A method for preparing alpha-ketoisovalerate by dynamic metabolic regulation of escherichia coli fermentation

By dynamically regulating the metabolic pathways of Escherichia coli, recombinant Escherichia coli was constructed, inhibiting the expression of ilvE and pdh genes, expressing specific keto acid reductases, and overexpressing pntA and pntAB genes. This solved the limitations of chemical synthesis methods and the problem of adding organic nitrogen sources to Corynebacterium glutamicum, achieving efficient and low-cost fermentation production of α-ketoisovalerate.

CN116064347BActive Publication Date: 2026-06-23JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2022-08-25
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing chemical synthesis methods for α-ketoisovalerate are complicated by the use of raw materials, complex processes, harsh reaction conditions, expensive and toxic catalysts. When using Corynebacterium glutamicum to synthesize α-ketoisovalerate, a large amount of organic nitrogen source needs to be added, which increases the cost of the culture medium. Furthermore, the imbalance of reducing power limits the yield and production intensity.

Method used

By dynamically regulating the metabolic pathways of Escherichia coli, recombinant Escherichia coli was constructed, the expression of ilvE and pdh genes was inhibited, keto acid reductases containing mutations of A71S, R76D, S78D and Q110V were expressed, and pntA and pntAB genes were overexpressed. α-ketoisovalerate was produced by fermentation in an inorganic salt medium under microaerobic conditions.

Benefits of technology

The method achieved efficient fermentation production of α-ketoisovaleric acid using inexpensive inorganic salt culture medium, with a yield of 35.2 g/L and a conversion rate close to 1 mol/mol glucose. It also reduced byproducts, simplified the fermentation process, and lowered costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064347B_ABST
    Figure CN116064347B_ABST
Patent Text Reader

Abstract

The application discloses a kind of dynamic metabolic regulation escherichia coli fermentation preparation alpha-ketoisovaleric acid method, belong to the field of bioengineering.The recombinant escherichia coli constructed contains the dynamic regulation cell growth metabolic pathway and balance coenzyme circulation system established based on CRISPRi technology and degradation label;It can be with cheap glucose as carbon source, with inorganic salt as nitrogen source, and ferment to generate high value-added alpha-ketoisovaleric acid, under the fermentation strategy of two-stage fermentation, the yield of alpha-ketoisovaleric acid can reach 35.2g / L for 60h, with the prospect of industrial application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for preparing α-ketoisovalerate by dynamically regulating the fermentation of Escherichia coli, which belongs to the field of bioengineering. Background Technology

[0002] α-Ketoisovalerate is an α-keto acid widely used in pharmaceuticals, chemical synthesis, and animal feed. In pharmaceuticals, it is a key ingredient in compound α-keto acid tablets and can be used to treat uremia. Furthermore, α-ketoisovalerate is an important raw material for the synthesis of vitamin B5; in vivo, it is a precursor for the synthesis of valine, isoleucine, and leucine, playing a crucial role in amino acid synthesis.

[0003] Currently, the most common method for synthesizing α-ketoisovaleric acid is chemical synthesis. However, chemical synthesis has significant limitations from both an industrial economic development and environmental protection perspective: it requires complex raw materials, intricate processes, stringent reaction conditions, and expensive and potentially toxic catalysts. Fermentation, on the other hand, is simple to operate, has low substrate costs, and is environmentally friendly, making it more suitable for industrial production.

[0004] Currently, α-ketoisovalerate is mainly synthesized by fermentation using Corynebacterium glutamicum as the host strain (Applied and Environmental Microbiology, 2010, 76(24):8053-8061), with fewer reports on E. coli as the chassis strain. E. coli has a short fermentation cycle, clear genetic information, and low fermentation cost, and can be used to modify it into a cell factory for efficient fermentation synthesis of the target product. In our previous study, we constructed a recombinant E. coli strain that synthesizes α-ketoisovalerate (A method for preparing α-ketoisovalerate by fermentation of E. coli through metabolic engineering, 2022, 2022100699947). Due to the knockout of the metabolic pathway for the decomposition of α-ketoisovalerate to synthesize valine, the strain became a auxotroph, requiring the addition of a large amount of organic nitrogen source during fermentation to maintain the cell growth capacity, which increased the cost of the culture medium and was not conducive to large-scale industrial application. Therefore, this study aims to reduce production costs by dynamically regulating the competitive metabolic pathway of α-ketoisovalerate and using inorganic nitrogen source for efficient fermentation synthesis of α-ketoisovalerate. Furthermore, since the synthesis of one molecule of α-ketoisovalerate requires the accumulation of two molecules of NADH while simultaneously consuming one molecule of NADPH, an imbalance in reducing power will lead to metabolic stagnation, inhibiting the increase in yield and production intensity. Therefore, this study further coordinates the reducing power balance to improve the yield and production intensity of α-ketoisovalerate. Summary of the Invention

[0005] The purpose of this invention is to provide a method for efficiently preparing α-ketoisovalerate by dynamically regulating the metabolic pathway of Escherichia coli, which can produce α-ketoisovalerate by fermentation in an inexpensive inorganic salt culture medium.

[0006] This invention provides a recombinant Escherichia coli strain, which has undergone at least one of the following modifications to the starting strain:

[0007] (1) Inhibit the expression of the ilvE gene;

[0008] (2) Inhibit pdh gene expression;

[0009] (3) Express keto acid reductase (IlvC enzyme) containing mutations of A71S, R76D, S78D and Q110V;

[0010] (4) Overexpression of pntA and pntAB genes.

[0011] In one embodiment, the starting strain E. coli B0016-050 is disclosed in the paper “Efficient L-Alanine Production by a Thermo-Regulated Switch in Escherichia coli”, and the applicant undertakes to release the strain to the public through legal means within twenty years from the date of application.

[0012] In one embodiment, the suppression of ilvE gene expression includes expressing dCas9 protein at the plasmid level or at the genome level.

[0013] In one implementation, expressing the dCas9 protein at the genomic level specifically involves expressing the dCas9 protein integrated into the genomic DNA using the T7 promoter.

[0014] In one implementation, P is used. trc Promoter expression of the sgRNA used to repress the ilvE gene is achieved by replacing the arabinose-inducible promoter located in the pACYC-ara-dcas9-444 plasmid with P trc Promoter.

[0015] In one embodiment, an sgRNA sequence with the nucleotide sequence ACATCACCGACGAAGATCAGCGG or GGATGGTGTTTGGTGCTGCGCGG is used to suppress the expression of the ilvE gene.

[0016] In one embodiment, the expression of dCas9 protein at the plasmid level uses plasmid pACYCDuet-1 as the expression vector.

[0017] In one embodiment, the inhibition of ilvE gene expression further includes adding a DAS+4 degradation tag to the C-terminus of the ilvE gene.

[0018] In one implementation, an sgRNA sequence with the nucleotide sequence TCAGTGGAGTCCCAGATACGCGG is used to suppress the expression of the pdh gene.

[0019] In one embodiment, the inhibition of pdh gene expression further includes adding a DAS+4 degradation tag to the C-terminus of the pdh gene.

[0020] In one embodiment, pCTSDT is used as an expression vector to express keto acid reductases containing mutations of A71S, R76D, S78D, and Q110V.

[0021] In one embodiment, the pntA gene has a Gene ID of 946628; the pntA gene has a Gene ID of 946144.

[0022] This invention provides a method for producing α-ketoisovalerate, using the recombinant Escherichia coli as a fermentation strain to produce α-ketoisovalerate.

[0023] In one embodiment, the method uses glucose as a carbon source.

[0024] In one embodiment, the method uses an inorganic salt as a nitrogen source.

[0025] In one embodiment, the method involves fermentation under microaerobic conditions.

[0026] In one embodiment, the culture medium used for fermentation is M9 medium containing glucose.

[0027] In one embodiment, the M9 culture medium contains the following components in g / L: KH₂PO₄ 3.0, Na₂HPO₄ 6.0, NaCl 0.3, NH₄Cl 1.0, MgSO₄·7H₂O 0.49, and trace elements 0.1% (v / v); the trace element solution contains: MnSO₄·4H₂O 0.5 g / L, FeSO₄·7H₂O 10.0 g / L, CaCl₂ 2.0 g / L, and (NH₄)Mo₇O₇. 24 0.1g / L, CuSO4·5H2O3.0g / L, Na2B4O7·10H2O 0.23g / L, ZnSO4·7H2O 5.25g / L.

[0028] In one implementation, the method employs a two-stage fermentation:

[0029] First stage: bacterial growth stage, control the temperature at 37℃, and adjust the stirring speed and aeration rate to control the dissolved oxygen concentration ≥30%.

[0030] Phase Two: When OD 600When the value reaches 30, the α-ketoisovaleric acid synthesis stage begins. 0.8 mM IPTG is added for induction, and the temperature is lowered to 30°C while controlling the dissolved oxygen concentration to ≤10%.

[0031] In one embodiment, the method further involves culturing to OD. 600 The bacterial culture was induced with IPTG at a concentration of 2.5.

[0032] In one embodiment, the bacterial strain is aerobically cultured in a fermenter until OD... 600 When the value reaches 30, add IPTG inducement.

[0033] This invention also protects the application of the recombinant Escherichia coli, or the method for producing α-ketoisovalerate, in the fields of medicine, food, and cosmetics.

[0034] Beneficial Effects: This invention constructs a recombinant *E. coli* strain capable of efficiently synthesizing α-ketoisovalerate using an inorganic salt culture medium. The host strain is then modified and optimized to obtain a recombinant bacterium capable of producing α-ketoisovalerate via fermentation, along with a fermentation method. The recombinant *E. coli* strain constructed in this invention contains a dynamically regulated bacterial growth and metabolic pathway established based on CRISPRi technology and degradation tags. Figure 1 a) and the balanced coenzyme cycle system ( Figure 1 b) The dynamically regulated bacterial growth and metabolic pathway enables normal bacterial growth during the growth phase through the operation of the valine biosynthesis pathway and the TCA cycle. During the product synthesis phase, transcription of the valine biosynthesis pathway and the TCA cycle is inhibited, and residual enzymes are degraded by the tag, thus shutting down both metabolic pathways to achieve efficient accumulation of α-ketoisovalerate. The balanced coenzyme cycle system contains the NADH-coenzyme-dependent pathway and the NADPH-coenzyme-dependent pathway, which can achieve coenzyme cycle balance in the α-ketoisovalerate synthesis process.

[0035] The recombinant strain constructed in this invention can ferment α-ketoisovalerate, which has higher added value, using inexpensive glucose as a carbon source and inorganic salts as a nitrogen source. After 60 hours of fermentation, the yield of α-ketoisovalerate can reach 35.2 g / L. The conversion rate of α-ketoisovalerate during the entire fermentation process reaches 0.73 mol / mol glucose, and the conversion rate in the second stage increases to 0.99 mol / mol glucose, which is close to the theoretical glucose of 1 mol / mol. The volumetric production intensity is 0.67 g / L h. The accumulation of the byproduct isobutanol is significantly reduced to 1.2 g / L, and the yield is only 0.04 mol / mol glucose. Attached Figure Description

[0036] Figure 1 The strategies for α-ketoisovalerate synthesis include: a) dynamic metabolic regulation strategy; b) balancing the coenzyme cycle system.

[0037] Figure 2 T7 RNAP was integrated and fermented to synthesize α-ketoisovalerate; a: T7 RNAP integration chromosome PCR verification; b: α-ketoisovalerate fermentation results; M: Marker; 1: PCR verification band of the original strain; 2: PCR verification band of the strain after T7 RNAP-kan integration; 3: PCR verification band of the strain after removing the kan fragment.

[0038] Figure 3 Screening for sgRNA sequences to inhibit ilvE gene expression; a: bacterial growth status; b: valine accumulation.

[0039] Figure 4 The inhibitory effect of dCas9 expression at the chromosome level on ilvE; a: valine accumulation; b: α-ketoisovalerate production.

[0040] Figure 5 The inhibitory effect of plasmid-level expression of dCas9 on ilvE; a: valine accumulation; b: α-ketoisovaleric acid production.

[0041] Figure 6 To improve the effect of combining CRISPRi technology with degradation tags in regulating the synthesis of α-ketoisovaleric acid.

[0042] Figure 7 The role of dCas9 promoter optimization in the synthesis of α-ketoisovalerate.

[0043] Figure 8 The inhibitory effects of different sgRNA sequences on pdh gene expression.

[0044] Figure 9 To investigate the role of CRISPRi technology in inhibiting the synthesis of α-ketoisovalerate by the ilvE and pdh genes.

[0045] Figure 10 To assess the effect of CRISPRi binding to degradation tags.

[0046] Figure 11 The effect of NADH-dependent synthesis of α-ketoisovalerate.

[0047] Figure 12 The effect of NADPH-dependent synthesis of α-ketoisovalerate; a: PCR verification results of strain 050Y4; b: Comparison of fermentation results. M: Marker; 1: Original strain band; 2: Band after integration of T7-kan fragment; 3: Band after removal of kan fragment.

[0048] Figure 13 The role of combined fermentation strategy in the synthesis of α-ketoisovalerate.

[0049] Figure 14α-Ketoisovalerate was synthesized in a 5L fermenter for strain 050Y4 / pCTSDTQ487S-RBS55+pACYC-trc-dcas9-444-478. Detailed Implementation

[0050] Culture medium:

[0051] LB liquid culture medium: First, weigh 10g of tryptone, 5g of yeast extract, and 10g of sodium chloride (NaCl) into a beaker using an electronic balance. Then, add deionized water to the beaker to bring the volume to 1L. Finally, autoclave the medium at 121℃ for 20 minutes.

[0052] LB solid medium: Weigh 20g of agar powder and add it to 1L of LB liquid medium, then place it in an autoclave and sterilize it at 121℃ for 20min.

[0053] M9 medium (g·L) -1 ): KH2PO4 3.0, Na2HPO4 6.0, NaCl 0.3, NH4Cl 1.0, MgSO4·7H2O 0.49, trace elements 0.1% (v / v).

[0054] Trace element solution: MnSO4·4H2O 0.5g / L, FeSO4·7H2O 10.0g / L, CaCl2 2.0g / L, (NH4)Mo7O 24 0.1 g / L CuSO4·5H2O 3.0 g / L Na2B4O7·10H2O 0.23 g / L ZnSO4·7H2O 5.25 g / L, prepared with 0.1 mol / L HCl.

[0055] Add appropriate antibiotics to the culture medium as needed. The antibiotic addition amounts are as follows: kanamycin final concentration 50 μg / mL, ampicillin final concentration 120 μg / mL, chloramphenicol final concentration 35 μg / mL.

[0056] Shake-flask fermentation method for α-ketoisovaleric acid:

[0057] (1) Pre-culture of the strain

[0058] The recombinant strain was streaked onto LB agar plates and incubated at 37°C for 24 h. Single colonies from the plates were then inoculated onto LB liquid medium and incubated at 37°C and 200 rpm for 10 h to obtain a pre-culture solution.

[0059] (2) Fermentation culture

[0060] Inoculate 2 mL of the bacterial suspension prepared in step (1) into 50 mL of M9 medium containing 36 g / L glucose, and incubate at 37 °C and 200 r / min using a shaker. Bacterial OD 600 When the value reaches 1, 2, 2.5, or 3, add IPTG inducer to a final concentration of 0.4 mmol / L, and add 40 mmol·L as needed. -1 For the addition of arabinose, place the shake flasks at 30°C and incubate with shaking at 100, 150, or 200 rpm for 60 hours. During this period, measure the pH value every 4 hours using pH test paper and adjust the pH of the fermentation broth to neutral with ammonia.

[0061] Determination method of α-ketoisovalerate:

[0062] α-Ketoisovaleric acid was detected by high performance liquid chromatography (HPLC). The detection conditions were as follows: Prevail OrganicAcid column (250 mm × 4.6 mm, 5 μm), mobile phase of KH2PO4 solution with pH 2.5 and a concentration of 25 mmol / L, flow rate of 1 mL / min, column temperature of 40 ℃, UV detector wavelength of 210 nm, and injection volume of 10 μL.

[0063] Modification of chromosomal genes using the Red recombination method: see KADatsenko et al., One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA, 2000, 97, 6640–6645.

[0064] High-performance liquid chromatography (HPLC) method for the detection of valine:

[0065] (1) Sample preparation: Take 1 mL of fermentation broth and 1200 r·min -1 Centrifuge for 2 min. Dilute the supernatant with distilled water to a certain extent, then derivatize with phenyl isosulfate (PITC): Take 500 μL of the diluted solution and add 250 μL of 1 mol·L⁻¹ solution. -1 Triethylamine-acetonitrile solution and 250 μL of 0.1 mol·L⁻¹ -1 The PITC-acetonitrile solution was allowed to stand in the dark for 45 minutes. After the reaction, 700 μL of n-hexane was added. At this time, the layering phenomenon occurred. The lower layer solution was aspirated with a 1 mL syringe, which is the sample to be tested for valine content.

[0066] (2) HPLC determination conditions: The chromatographic column was a Diamonsil C18 (4.6 mm × 250 mm, 5 μm). The mobile phase consisted of two phases: A was 80% acetonitrile solution, and B was 3% acetonitrile and 97% 0.1 mol·L⁻¹ solution. -1 Sodium acetate mixture. Flow rate set at 0.6 mL / min. -1 The column temperature was set to 40℃, the UV detection wavelength was set to 254nm, and the injection volume was set to 10μL. Gradient elution was used, and the elution conditions were set as follows: 0-35 min, mobile phase B decreased from 95% to 65%; 35-40 min, mobile phase B increased from 65% to 95%; 40-45 min, mobile phase B remained at 95%.

[0067] Glucose detection methods:

[0068] First use 1 g / L of glucose -1 The standard sample was used to calibrate the biosensor. After successful calibration, the fermentation broth to be tested was diluted appropriately to a concentration range of 0-2 g·L⁻¹. -1 The glucose concentration is obtained by multiplying the reading by the dilution factor.

[0069] Example 1: Obtaining Prototrophic Strains

[0070] Because strain 050TY (disclosed in patent application CN114480235A) has had its valine and leucine synthesis pathways knocked out, making it an auxotrophic strain, this embodiment uses E. coli B0016-050 (disclosed in the paper "Efficient L-Alanine Production by a Thermo-Regulated Switch in Escherichia coli"), whose formic acid, acetic acid, ethanol, lactic acid, and succinic acid organic acid byproduct synthesis pathways (encoded by the pflB, ackA-pta, adhE, ldhA, and frdA genes) have been knocked out, as the starting strain. Since the α-ketoisovalerate synthesis pathway is transcribed by the T7 promoter, and strain B0016-050 does not use T7 RNA polymerase, the encoding gene T7 RNAP needs to be inserted into the genome of strain B0016-050.

[0071] poxB is the gene encoding the metabolic pathway that catalyzes the synthesis of acetic acid from pyruvate. In this embodiment, T7 RNAP is integrated into the poxB site, which can express T7 RNA polymerase while further reducing the accumulation of the byproduct acetic acid. The specific steps are as follows: The target gene fragment is cloned using P63 / P64 primers with plasmid pMD-T7 RNAP-kan (published in the 2020 dissertation "Metabolic Engineering to Produce α-Ketoisovaleric Acid in Escherichia coli") as a template. The target gene is then integrated into the poxB gene on the chromosome of strain 050 using the Red recombination system. The recombinant strain is verified by colony PCR using P65 / P66 primers to construct strain 050Y.

[0072] like Figure 2 a represents the chromosome integration result. The original band of strain B0016-050 was 2030bp, and after integration with T7 RNAP-kan, it was approximately 5000bp. After removing the kan gene, it was approximately 3600bp, resulting in strain 050Y.

[0073] Table 1 Primers used for constructing strain 050Y

[0074]

[0075] The pCTSDT recombinant plasmid (published in the 2020 dissertation "Metabolic Engineering of Escherichia coli for the Production of α-ketoisovalerate") was transformed into strain 050Y via electroporation to obtain strain 050Y / pCTSDT. This strain was fermented in shake flasks using M9 inorganic salt medium. When the cell OD... 600 When the growth rate reached 2.5, IPTG inducer was added to a final concentration of 0.4 mmol / L. The shake flask was then placed at 30°C and cultured on a shaker at 200 rpm for 60 h. The fermentation results are as follows. Figure 2 As shown in b, the yield of α-ketoisovaleric acid was 10 g·L⁻¹. -1 Because this strain did not knock out the metabolic pathway that breaks down α-ketoisovalerate to produce valine, the accumulation of valine was as high as 4.1 g·L⁻¹. -1 .

[0076] Example 2: Dynamic regulation of valine synthesis pathway

[0077] Valine, an essential amino acid for bacterial growth, plays a crucial role in bacterial development. Simultaneously, the valine synthesis pathway is also the catabolism pathway for its product, α-ketoisovalerate. To coordinate bacterial growth and product accumulation, this study employed CRISPRi technology and the DAS+4 degradation tag to dynamically regulate the valine synthesis pathway at both the transcriptional and enzymatic activity levels, achieving efficient separation of the bacterial growth and product synthesis stages.

[0078] (1) sgRNA screening to inhibit the ilvE gene

[0079] sgRNA sequences to repress the ilvE gene were designed using the CHOPCHOP website. The binding position of the sgRNA affects the repression effect on the target gene. Binding sites were designed at the pre-, mid-, and post-positions of the ilvE gene fragment, and six sgRNA sequences were screened, as shown in Table 2. Recombinant plasmids containing these six sgRNA sequences were constructed.

[0080] Table 2 ilvE-sgRNA sequence design

[0081]

[0082] Plasmid construction method: Using pKD-dcas9-sgRNA (nucleotide sequence as shown in SEQ ID NO.1) as a template, and using P17 / P18, P19 / P20, P21 / P22, P23 / P24, P25 / P26, and P27 / P28 as upstream and downstream primers in Table 3, the whole plasmid was PCRed. After digestion and purification, the fragments were transformed and sequenced to construct recombinant plasmids pKD-ilvE121sgRNA, pKD-ilvE291sgRNA, pKD-ilvE444sgRNA, pKD-ilvE531sgRNA, pKD-ilvE729sgRNA, and pKD-ilvE828sgRNA.

[0083] Table 3 Primers used for constructing the sgRNA screening plasmid bound to the ilvE gene.

[0084]

[0085] The recombinant plasmids were electroporated into the 050Y recombinant strain, and the recombinant strains containing each CRISPRi plasmid were then inoculated into M9 fermentation medium and cultured until OD500. 600 When the concentration was 0.6, a final concentration of 40 mmol·L⁻¹ was added. -1 The arabinose induced dCas9 expression, thereby inhibiting ilvE expression. Cell growth and valine accumulation were measured; results from incubation at 37℃ and 200 rpm for 60 h are shown below. Figure 3 As shown, the six sgRNAs with different strengths exhibited significant differences in their inhibitory effects on ilvE. Specifically, the sgRNAs binding to the start codon upstream of the ilvE gene fragment at positions 291 and 444 bp significantly inhibited bacterial growth and reduced valine accumulation to 0.03 and 0.08 mmol·L⁻¹, respectively. -1 .

[0086] (2) Optimization of dCas9 expression level Based on recombinant strain 050Y, dCas9 was integrated into the chromosome to replace the lldD gene, and dCas9 was expressed using promoters of different strengths, T7, TM2 (37% of the strength of T7 promoter), and TM3 (16% of the strength of T7 promoter) (nucleotide sequences are shown in Table 4), to obtain recombinant strains 050Y1, 050Y1-1, and 050Y1-2, respectively.

[0087] Table 4. T7 promoter sequences of different intensities

[0088]

[0089] Construction methods of strains 050Y1, 050Y1-1, and 050Y1-2: Using the pKD-ilvE291sgRNA plasmid constructed in step (1) as a template, the dcas9 gene fragment was amplified using G7-cas9-F / G7-cas9-R primers; pACYC-kan-T7100-pntAB, pACYC-kan-T737-pntAB, and pACYC-kan-T716-pntAB (laboratory-preserved plasmids, the DNA sequences of which are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively) were used. Using NO.4 as a template, the plasmid backbone was amplified using G7-T7-F / G7-T7-R primers. The plasmid backbone was then assembled with the dcas9 gene fragment using the In-Fusion assembly kit to construct the recombinant plasmids pACYC-kan-T7100-cas9, pACYC-kan-T737-cas9, and pACYC-kan-T716-cas9. The recombinant plasmids were verified by PCR using Ycas9-R / YT7-F primers. A correct band size was 2200 bp, while no band was observed in an incorrect band. Using plasmids pACYC-kan-T7100-cas9, pACYC-kan-T737-cas9, and pACYC-kan-T716-cas9 as templates, the targeted fragment was amplified by PCR with primers P67 / P68 and integrated into the lldD gene on chromosome 050Y of strain 050Y. Colony PCR with primers P69 / P70 was used to verify the integration, resulting in strains 050Y1, 050Y1-1, and 050Y1-2.

[0090] Table 5 Primers used for the construction of strains 050Y1, 050Y1-1, and 050Y1-2

[0091]

[0092] Using pCTSDT as a template, the plasmid backbone was amplified using primers P35 / P36 in Table 6 as upstream and downstream primers. Using pKD-ilvE291sgRNA and pKD-ilvE444sgRNA constructed in step (1) as templates, the plasmid fragments were amplified using primers P37 / P38 as upstream and downstream primers, respectively. The fragments were then assembled using the In-Fusion assembly kit to obtain pCTSDT-291sgRNA and pCTSDT-444sgRNA recombinant plasmids.

[0093] Table 6 Primers used for constructing pCTSDT-291sgRNA and pCTSDT-444sgRNA plasmids.

[0094]

[0095] Recombinant plasmids pCTSDT-291sgRNA and pCTSDT-444sgRNA were transformed into strains 050Y1, 050Y1-1, and 050Y1-2, respectively, to obtain recombinant strains 050Y1 / pCTSDT-291sgRNA, 050Y1 / pCTSDT-444sgRNA, 050Y1-1 / pCTSDT-291sgRNA, 050Y1-1 / pCTSDT-444sgRNA, and 050Y1-2 / pCTSDT-291sgRNA, 050Y1-2 / pCTSDT-444sgRNA. These strains were then subjected to shake-flask fermentation, and the accumulation of valine and the production of α-ketoisovaleric acid were measured. CRISPRi showed an inhibitory effect on ilvE. Figure 4 As shown, the accumulation of valine in the starting strain was 4.1 g·L⁻¹. -1 Under the regulation of both 291sgRNA and 444sgRNA, the accumulation of valine decreased. Simultaneously, the production of α-ketoisovalerate increased to some extent, with 444sgRNA showing generally better inhibition than 291sgRNA. Furthermore, at the chromosomal level, dCas9 protein expression showed the best inhibitory effect with increasing promoter strength. Specifically, dCas9 expression via the T7 promoter, binding to 444sgRNA, resulted in the lowest valine accumulation (3.20 g / L). -1 The highest yield of α-ketoisovaleric acid was 10.45 g·L⁻¹. -1 .

[0096] (3) Plasmid-level expression of dCas9 inhibits ilvE

[0097] Although dCas9 expression at the chromosomal level has an inhibitory effect on ilvE, it still has a concentration of 3.20 g·L⁻¹. -1 Valine accumulation was observed; meanwhile, α-ketoisovalerate production only increased slightly. To enhance the regulatory effect of the CRISPRi method, dCas9 was expressed on the plasmid.

[0098] Using pACYCDuet-1 plasmid as a template, the plasmid backbone was amplified using primers P39 / P40 (Table 7) as upstream and downstream primers; the plasmid fragment was amplified using pKD-dcas9-sgRNA as a template, using primers P41 / P42 as upstream and downstream primers. The pACYC-ara-dcas9 recombinant plasmid was then assembled using In-Fusion. Using pACYC-ara-dcas9 as a template, the plasmid backbone was amplified using primers P43 / P44 as upstream and downstream primers; the sgRNA plasmid fragment was amplified using pKD-ilvE291sgRNA or pKD-ilvE444sgRNA constructed in step (1) as a template, using primers P45 / P46 as upstream and downstream primers. The pACYC-ara-dcas9-291 or pACYC-ara-dcas9-444 recombinant plasmid was then assembled using In-Fusion.

[0099] Table 7 Primers used for constructing pACYC-ara-dcas9, pACYC-ara-dcas9-291, and pACYC-ara-dcas9-444 plasmids.

[0100]

[0101]

[0102] The recombinant plasmids pACYC-ara-dcas9-291 and pACYC-ara-dcas9-444 were transformed into the strain 050Y / pCTSDT constructed in Example 1, respectively, to obtain recombinant strains 050Y / pCTSDT+pACYC-ara-dcas9-291 and 050Y / pCTSDT+pACYC-ara-dcas9-444. Using the recombinant bacteria obtained by transforming pACYCDuet-1 into strain 050Y / pCTSDT as a control, the above recombinant strains were shake-flask fermented, and the results are as follows. Figure 5 As shown, the regulatory effect of the CRISPRi method was further enhanced after plasmid-level expression of dCas9. Compared with the control strain 050Y / pCTSDT+pACYCDuet-1, the valine accumulation of strains 050Y / pCTSDT+pACYC-ara-dcas9-291 and 050Y / pCTSDT+pACYC-ara-dcas9-444 was significantly inhibited, with 444sgRNA reducing valine accumulation to 1.8 g·L⁻¹. -1 This increased the yield of α-ketoisovaleric acid to 11.0 g·L⁻¹. -1 This indicates that plasmid-level expression of dCas9 is superior to chromosome-level expression.

[0103] (4) Combining CRISPRi technology with degradation tag to inhibit ilvE

[0104] Under the regulation of the CRISPRi method, valine can be synthesized during the bacterial growth phase, providing nutrients for bacterial growth and utilizing inorganic nitrogen sources. During the α-ketoisovaleric acid synthesis phase, ilvE transcription is shut down; however, because previously expressed IlvE protein remains in the cell, valine synthesis continues, ultimately accumulating to 1.8 g·L⁻¹. -1 This study further employed the DAS+4 degradation tag to degrade residual IlvE protein, thereby reducing valine accumulation and increasing α-ketoisovalerate production.

[0105] The DAS+4 degradation tag, with a nucleotide sequence as shown in GCAGCTAATGATGAAAATTACAGCGAAAATTACGCAGATGCCAGCTAA, was amplified and integrated into the downstream of the ilvE gene on the 050Y chromosome of the strain using the Red recombination system. This resulted in the fusion expression of the DAS+4 degradation tag at the C-terminus of ilvE on the 050Y chromosome of the strain. Colony PCR was performed using P73 / P74 primers to verify the recombinant strain, which was named 050Y2.

[0106] Table 8 Primers used to validate strain 050Y2

[0107]

[0108] Plasmid pCTSDT and plasmid pACYC-ara-dcas9-444 constructed in Example 2 were transformed into strain 050Y2. Straw 050Y2 / pCTSDT+pACYC-ara-dcas9-444 was inoculated into 50 mL of M9 medium containing 36 g / L glucose and cultured at 37°C with shaking at 200 rpm until OD500 was reached. 600 When the concentrations are 1, 1.5, 2, 2.5, and 3 respectively, add 40 mmol·L⁻¹. -1 Arabinose induces dCas9 expression, and at OD 600 Add 0.4 mmol·L when the concentration reaches 2.5. -1 IPTG was used to determine the accumulation of valine and the yield of α-ketoisovaleric acid, byproducts of fermentation, after 60 hours. Figure 6 ).

[0109] The results showed that the combination of CRISPRi technology and degradation tagging significantly reduced valine accumulation and increased α-ketoisovalerate production, indicating that adding degradation tags can more effectively achieve dynamic regulation. Inducing dCas9 expression during bacterial growth did not increase α-ketoisovalerate production but rather decreased it; however, after reaching a certain concentration of α-ketoisovalerate, induction increased α-ketoisovalerate production. At OD... 600 When the induction temperature is 2.5, the yield can reach 11.9 g·L⁻¹. -1 The accumulation of valine also decreased to 0.2 g·L⁻¹. -1 .

[0110] (5) The dynamic regulation conditions of ilvE in the α-ketoisovalerate catabolism pathway optimized by the dCas9 promoter are: OD 600 When the value reaches 2.5, add to a final concentration of 40 mmol·L⁻¹. -1 Arabinose induces dCas9 expression. Simultaneously, the overexpression conditions for key genes in the α-ketoisovalerate synthesis pathway are: OD 600 When the concentration reaches 2.5, add 0.4 mmol·L⁻¹. -1 IPTG induction. Therefore, in the dynamic regulation of the synthesis of α-ketoisovalerate, the induction timing is always OD. 600 A value of 2.5 requires the simultaneous addition of both arabinose and IPTG inducers. To simplify the fermentation process and reduce the cost of inducing agents, this embodiment replaces the arabinose-inducible promoter with an IPTG-inducible promoter, using only IPTG as an inducer to simultaneously activate the α-ketoisovaleric acid synthesis pathway and deactivate its degradation pathway. The arabinose promoter was replaced with promoters of varying strengths: trc, CP9a, CP7, and CP26 (promoter sequences are shown in Table 9), as well as the lacO operator gene. Using pACYC-ara-dcas9-444 constructed in Example 2 as a template, and with P51 / P52, P53 / P54, P55 / P56, and P57 / P58 from Table 10 as upstream and downstream primers, the whole plasmid was amplified by PCR to obtain recombinant plasmids pACYC-trc-dcas9-444, pACYC-cp9a-dcas9-444, pACYC-cp7-dcas9-444, and pACYC-cp26-dcas9-444.

[0111] Table 9 dCas9 expression promoter sequence

[0112]

[0113] Table 10 Primers used for constructing plasmids pACYC-trc-dcas9-444, pACYC-cp9a-dcas9-444, pACYC-cp7-dcas9-444, and pACYC-cp26-dcas9-444.

[0114]

[0115]

[0116] The plasmids were transformed into strain 050Y2 / pCTSDT. The fermentation conditions for the recombinant strain were as follows: 2 mL of seed culture was inoculated into 50 mL of M9 medium containing 36 g / L glucose, and cultured at 37°C with shaking at 200 rpm. Cell OD... 600 When the pH reached 2.5, IPTG inducer was added to a final concentration of 0.4 mmol / L. The shake flask was then placed at 30°C and incubated on a shaker at 200 rpm for 60 h. During fermentation, the pH of the fermentation broth was adjusted to neutral with ammonia. The fermentation results of the recombinant strain are as follows: Figure 7 As shown. Using P trc The promoter can further increase the yield of α-ketoisovalerate to 12.4 g·L⁻¹. -1 The accumulation of valine decreased to 0.05 g·L⁻¹. -1 After strain modification, α-ketoisovalerate can be synthesized by fermentation using only IPTG as an inducer, simplifying the fermentation process and reducing the cost of adding the inducer.

[0117] Example 3: Dynamic regulation of the tricarboxylic acid cycle competitive metabolic pathway using CRISPRi technology and DAS+4 degradation tags

[0118] (1) Screening of sgRNA sequences that inhibit pdh gene expression

[0119] sgRNA sequences that inhibit pdh gene expression were designed using CHOPCHOP software. Binding sites were designed at the pre-, mid-, and post-pdh gene fragments, and three sgRNAs were screened, as shown in Table 11. Three recombinant plasmids with different strengths of sgRNA were further constructed for screening. Plasmid construction method: Using pKD-dcas9-sgRNA as a template, full-plasmid PCR was performed using P29 / P30, P31 / P32, and P33 / P34 primers (Table 12). After fragment digestion and purification, the fragments were transformed and sequenced to construct pKD-pdh45sgRNA, pKD-pdh342sgRNA, and pKD-pdh478sgRNA recombinant plasmids, respectively.

[0120] The recombinant plasmids were transformed into E. coli 050Y competent cells, and the resulting recombinant strains were subjected to inoculation and OD240 assays.600 At a concentration of 0.6, 40 mmol / L arabinose was added to induce dCas9 expression and inhibit pdh expression. The flasks were then incubated at 37°C with shaking at 200 rpm for 60 h. The inhibitory effect of the CRISPRi method on pdh was verified by measuring cell growth. Figure 8 As shown, the three sgRNAs with different strengths exhibited significant differences in their inhibitory effects on pyruvate dehydrogenase (PDH). The sgRNA sequence with the best inhibitory effect, binding at 478 bp after the start codon of the aceF gene, showed the best inhibitory effect, leading to increased bacterial OD after inducing dCas9 expression. 600 The value decreased from 4.1 to 1.9, indicating that 478sgRNA had the best inhibitory effect on PDH.

[0121] Table 11 pdh-sgRNA sequence design

[0122]

[0123]

[0124] Table 12 Primers used for constructing sgRNA screening plasmids

[0125]

[0126] (2) Using pACYC-trc-dcas9-444 constructed in Example 2 as a template, the plasmid backbone was amplified using P47 / P48 primers; using pKD-pdh478sgRNA from Example 2 as a template, the fragment was amplified using P49 / P50 primers; the two were assembled using an In-Fusion kit to obtain the recombinant plasmid pACYC-trc-dcas9-444-478. The recombinant plasmid pACYC-trc-dcas9-444-478 was transformed into strain 050Y2 / pCTSDT to obtain strain 050Y2 / pCTSDT+pACYC-trc-dcas9-444-478.

[0127] Table 13 Primers used for constructing pACYC-trc-dcas9-444-478 plasmid

[0128]

[0129] Recombinant strains 050Y2 / pCTSDT+pACYC-trc-dcas9-444 and 050Y2 / pCTSDT+pACYC-trc-dcas9-444-478 were fermented to synthesize α-ketoisovaleric acid. The fermentation conditions were as follows: 2 mL of seed culture was inoculated into 50 mL of M9 medium containing 36 g / L glucose, and cultured at 37℃ with shaking at 200 rpm. The cell OD... 600 When the value reaches 2.5, add IPTG inducer to a final concentration of 0.4 mmol / L, and incubate the flask at 30°C with shaking at 100, 150, or 200 rpm for 60 hours. Figure 9 As shown, after superimposing PDH inhibition on the basis of ilvE, the strain showed effects at 100, 150, and 200 r·min -1 In the bottom fermentation, the yields of α-ketoisovaleric acid were 14.0, 13.2, and 11.8 g·L⁻¹, respectively. -1 The results showed that 100 r·min was more suitable for the fermentation synthesis of α-ketoisovalerate by strains that inhibited pdh expression, and the yield was further increased after inhibiting pdh expression.

[0130] (3) CRISPRi technology combined with degradation tag to inhibit ilvE and pdh gene

[0131] Following the same strategy as in Part (4) of Example 2, the targeting fragment was constructed using P75 / P76 primer PCR. A DAS+4 degradation tag was added to the C-terminus of the pdh gene on chromosome 050Y2 of strain 050Y2, and colony PCR was performed using P77 / P78 primers to obtain strain 050Y3.

[0132] Table 14 Primers used in the construction of strain 050Y3

[0133]

[0134]

[0135] Recombinant plasmids pCTSDT, pACYC-trc-dcas9-444, and pACYC-trc-dcas9-444-478 were transformed into strain 050Y3. Recombinant strains 050Y2 / pCTSDT+pACYC-trc-dcas9-444-478, 050Y3 / pCTSDT+pACYC-trc-dcas9-444, and 050Y3 / pCTSDT+pACYC-trc-dcas9-444-478 were inoculated at 2% (v / v) in M9 medium containing 36 g / L glucose. When the bacterial cell concentration reached an OD of 2.5, IPTG was added to a final concentration of 0.4 mM for induction at 100, 150, and 200 rpm.-1 Shake flask fermentation was performed to compare the effects of PDH degradation tag addition on α-ketoisovaleric acid synthesis. The fermentation results are as follows: Figure 10 As shown.

[0136] When the degradation tag is added alone, at 100 r·min -1 The highest yield was 14.4 g·L. -1 The yield of α-ketoisovalerate was higher than that obtained by using CRISPRi technology alone. When the degradation tag was combined with CRISPRi, the yield of α-ketoisovalerate was within 100 r·min. -1 The concentration was increased to 15.8 g·L. -1 This indicates that the addition of degradation tags reduced PDH enzyme activity. Simultaneously, the low residual pyruvate dehydrogenase activity under microaerobic conditions weakened the TCA cycle, leading to a greater flow of pyruvate metabolic flux towards α-ketoisovaleric acid synthesis. Based on the dynamic regulation of the IlvE metabolic pathway, dynamic regulation of the key competitive metabolic pathway enzyme PDH further increased α-ketoisovaleric acid production by 27.4%.

[0137] Example 4: Constructing the NADH-dependent pathway and strengthening the NADPH-dependent pathway to balance the coenzyme cycle

[0138] (1) Construction of the NADH-dependent pathway: Using whole-plasmid PCR, IlvC (Gene ID 948286) was mutated by A71S, R76D, S78D, and Q110V (mutated IlvC sequence is shown in Sequence 5). Using pCTSDT plasmid as template, and with primers P13 / P14 in Table 15, pCTSDT* ​​plasmid (ilvC gene with A71S, R76D, and S78D mutations) was constructed by whole-plasmid PCR. Then, using pCTSDT* ​​as template, and with primers P15 / P16 as upstream and downstream primers, whole-plasmid PCR was performed to obtain the recombinant plasmid pCTSDT-ilvC(mut)ilvC (with A71S, R76D, S78D, and Q110V mutations) carrying the ilvC mutant shown in SEQ ID NO.1.

[0139] Table 15 Primers involved in IlvC enzyme modification

[0140]

[0141] The recombinant plasmids pCTSDT-ilvC(mut) and pACYC-trc-dcas9-444-478 were transformed into strain 050Y3 to obtain the recombinant strain 050Y3 / pCTSDT-ilvC(mut)+pACYC-trc-dcas9-444-478. This strain and the control strain 050Y2 / pCTSDT+pACYC-trc-dcas9-444-478 were then subjected to temperature checks at 100 and 200 rpm, respectively. -1 Fermentation was performed in a shake flask. Fermentation conditions were as follows: 2 mL of seed culture was inoculated into 50 mL of M9 medium containing 36 g / L glucose, and cultured on a shaker at 37°C and 200 rpm. The cell OD... 600 When the pH value reached 2.5, IPTG inducer was added to a final concentration of 0.4 mmol / L. The shake flask was then placed at 30°C and incubated on a shaker at 100 or 200 rpm for 60 h. The yield of α-ketoisovaleric acid was measured, and the results are as follows: Figure 11 As shown.

[0142] At 100 r·min -1 After 60 hours of shake-flask fermentation, the yield of α-ketoisovaleric acid decreased to 14.5 g·L⁻¹. -1 Additionally, at 100 and 200 r / min -1 The presence of large amounts of pyruvate in the samples indicates that the metabolic pathway from pyruvate to product synthesis is not smooth, which may be due to the reduced enzyme activity of the IlvC mutant enzyme.

[0143] (2) Enhanced NADPH-dependent pathway

[0144] This study further overexpressed the pntAB gene (Gene IDs 946628 and 946144), converting the two NADH molecules generated in the EMP pathway into NADPH, constructing an NADPH-dependent pathway to promote the balance of the coenzyme cycle. A T7 promoter was added before the pntAB gene on the chromosome of E. coli 050Y3 constructed in Example 3 to obtain strain E. coli 050Y4. Strain construction method: Using the pACYC-kan-T7100-pntAB plasmid as a template, the targeted fragment was amplified by PCR using primers P79 / P80, integrated into the 050Y3 chromosome using the Red recombination system, and verified by PCR using primers P81 / P82. The results are as follows: Figure 12As shown, the wild-type strain's PCR amplification fragment size was 550 bp, the size after integration of the T7-kan fragment was 1870 bp, and the size after removing the kan fragment was approximately 600 bp, indicating that the recombinant strain 050Y4 was successfully constructed. pCTSDT and the plasmid pACYC-trc-dcas9-444-478 constructed in Example 3 were transformed into 050Y4 competent cells to obtain strain 050Y4 / pCTSDT+pACYC-trc-dcas9-444-478.

[0145] Table 16 Primers used to construct strain 050Y4

[0146]

[0147] α-Ketoisovalerate was synthesized by shake-flask fermentation of strain 050Y4 / pCTSDT+pACYC-trc-dcas9-444-478. The fermentation conditions were as follows: 2 mL of seed culture was inoculated into 50 mL of M9 medium containing 36 g / L glucose, and cultured at 37°C with shaking at 200 rpm. The cell OD... 600 When the value reached 2.5, IPTG inducer was added to a final concentration of 0.4 mmol / L. The shake flask was then placed at 30°C and cultured on a shaker at 100 or 200 rpm for 60 h. The results showed that after the pntAB gene expression was enhanced, α-ketoisovalerate was induced at 100 rpm. -1 The yield from the lower fermentation stage was 17.1 g·L. -1 This further increased by 10%. This indicates that pntAB overexpression can enhance the conversion of NADH to NADPH and increase the synthesis level of α-ketoisovaleric acid.

[0148] Example 5: Construction of a combined strategy strain for fermentation production of α-ketoisovaleric acid

[0149] (1) Combination strategy strains shake flask fermentation

[0150] The recombinant plasmid pCTSDTQ487S-RBS55 (published in "Recombinant Escherichia coli Metabolic Engineering Synthesis of α-Ketoisovalerate", China Science and Technology Paper Online, 2022-01-29, http: / / www.paper.edu.cn / releasepaper / content / 202201-127) and the recombinant plasmid pACYC-trc-dcas9-444-478 constructed in Example 3 were transformed into the strain 050Y4 constructed in Example 4 to obtain the recombinant strain 050Y4 / pCTSDTQ487S-RBS55+pACYC-trc-dcas9-444-478. This strain and the control strain (050Y4 / pCTSDT+pACYC-trc-dcas9-444-478 constructed in Example 4) were then subjected to an incubation period of 100 rpm. -1 The fermentation culture was carried out to determine the yield of α-ketoisovaleric acid and the accumulation of isobutanol. The fermentation conditions were as follows: 2 mL of seed culture was inoculated into 50 mL of M9 medium containing 36 g / L glucose, and cultured on a shaker at 37℃ and 200 rpm. The cell OD... 600 When the value reaches 2.5, add IPTG inducer to a final concentration of 0.4 mmol / L, place the shake flask at 30℃, and incubate with shaking at 100 r / min for 60 h.

[0151] The results are as follows Figure 13 As shown, replacing plasmid pCTSDT with pCTSDTQ487S-RBS55 increased the yield of α-ketoisovaleric acid from 17.1 g·L⁻¹. -1 Reduced to 16.5 g·L -1 The decrease was not significant. However, isobutanol accumulation increased from 1.48 g·L⁻¹. -1 Reduced to 0.52 g·L -1 The concentration of isobutanol was significantly reduced by 64.9%, achieving a reduction in isobutanol accumulation without significantly affecting the yield of α-ketoisovaleric acid. This helps avoid the accumulation of high concentrations of isobutanol during scale-up cultivation, which inhibits cell growth. Furthermore, the use of inorganic salt medium by strain 050Y4 / pCTSDTQ487S-RBS55 for α-ketoisovaleric acid synthesis effectively reduces the cost of the fermentation medium.

[0152] (2) Combined strategy strains fermented at the fermenter level

[0153] The strain 050Y4 / pCTSDTQ487S-RBS55+pACYC-trc-dcas9-444-478 was expanded in a 5L fermenter. To improve the yield and conversion rate of α-ketoisovaleric acid, a two-stage fermentation model was adopted. The first stage was the aerobic cell growth stage; when the cell growth reached OD... 600When the concentration reaches 30, the process transitions to the second stage, microaerobic fermentation (with dissolved oxygen concentration controlled at ≤10%) to synthesize α-ketoisovaleric acid.

[0154] The specific steps are as follows:

[0155] Single colonies were picked and incubated in 30 mL of LB medium at 37°C and 200 rpm for 8 h. The culture was then inoculated into 50 mL of seed culture medium and incubated at 37°C and 200 rpm for 12 h. 100 mL of the seed culture was then inoculated into a 5 L fermenter containing 2 L of M9 fermentation medium, with an initial glucose concentration of 30 g / L. During the cell growth phase, the temperature was controlled at 37°C, and the dissolved oxygen concentration was maintained ≥30% by adjusting the stirring speed and aeration rate. When OD... 600 When the pH reaches 30, the α-ketoisovalerate synthesis stage begins. IPTG at a final concentration of 0.8 mM is added for induction, while the temperature is simultaneously lowered to 30°C to synthesize α-ketoisovalerate. Throughout the fermentation process, ammonia water is used to control the pH to 7.

[0156] During fermentation, when the residual sugar is below 10 g·L -1 Add 30g·L -1 A total of 240g of glucose was added, and fermentation was continued for 60 hours until it was terminated, at which point the residual sugar was 1.4g·L⁻¹. -1 .

[0157] The results of changes in cell concentration and α-ketoisovalerate production over time are as follows: Figure 14 As shown, when the bacterial cells have grown for 14 hours, the OD... 600 When the concentration reached 30.0, the culture was switched to microaerophilic conditions for α-ketoisovalerate synthesis. During the product synthesis stage, the bacterial concentration did not increase significantly, indicating that the dynamic regulatory element effectively controlled the TCA cycle and valine biosynthesis pathway to promote the complete utilization of carbon sources for α-ketoisovalerate synthesis. α-ketoisovalerate began to accumulate in the microaerophilic stage, and the yield stabilized after 60 hours of fermentation, ultimately reaching 35.2 g·L⁻¹. -1 The total conversion rate reached 0.73 mol·mol⁻¹ -1 The conversion rate of glucose in the second stage reached 0.99 mol·mol⁻¹. -1 Glucose has a volumetric productivity of 0.67 g / (L·h). -1 (Table 17). Throughout the fermentation process, the accumulation of isobutanol decreased to 1.2 g·L⁻¹. -1 The yield was only 0.04 mol·mol⁻¹ -1 Glucose and isobutanol accumulation were significantly reduced. Further optimization of dissolved oxygen intensity during the microaerobic stage showed that the optimal dissolved oxygen (DO) value was 10%, and neither increasing nor decreasing the oxygen supply intensity improved the yield of α-ketoisovaleric acid.

[0158] The dynamically regulated strain 050Y4 / pCTSDTQ487S-RBS55+pACYC-trc-dcas9-444-478 requires no addition of organic nitrogen source during the entire fermentation process, significantly reducing the cost of culture medium consumption. The results of this study using basal culture medium are comparable to those reported previously (Applied and Environmental Microbiology, 2013, 79(18):5566-5575), which yielded 33.7 g·L⁻¹ of organic nitrogen source. -1 It was on par, but the overall conversion rate was twice that of the other two.

[0159] Table 17. Fermentation data statistics for strain 050Y4 / pCTSDTQ487S-RBS55 in a 5L fermenter.

[0160]

[0161] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant E. coli, the construction method comprising: (1) with E. coli The starting strain was B0016-050, which integrated the T7 RNA polymerase gene into the poxB site. ilvE The C-terminal fusion expression of the DAS+4 degradation tag, pdh A DAS+4 degradation tag was added to the C-terminus of the gene, and a T7 promoter was added before the pntAB gene to obtain strain 050Y4. (2) transforming the recombinant plasmid pACYC-trc-dcas9-444-478 and the recombinant plasmid pCTSDTQ487S-RBS55 into the strain 050Y4 to obtain the recombinant E. coli; wherein the recombinant plasmid pACYC-trc-dcas9-444-478 expresses dCas9 protein, sgRNA for inhibiting ilvE gene and sgRNA for inhibiting pdh gene by trc promoter; the sequence of sgRNA for inhibiting ilvE gene is GGATGGTGTTTGGTGCTGCGCGG; the sequence of sgRNA for inhibiting pdh gene is TCAGTGGAGTCCCAGATACGCGG.

2. A method of producing α-ketoisovalerate, characterized by, The recombinant E. coli of claim 1 is used as a fermentation strain to produce α-ketoisovalerate by fermentation.

3. The method of claim 2, wherein, The method adopts two-stage fermentation: The first stage: controlling the temperature to be 37℃ and the dissolved oxygen concentration to be ≥30%; Second stage: when OD 600 When the OD value reaches the required induction value, IPTG is added for induction, and the temperature is lowered to 28-30°C, and the dissolved oxygen concentration is controlled to be ≤10%. 4.The recombinant E. coli of claim 1, or the method of any one of claims 2-3, is used in the production of products containing α-ketoisovalerate in the field of medicine, food or cosmetics.

Citation Information

Patent Citations

  • CN111607623A

  • CN114480235A