3) Determine the genotype of the 180th nucleotide in the 3′UTR region of the INHA gene in the sheep genome of the amplified product, and select sheep with the CC genotype at the 180th nucleotide in the 3′UTR region of the INHA gene as the parent for breeding.
8. The method for improving sheep fertility according to claim 6, characterized in that, In step (2) PCR amplification, the total volume of the amplification system is 20 μL, including 1 μL of specific primers, 1 μL of template, 10 μL of premix, and 7 μL of deionized water.
9. The method for improving sheep fertility according to claim 6, characterized in that, The amplification program for step (2) is as follows: pre-denaturation at 95℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 56℃ for 15 s, extension at 68℃ for 21 s, 35 cycles, and extension at 68℃ for 7 min.
10. The method for improving sheep fertility according to claim 6, characterized in that, The sheep in question are either Gobi short-tailed sheep or Ujumqin sheep.