A method for leaching metals from environmental pollutants using microorganisms

Abstract

This invention discloses a method for leaching metals from environmental pollutants using microorganisms, belonging to the field of bioleaching technology. The invention isolates a strain of *Coniochaeta fodinicola* from sludge from a wastewater treatment plant in Changzhou. This strain can grow normally under acidic conditions. When applied to leaching metallic lead, reacting with lead-containing ore for 0.5–8 hours, it can effectively leach the lead content, achieving a lead leaching rate of up to 91.9%. The microbial lead leaching method provided by this invention is simple and effective, and has practical significance for industrial lead leaching.

Description

Technical Field

[0001] The invention relates to a method for leaching metals from environmental pollutants using microorganisms, belonging to the technical field of biological leaching. Background Art

[0002] Lead is a common metal element in environmental pollutants and is also a corrosion-resistant heavy non-ferrous metal material. Lead has the advantages of low melting point, high corrosion resistance, difficulty in penetration by X-rays and gamma rays, and good plasticity. It is often processed into plates and pipes and is widely used in industrial sectors such as chemical, cable, battery and radiation protection.

[0003] Lead is one of the three major heavy metal pollutants and is a heavy metal element that seriously harms human health. Lead is taken into the human body through food intake and drinking tap water. 90% of the lead that enters the human body is stored in the bones, and 10% is distributed to various tissues and organs throughout the body with the circulation of blood, affecting the functions of red blood cells and the brain, kidneys, and nervous system. In particular, after infants and young children absorb lead, more than 30% will remain in the body, affecting their growth and intellectual development.

[0004] Since lead is a cumulative poison, it will only cause physical discomfort when the lead content in the human body reaches a certain level. Long-term intake of lead will cause serious damage to the body's blood and nervous systems, especially causing irreversible damage to children's health and intelligence.

[0005] Acid leaching is generally used to leach lead from soil and mines, but the leaching steps are complicated (five-step extraction method), the leaching process is slow, and the extremely strong acidic leaching solution will cause harm to the surrounding environment; the process of microbial leaching of lead is simple and has no secondary pollution to the environment.

[0006] At present, the related research on microbial leaching of lead includes: research on biological leaching of metals in lead-zinc sulfide tailings, and research on the process of leaching lead-zinc sulfide tailings by enhanced moderately thermophilic bacteria. However, biological leaching of metallic lead is still in the exploratory test stage, and further research is needed on leaching efficiency and cultivation of efficient bacteria that can adapt to industrial production. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art. A strain of acidophilic Coniochaeta fodinicola is extracted from the sludge of a Changzhou sewage treatment plant. The strain can be used to leaching metallic lead, thereby providing an effective biological leaching method for leaching metallic lead.

[0008] The present invention provides a Coniochaeta fodinicola, which was deposited in the China Type Culture Collection on May 12, 2021, with a deposit number of CGMCC No: 21958, and the deposit address is the Institute of the Chinese Academy of Sciences.

[0009] The present invention provides a product containing the Coniochaeta fodinicola.

[0010] In one embodiment, the product includes but is not limited to a microbial preparation and a sewage treatment agent.

[0011] In one embodiment, the content of Coniochaeta fodinicola in the product is not less than 1.0×10 7 cfu / L or 1.0×10 7 cfu / g.

[0012] The present invention provides a method for culturing the Coniochaeta fodinicola, wherein the method comprises inoculating the Coniochaeta fodinicola into a culture medium, culturing the culture medium in a constant temperature environment of 100 to 140 rpm and 30 to 70° C. until the bacterial solution OD reaches 0. 600 The value is 0.8~1.2.

[0013] The present invention provides a method for leaching lead by using microorganisms. The method comprises the following steps: using the Coniochaetafodinicola or the product to react in a system containing metallic lead to leach metallic lead.

[0014] In one embodiment, the lead-containing system includes, but is not limited to, lead-containing solid contaminants or lead-containing liquid contaminants.

[0015] In one embodiment, the reaction system containing metallic lead includes mineral soil.

[0016] In one embodiment, the Coniochaeta fodinicola is cultured at a pH of 2.5 to 3.5, 100 to 140 rpm, 30 to 35°C until the OD 600 0.8-1.0, add 10-100mLOD per gram or per milliliter to the mineral soil 600 The mixture was stirred at 100-140 rpm and 30-35°C.

[0017] Preferably, the Coniochaeta fodinicola is grown to OD 600 is 0.9.

[0018] In one embodiment, the reaction lasts for 1 to 8 hours.

[0019] The invention provides the use of the Coniochaeta fodinicola or the product in leaching lead.

[0020] In one embodiment, OD is added to a system containing lead. 600 The reaction was carried out at a temperature of 100 to 140 rpm and a temperature of 30 to 35°C.

[0021] In one embodiment, OD 600 The Coniochaeta fodinicola bacterial solution with a concentration of 0.9 is added in an amount of 10 to 100 mL per gram of mineral soil, and the lead content in the mineral soil is 5043 ppm.

[0022] In one embodiment, each reaction time is not less than 0.5 h.

[0023] Preferably, the reaction time is 1.0 to 8.0 h.

[0024] Beneficial effects of the present invention: The present invention isolates a strain of Coniochaeta fodinicola from the sludge of a Changzhou sewage treatment plant. The strain can grow normally under acidic conditions. When the strain is used to leaching metallic lead, it reacts with lead-containing mineral soil for 0 to 8 hours, and the lead content therein can be effectively leached, and the leaching rate can reach 91.9%.

[0025] Biomaterial Deposit

[0026] The Coniochaeta fodinicola provided by the present invention is classified and named Coniochaetafodinicola, and was deposited in the China Center for Type Culture Collection on May 12, 2021, with a deposit number of CGMCC No: 21958. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of the Chinese Academy of Sciences. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a diagram of the colony and cell morphology of Coniochaeta fodinicola.

[0028] Figure 2 The electrophoresis diagram of Coniochaeta fodinicola; A is the gel image of the product amplified using the ITS primer pair, and B is the gel image of the product amplified using the NS primer pair. DETAILED DESCRIPTION

[0029] The present invention is described in detail below in conjunction with the embodiments described in the accompanying drawings, wherein the same numerals in all the accompanying drawings represent the same features. Although specific embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0030] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the following description of suitable methods and material examples is illustrative only and does not limit the present invention in any way.

[0031] As used herein, the term "strain" refers to a microorganism of a particular species having common characteristics. Unless otherwise indicated, the terms "strain" and "cell" are used interchangeably herein.

[0032] The term "plate" used in this article refers to plate culture medium, which is the most commonly used form of solid culture medium for obtaining pure culture of microorganisms. It is a solid surface of culture medium formed in a sterile culture dish after cooling and solidification, and is often referred to as a culture plate or plate.

[0033] The term "medium" as used herein refers to a culture medium comprising the chemical elements required for the growth of the microorganisms together with at least one carbon source and one nitrogen source.

[0034] The LB liquid medium used in the following examples contained 5 g·L -1 Yeast powder, 10g·L -1 Tryptone, 10 g L -1 Sodium chloride.

[0035] LB solid medium used in the following examples: 5 g·L -1 Yeast powder, 10g·L -1 Tryptone, 10 g L -1 Sodium chloride, and 20 g agar per liter of culture medium.

[0036] The acidic LB solid medium used in the following examples: 5 g·L -1 Yeast powder, 10g·L -1 Tryptone, 10 g L -1 Sodium chloride, adjust pH to 3.0.

[0037] Calculation of lead leaching rate in the following examples:

[0038] Leaching rate = (C*A*M*V) / m.

[0039] C: concentration of lead ions; A: dilution factor; M: molar mass of lead; V: volume of bacterial solution; m: initial mass of lead in the mineral soil.

[0040] The initial lead content in the mineral soil was determined by spectrophotometry and was 0.024 mol·L -1 .

[0041] Example 1: Screening of strains

[0042] (1) The density obtained from Changzhou Wastewater Treatment Plant is 0.027 g mL -1 10 mL of sludge was placed into 90 mL of LB liquid culture medium and cultured at 100-140 rpm and 30-35°C for 4-6 days;

[0043] (2) Take the bacterial solution in (1) and inoculate it into 100 mL of new LB liquid culture medium at a volume ratio of 5-10% and culture it at 100-140 rpm and 30-35°C for 4-6 days;

[0044] (3) Take the bacterial solution in (2) and inoculate it into 100 mL of new LB liquid culture medium at a volume ratio of 5-10% and culture it at 100-140 rpm and 30-35°C for 4-6 days;

[0045] (4) Take 5 μL of the bacterial solution in (3) and add it to the sterilized LB liquid medium. After culturing in a shaker at 100-180 rpm and 30-40°C for 4-6 days, use a pipette to draw up 100 μL of the liquid and spread it on the acidic (pH 3) LB solid medium;

[0046] (5) Place the acidic LB solid medium in a 37°C incubator for 1 to 2 days and observe the morphology of the colonies. Pick a small amount of bacteria from each colony and place it in the acidic LB liquid medium. After culturing for 4 to 6 days, inoculate it on the acidic LB solid medium.

[0047] (6) Repeat step (5) multiple times until a single bacterial strain is obtained in each acidic LB solid culture medium;

[0048] (7) Pick a single strain from the culture medium where a single strain grows and inoculate it into 100 mL of acidic (pH 3) LB liquid culture medium. Cultivate at 100-140 rpm and 30-35°C for 4-6 days and measure the OD of the bacterial solution. 600 The value reaches 0.9, and the desired bacterial solution is obtained.

[0049] Example 2: Identification of strains

[0050] (1) The morphological characteristics of the strain were observed using an optical microscope. Figure 1 As shown, the strain has a velvety body, round colonies and is opaque.

[0051] (2) The genus was identified by Shanghai Sangon Biotechnology Co., Ltd. using the ITS method. After amplification using ITS universal primers, the primers and amplification system are as follows: The amplified bands were detected by electrophoresis. The electrophoresis diagram is shown in Figure 2 As shown in lane 2 (band size is about 450 bp). The band was sent for sequencing, and the sequencing results were compared on BLAST. After comparison, the sequence had a similarity of 100% with Coniochaeta fodinicola, and was identified as Coniochaeta fodinicola, and sent to the strain collection center for preservation.

[0052] ① Primers used:

[0053] ITS1:TCCGTAGGTGAACCTGCGG(SEQ ID NO:1),

[0054] ITS4:TCCTCCGCTTATTGATATGC(SEQ ID NO:2);

[0055] ②PCR amplification reaction system:

[0056]

[0057]

[0058] ③PCR reaction conditions:

[0059]

[0060] Example 3: Application of Coniochaetafodinicola in lead leaching

[0061] (1) The strain selected above was inoculated into acidic (pH 3) LB medium and cultured at 100-140 rpm and 30-35°C until the bacterial solution OD 600 The value is 0.9;

[0062] (2) Take 10 mL, 20 mL, 30 mL, 40 mL, 50 mL, and 100 mL of the bacterial solution obtained in step 1, respectively, add them to 1 g of mineral soil, stir them on a magnetic stirrer at a speed of 800 r / min, and draw samples every 2 h, 4 h, and 8 h;

[0063] (3) centrifuging the sample liquid, filtering the supernatant after high-speed low-temperature centrifugation to obtain the required clear and transparent extract;

[0064] (4) The leaching solution in (3) was diluted 50 times and the lead ion concentration in 1 g of mineral soil was measured by ICP when different amounts of bacterial solution were added;

[0065] (5) Calculate the lead leaching rate:

[0066] Leaching rate = (C*A*M*V) / m.

[0067] C: concentration of lead ions; A: dilution factor; M: molar mass of lead; V: volume of bacterial solution; m: initial mass of lead in the mineral soil.

[0068] The initial lead content in the mineral soil was determined by spectrophotometry and was 0.024 mol·L -1 .

[0069] The leaching rate results of lead are shown in Tables 1 to 5: using 20 mL of Coniochaeta fodinicola solution for 8 hours, the leaching rate of lead can reach 79.8%, adding more than 30 mL of Coniochaeta fodinicola solution for 8 hours, the leaching rate of lead can reach more than 80%, adding 100 mL of Coniochaeta fodinicola solution for 8 hours, the leaching rate of lead can reach 91.9%.

[0070] Table 1. Lead ion concentrations at different times after adding 10 mL of Coniochaeta fodinicola culture

[0071]

[0072] Table 2. Lead ion concentrations at different times after adding 20 mL of Coniochaeta fodinicola culture

[0073]

[0074]

[0075] Table 3. Lead ion concentrations at different times after adding 30 mL of Coniochaeta fodinicola culture

[0076]

[0077] Table 4. Lead ion concentrations at different times after adding 40 mL of Coniochaeta fodinicola culture

[0078]

[0079] Table 5. Lead ion concentrations at different times after adding 50 mL of Coniochaeta fodinicola culture

[0080]

[0081] Table 6. Lead ion concentrations at different times after adding 100 mL of Coniochaeta fodinicola culture

[0082]

[0083] Example 4: A method for leaching lead

[0084] Inoculate Coniochaeta fodinicola into acidic LB medium and culture at 100-140 rpm and 30-35°C until the bacterial solution OD reaches 600 The value is 0.9; take OD 600 10-100 mL of bacterial solution with a pH of 0.9 is added with 1 g of fly ash, and stirred on a magnetic stirrer at a speed of 800 r / min for 0-8 h. After the reaction is completed, the lead ion leaching rate can reach 91.9%.

[0085] Example 5: Preparation of a product containing Coniochaeta fodinicola

[0086] Take 200-600 μL of Coniochaeta fodinicola and inoculate it into 10-30 mL of acidic LB liquid medium. Activate it for 2 to 3 generations at 30°C. 8 When the number of viable bacteria is above cfu / mL, centrifuge at 8000rpm for 15min, remove the supernatant, take the bacteria, freeze-dry the bacteria, and then mix them with other bacterial powders to prepare a mixed bacterial agent. The other bacterial powders are powders of any strains that synergize with Coniochaeta fodinicola to leach lead.

[0087] Comparative Example 1: Leaching lead using acid leaching

[0088] Specific steps:

[0089] (1) Take 10 to 100 mL (10 mL, 20 mL, 30 mL, 40 mL, 50 mL, 100 mL) of sulfuric acid in 1 g of mineral soil and stir at 800 r / min on a magnetic stirrer.

[0090] (2) The liquid in step (1) is absorbed and centrifuged, and the supernatant after high-speed low-temperature centrifugation is filtered to obtain the desired clear and transparent extract.

[0091] (3) The concentration of lead ions in 1 g of mineral soil when different amounts of sulfuric acid are added is measured using ICP using the leaching solution in (2).

[0092] (4) In step (3), the concentration of lead ions is measured at 0 to 8 hours respectively.

[0093] (5) Calculate the lead leaching rate:

[0094] Leaching rate = (C*A*M*V) / m.

[0095] C: concentration of lead ions; A: dilution factor; M: molar mass of lead; V: volume of bacterial solution; m: initial mass of lead in the mineral soil.

[0096] Table 7. Lead ion concentrations at different times after adding 10 mL of sulfuric acid

[0097]

[0098] Table 8. Lead ion concentrations at different times after adding 20 mL of sulfuric acid

[0099]

[0100] Table 9. Lead ion concentrations at different times after adding 30 mL of sulfuric acid

[0101]

[0102] Table 10. Lead ion concentrations at different times after adding 40 mL of sulfuric acid

[0103]

[0104] Table 11. Lead ion concentrations at different times after adding 50 mL of sulfuric acid

[0105]

[0106] Table 12. Lead ion concentrations at different times after adding 100 mL of sulfuric acid

[0107]

[0108] Although the present invention has been disclosed as above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. One Coniochaeta fodinicola , was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 12, 2021, with the deposit number CGMCC No. 21958.

2. A microbial preparation, characterized in that: The microbial preparation contains the Coniochaeta fodinicola .

3. The microbial preparation according to claim 2, characterized in that Microbial preparations described Coniochaeta fodinicola The content is not less than 1.0×10 7 cfu / mL or 1.0×10 7 cfu / g.

4. A method for leaching lead, characterized in that: The method is to use the method of claim 1 Coniochaeta fodinicola Or the microbial preparation described in any one of claims 2 to 3 reacts with mineral soil containing metallic lead to leaching the metallic lead.

5. The method according to claim 4, characterized in that The claim 1 Coniochaeta fodinicola Culture to OD 600 The concentration of bacterial solution is 0.8~1.2, and then 10~100 mL of bacterial solution is added per gram or milliliter of pollutant to react and leach lead.

6. The method according to claim 4 or 5, characterized in that: The reaction was carried out at 100-140 rpm and 30-35°C.

7. The method according to claim 1 Coniochaeta fodinicola Or the use of the microbial preparation described in any one of claims 2 to 3 in leaching lead; characterized in that, The application is for treating lead-containing mineral soils.

Images