Kit for constructing nuclear transfer donor cells for ataxia-telangiectasia model pigs with mutations in the atm gene

Abstract

The application discloses a kit for constructing an ATM gene mutation ataxia-telangiectasia model pig nuclear transfer donor cell. The application provides a kit comprising ATM-gRNA1 shown in SEQ ID NO: 16, ATM-gRNA4 shown in SEQ ID NO: 17 and NCN protein. The application also provides a method for preparing a recombinant cell: co-transfecting a pig cell with ATM-gRNA1, ATM-gRNA4 and NCN protein to obtain a recombinant cell. The recombinant cell is a recombinant cell with ATM gene mutation. The kit is used for: preparing a recombinant cell; preparing an ataxia-telangiectasia model pig; preparing an ataxia-telangiectasia cell model or an ataxia-telangiectasia tissue model or an ataxia-telangiectasia organ model. The application has great application value for research and development of ataxia-telangiectasia drugs and revealing the pathogenesis of the disease.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, specifically to the field of gene editing, and more specifically relates to a kit for constructing an ATM gene mutation ataxia-telangiectasia model pig nuclear transfer donor cell. BACKGROUND

[0002] Ataxia-telangiectasia is a rare autosomal recessive disease. The main features of the disease are progressive cerebellar ataxia, which develops into severe neuromotor dysfunction, conjunctival and cutaneous telangiectasia, immunodeficiency, and recurrent paranasal sinusitis and pulmonary infection, sensitivity to ionizing radiation, and high incidence of tumors. Patients in the late stage of the disease mostly die of infection and tumors, and the overall prognosis is poor.

[0003] Ataxia-telangiectasia is mainly caused by mutations in the ATM (Ataxia-telangiectasia mutated proteins) gene. ATM was first discovered in patients with ataxia-telangiectasia, and is sensitive to ionizing radiation and prone to cancer. After normal cells are treated with radiation, DNA damage activates repair mechanisms, such as DNA repair, which induces apoptosis. Studies have found that in the biological response to DNA damage, ATM can activate p53 through phosphorylation, which in turn transcribes and activates the expression of cell cycle checkpoint protein p21WAF1 CIP1. Mutated ATM genes can interfere with the cell's ability to recognize damaged DNA, leading to the accumulation of damaged DNA in cells, which in turn leads to genomic instability, chromosomal breakage and rearrangement, causing ataxia-telangiectasia.

[0004] Research on the mechanism of occurrence and development of ataxia-telangiectasia and the development of corresponding treatment methods all need to be based on animal models. The commonly used animal model is the mouse model, but mice differ greatly from humans in terms of size, organ size, physiology, pathology, and other aspects, and cannot truly simulate human normal physiological and pathological states. Pigs, as large animals, are similar in size and physiological function to humans, are easy to breed in large quantities, and have lower requirements in terms of ethics and animal protection, making them ideal animals for human disease models.

[0005] Gene editing is a biological technology that has made significant progress in recent years, including gene editing based on homologous recombination, ZFN, TALEN, CRISPR / Cas9, and other editing technologies based on nucleases. Among them, CRISPR / Cas9 technology is the most advanced gene editing technology currently available. Currently, gene editing technology is being increasingly applied to the production of animal models. SUMMARY

[0006] The present application aims to provide a kit for constructing an ATM gene mutation ataxia-telangiectasia model pig nuclear transfer donor cell.

[0007] The present application provides a kit comprising ATM-gRNA1, ATM-gRNA4 and NCN protein.

[0008] The present application also provides a kit comprising ATM-gRNA1, ATM-gRNA4 and PRONCN protein.

[0009] The present application also provides a kit comprising ATM-gRNA1, ATM-gRNA4 and specific plasmid.

[0010] The kit described above also comprises a pig cell.

[0011] The present application provides the use of ATM-gRNA1, ATM-gRNA4 and NCN protein in the preparation of a kit.

[0012] The present application also provides the use of ATM-gRNA1, ATM-gRNA4 and PRONCN protein in the preparation of a kit.

[0013] The present application also provides the use of ATM-gRNA1, ATM-gRNA4 and specific plasmid in the preparation of a kit.

[0014] The use of the kit described above is as follows (a) or (b) or (c): (a) preparation of a recombinant pig cell; (b) preparation of an ataxia-telangiectasia model pig; (c) preparation of an ataxia-telangiectasia cell model or an ataxia-telangiectasia tissue model or an ataxia-telangiectasia organ model.

[0015] The present application provides a method for preparing a recombinant pig cell, comprising the following steps: co-transfecting ATM-gRNA1, ATM-gRNA4 and NCN protein into a pig cell to obtain a recombinant pig cell.

[0016] The co-transfection is specifically performed by electroporation.

[0017] The parameter setting of the electroporation can be specifically 1450V, 10ms, 3pulse.

[0018] The co-transfection can be specifically performed by using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporator.

[0019] The ratio of ATM-gRNA1, ATM-gRNA4 and NCN protein is 0.8-1.2 μg ATM-gRNA1: 0.8-1.2 μg ATM-gRNA4: 3-5 μg NCN protein in turn.

[0020] The ratio of ATM-gRNA1, ATM-gRNA4 and NCN protein is 1 μg ATM-gRNA1: 1 μg ATM-gRNA4: 4 μg NCN protein in turn.

[0021] The ratio of pig cells, ATM-gRNA1, ATM-gRNA4 and NCN protein is 100,000 pig cells: 0.8-1.2 μg ATM-gRNA1: 0.8-1.2 μg ATM-gRNA4: 3-5 μg NCN protein in turn.

[0022] The ratio of pig cells, ATM-gRNA1, ATM-gRNA4 and NCN protein is 100,000 pig cells: 1 μg ATM-gRNA1: 1 μg ATM-gRNA4: 4 μg NCN protein in turn.

[0023] The ATM-gRNA1 in any of the above is sgRNA, and the target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16.

[0024] Specifically, the ATM-gRNA1 is shown as SEQ ID NO: 16.

[0025] Specifically, the ATM-gRNA1 is shown as SEQ ID NO: 10.

[0026] The ATM-gRNA4 in any of the above is sgRNA, and the target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17.

[0027] Specifically, the ATM-gRNA4 is shown as SEQ ID NO: 17.

[0028] Specifically, the ATM-gRNA4 is shown as SEQ ID NO: 13.

[0029] The NCN protein in any of the above is Cas9 protein or fusion protein with Cas9 protein.

[0030] Specifically, the NCN protein is shown as SEQ ID NO: 3.

[0031] The pig cell in any of the above is pig fibroblast.

[0032] The pig cell in any of the above is pig primary fibroblast.

[0033] Any of the above pig cells is a pig primary fibroblast cell obtained from a newborn pig.

[0034] The preparation method of the NCN protein comprises the following steps:

[0035] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium;

[0036] (2) culturing the recombinant bacterium in a liquid medium at 30°C, then adding IPTG and inducing culture at 25°C, and then collecting the bacterial bodies;

[0037] (3) subjecting the collected bacterial bodies to bacterial body disruption, and collecting a crude protein solution;

[0038] (4) purifying the fusion protein with His6 tag from the crude protein solution by affinity chromatography;

[0039] (5) subjecting the fusion protein with His6 tag to enterokinase digestion with His6 tag, and then removing the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein;

[0040] The fusion gene shown in SEQ ID NO: 1 at positions 5209-9852 is in the plasmid pKG-GE4.

[0041] The preparation method of the NCN protein specifically comprises the following steps:

[0042] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium.

[0043] (2) inoculating the recombinant bacterium obtained in step (1) into a liquid LB medium containing ampicillin and subjecting to shaking culture;

[0044] (3) inoculating the bacterial solution obtained in step (2) into a liquid LB medium, and subjecting to shaking culture at 30°C and 230 rpm until the OD value is 1.0, then adding IPTG to make the concentration in the system be 0.5 mM, and then subjecting to shaking culture at 25°C and 230 rpm for 12 hours, and then centrifuging to collect the bacterial bodies; 600nm

[0045] (4) taking the bacterial bodies obtained in step (3), and washing with PBS buffer;

[0046] (5) taking the bacterial bodies obtained in step (4), adding a crude extraction buffer and suspending the bacterial bodies, then subjecting to bacterial body disruption, then centrifuging to collect the supernatant, filtering by a filter membrane with a pore size of 0.22 μm, and collecting the filtrate;

[0047] ​(6) purifying the fusion protein having His6 tag (fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) using affinity chromatography;

[0048] (7) taking the post-column solution collected in step (6), concentrating using an ultrafiltration tube, and then diluting with 25 mM Tris-HCl (pH 8.0);

[0049] (8) adding recombinant bovine enterokinase having His6 tag to the solution obtained in step (7) and performing enzyme cleavage;

[0050] (9) mixing the solution on which step (8) is completed with Ni-NTA resin, incubating, and then collecting the supernatant by centrifugation;

[0051] (10) taking the supernatant obtained in step (9), concentrating using an ultrafiltration tube, and then adding an enzyme storage solution, which is an NCN protein solution.

[0052] The specific method of purifying the fusion protein having His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0053] First, the Ni-NTA Sepharose column is equilibrated with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then 50 ml of the filtrate obtained in step (5) is loaded at a flow rate of 0.5-1 ml / min; then the column is washed with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then the column is washed with 5 column volumes of buffer at a flow rate of 1 ml / min to remove impure proteins; and then elution is performed with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and the post-column solution (90-100 ml) is collected.

[0054] Any of the above-described PRONCN proteins sequentially comprises the following elements from upstream to downstream: a signal peptide, a chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.

[0055] The signal peptide functions to promote secretory expression of the protein. The signal peptide can be selected from the group consisting of an Escherichia coli alkaline phosphatase (phoA) signal peptide, a Staphylococcus aureus protein A signal peptide, an Escherichia coli outer membrane protein (ompa) signal peptide, or a signal peptide of any other prokaryotic gene, and is preferably a phoA signal peptide. The phoA signal peptide is used to guide secretory expression of the target protein into the periplasmic space of bacteria, thereby separating the target protein from intracellular proteins of bacteria, and the target protein secreted into the periplasmic space of bacteria is expressed in a soluble form and can be cleaved by a signal peptidase in the periplasmic space of bacteria.

[0056] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably a thioreduction protein (TrxA protein). A thioreduction protein, acting as a molecular chaperone, helps the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein.

[0057] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, with a His tag being more preferred. The His tag can bind to a Ni column, enabling one-step Ni column affinity chromatography to purify the target protein, greatly simplifying the purification process.

[0058] The function of the protease cleavage site is to cleave the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endopeptide, with enterokinase being more preferred. EK is an enterokinase cleavage site, facilitating the cleavage of the fused TrxA-His segment using enterokinase to obtain the native form of Cas9 protein. In this application, after cleaving the fusion protein with a His-tagged commercial enterokinase, the TrxA-His segment and the His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification dialysis processes.

[0059] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. The NLS is the nuclear localization signal; an NLS site is designed at both the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing.

[0060] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0061] The PRONCN protein is shown in SEQ ID NO: 2.

[0062] Each of the above-mentioned specific plasmids comprises the following elements from upstream to downstream: promoter, operon, ribosome binding site, gene encoding PRONCN protein, and terminator.

[0063] The promoter may specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0064] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, the expression of the target protein can be induced by IPTG at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Induction at low temperature also significantly improves the solubility of the expressed target protein.

[0065] The ribosome binding site is the ribosome binding site during protein translation, which is essential for protein translation.

[0066] The terminator can specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.

[0067] For the codons of spCas9 protein, this application has optimized the codons to fully adapt to the codon preferences of the high-efficiency E. coli expression strain E. coli BL21(DE3) selected in this application, thereby improving the expression level of Cas9 protein.

[0068] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0069] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.

[0070] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.

[0071] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0072] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0073] The coding sequence of His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0074] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0075] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0076] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0077] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0078] The T7 terminator is nucleotides 9902-9949 in SEQ ID NO: 1.

[0079] Specifically, the specific plasmid is plasmid pKG-GE4.

[0080] The plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121-9949 of SEQ ID NO: 1.

[0081] Specifically, any of the plasmids pKG-GE4 described above is shown in SEQ ID NO: 1.

[0082] This invention also protects recombinant porcine cells prepared by any of the methods described above.

[0083] The recombinant pig cells are recombinant pig cells with a mutation in the ATM gene.

[0084] The recombinant pig cells can specifically be single-cell clones with genotypes of heterozygosity, identical biallelic mutants, or different biallelic mutants as shown in Table 1.

[0085] This invention also protects the use of the recombinant porcine cells in the preparation of ataxia-telangiectasia model pigs.

[0086] Using the recombinant pig cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are ataxia-telangiectasia model pigs.

[0087] This invention also protects porcine tissues of model pigs prepared using the recombinant porcine cells, namely, an ataxia-telangiectasia tissue model.

[0088] This invention also protects porcine organs of model pigs prepared using the recombinant porcine cells, namely, an ataxia-telangiectasia organ model.

[0089] This invention also protects porcine cells of model pigs prepared using the recombinant porcine cells, namely, an ataxia-telangiectasia cell model.

[0090] The present invention also protects the application of the recombinant porcine cells, the ataxia-telangiectasia tissue model, the ataxia-telangiectasia organ model, the ataxia-telangiectasia cell model, or the ataxia-telangiectasia model pig, as follows (d1) or (d2) or (d3) or (d4):

[0091] (d1) Screening for drugs to treat ataxia-telangiectasia;

[0092] (d2) Efficacy evaluation of drugs for ataxia-telangiectasia;

[0093] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for ataxia-telangiectasia;

[0094] (d4) To study the pathogenesis of ataxia-telangiectasia.

[0095] The pig mentioned above can specifically refer to the Congjiang Xiang pig.

[0096] The pigs mentioned above can specifically refer to newborn Congjiang Xiang pigs.

[0097] The pig mentioned above can specifically be the Bama miniature pig.

[0098] The pigs mentioned above can specifically refer to newborn Bama miniature pigs.

[0099] Any of the above-mentioned ataxia-telangiectasia is caused by mutations in the ATM gene.

[0100] Porcine ATM gene information: Encodes ATM serine / threonine kinase; located on chromosome 9; Gene ID is 100101922, Sus scrofa.

[0101] The amino acid sequence of the protein encoded by the porcine ATM gene is shown in SEQ ID NO: 8.

[0102] The porcine ATM gene contains the DNA segment shown in SEQ ID NO: 9.

[0103] Any of the above-described mutations are deletions and / or insertions and / or substitutions of one or more nucleotides.

[0104] Any of the above-described mutations is the deletion of one or more nucleotides.

[0105] Any of the above mutations is an insertion of one or more nucleotides.

[0106] Any of the above-described mutations are deletions and insertions of one or more nucleotides.

[0107] Compared with the prior art, the present invention has at least the following beneficial effects:

[0108] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).

[0109] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.

[0110] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.

[0111] (2) The vector constructed in this invention uses the strong promoter T7-lac, which can efficiently express the target protein, to express the target protein. The signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) guides the secretion of the target protein into the bacterial periplasmic lumen, thereby separating it from intracellular proteins. The target protein secreted into the bacterial periplasmic lumen is soluble. Simultaneously, the thioreduction protein TrxA is fused with the Cas9 protein for expression. TrxA helps the co-expressed target protein form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein. To facilitate the purification of the target protein, a His tag is designed, allowing for one-step Ni column affinity chromatography purification of the target protein, greatly simplifying the purification process. Furthermore, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment, yielding the native form of the Cas9 protein. After cleaving the fusion protein with a His-tagged enterokinase, the TrxA-His polypeptide fragment and the His-tagged enterokinase can be removed by a single affinity chromatography step, yielding the native form of Cas9 protein. This avoids the damage and loss to the target protein caused by multiple purification dialysis steps. Furthermore, this invention also designs an NLS site at the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing. Additionally, this invention selects E. coli BL21(DE3) as the target protein expression strain, which can efficiently express exogenous genes cloned into expression vectors containing the phage T7 promoter (such as pET-32a). Moreover, this invention optimizes the codons for the Cas9 protein to perfectly suit the codon preferences of the expression strain, thereby improving the expression level of the target protein. Furthermore, this invention induces the expression of the target protein with IPTG at low temperature after the bacteria have grown to a certain quantity, avoiding the impact of premature expression on host bacterial growth. Low-temperature induction also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization design and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with that of the commercial Cas9 protein.

[0112] (3) Gene editing was performed using the Cas9 high-efficiency protein constructed and expressed in this invention in combination with in vitro transcribed gRNA, and the optimal ratio of Cas9 and gRNA was optimized. The final rate of gene-edited single-cell clones was as high as 96.7%, which is much higher than the conventional gene editing efficiency (10-30%).

[0113] (4) Using the target gene knockout single-cell clone obtained by the present invention to perform somatic cell nuclear transfer animal cloning, the target gene knockout clone pig can be directly obtained, and the gene mutation can be stably inherited.

[0114] The method of microinjecting gene-edited material into fertilized eggs followed by embryo transfer, used in mouse model creation, has a relatively low probability of directly obtaining gene-mutated offspring, requiring crossbreeding and selection of offspring. This method is not suitable for creating models of large animals (such as pigs) with long gestation periods. Therefore, this invention employs a technically challenging method of primary cell in vitro editing, Cas9 protein and double gRNA cleavage, and screening for positively edited single-cell clones. Subsequently, somatic cell nuclear transfer animal cloning technology is used to directly obtain pig models of the corresponding disease. This significantly shortens the pig model creation cycle and saves manpower, material resources, and financial resources.

[0115] This invention utilizes CRISPR / Cas9 technology combined with dual gRNA editing to knock out the ATM gene, mimicking the genetic characteristics of ataxia-telangiectasia, and obtained a single-cell clone with the ATM gene knockout. This lays the foundation for later development of ataxia-telangiectasia model pigs using somatic cell nuclear transfer animal cloning technology. This invention will contribute to the research and elucidation of the pathogenesis of ataxia-telangiectasia caused by ATM gene dysfunction. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and thus offering a powerful experimental tool for the successful treatment of human ataxia-telangiectasia. This invention has significant application value for the development of drugs for ataxia-telangiectasia and for elucidating the pathogenesis of this disease. Attached Figure Description

[0116] Figure 1 This is a schematic diagram of the structure of plasmid pET-32a.

[0117] Figure 2 This is a schematic diagram of the structure of plasmid pKG-GE4.

[0118] Figure 3 This is an electrophoresis diagram showing the optimized ratio of gRNA to NCN protein in Example 2.

[0119] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 2.

[0120] Figure 5 This is an electrophoresis image of PCR amplification using different primer pairs with genome extracted from ear tissue of a pig named BX4 as a template in Example 3.

[0121] Figure 6 The image shows electrophoresis results of PCR amplification using primer pairs consisting of ATM-E3-JDF62 and ATM-E3-JDR515, respectively, with genomic DNA from 10 pigs as templates in Example 3.

[0122] Figure 7 The results of forward sequencing and wild-type sequence alignment of single-cell clone number 23 are shown.

[0123] Figure 8 The results of forward sequencing and wild-type sequence alignment of single-cell clone number 8 are shown.

[0124] Figure 9 The results of forward sequencing and wild-type sequence alignment of single-cell clone number 6 are shown.

[0125] Figure 10 The results of forward sequencing and wild-type sequence alignment of single-cell clone number 7 are shown. Detailed Implementation

[0126] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0127] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercially available Cas9-A protein is a commercially available, effective Cas9 protein. The commercially available Cas9-B protein is a commercially available, effective Cas9 protein. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, incubator with 5% CO2 and 5% O2.

[0128] The porcine primary fibroblasts used in Example 2 were prepared from the ear tissue of newly hatched Jiangxiang pigs. The porcine primary fibroblasts used in Examples 3 and 4 were both prepared from the ear tissue of newly hatched Bama Xiang pigs. Method for preparing primary porcine fibroblasts from porcine ear tissue: ① Take 0.5g of porcine ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30-40s, wash 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and wash once with PBS buffer; ② Cut the tissue into small pieces with scissors, digest with 5mL of 0.1% collagenase solution (Sigma) at 37℃ for 1h, then centrifuge at 500g for 5min and discard the supernatant; ③ Resuspend the pellet in 1mL of complete culture medium, then plate it into a 10cm diameter cell culture dish containing 10mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells reach approximately 60% confluence with the bottom of the dish; ④ After completing step ③, digest and collect the cells with trypsin, then resuspend them in complete culture medium for subsequent electroporation experiments.

[0129] Example 1: Preparation and purification of NCN protein

[0130] I. Construction of a high-efficiency prokaryotic Cas9 expression vector

[0131] A schematic diagram of the structure of plasmid pET-32a is shown below. Figure 1 .

[0132] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid; its structural diagram is shown below. Figure 2 .

[0133] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag (also known as the His6 tag), nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for Escherichia coli BL21(DE3) strain.

[0134] The main modifications to plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein was retained. The TrxA protein can help the expressed target protein form disulfide bonds, increasing the solubility and activity of the target protein. An alkaline phosphatase signal peptide coding sequence was added before the TrxA protein coding region. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the bacterial periplasmic lumen and can be cleaved by prokaryotic periplasmic signal peptidase. ② A His-Tag coding sequence was added after the TrxA protein coding sequence. The His-Tag can be used for... Enrichment of the target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the Cas9 gene of suitable Escherichia coli BL21(DE3) strain with optimized codons, and add nuclear localization signal coding sequences upstream and downstream of this gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.

[0135] The fusion gene in plasmid pKG-GE4, as shown in nucleotides 5209-9852 of SEQ ID NO: 1, encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0136] II. Induced Expression

[0137] 1. Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0138] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin and culture overnight at 37°C with shaking at 200 rpm.

[0139] 3. Inoculate the bacterial culture obtained in step 2 into liquid LB medium and incubate at 30°C with shaking at 230 rpm until OD reaches 100%. 600nm The concentration was set to 1.0, then isopropyl thiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The mixture was then cultured at 25°C and 230 rpm for 12 hours with shaking. Finally, the cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes.

[0140] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.

[0141] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0142] 1. Take the bacterial cells obtained in step 2, add crude extraction buffer and suspend the cells. Then, homogenize the cells using a homogenizer (3 cycles at 1000 rpm). Centrifuge at 15000g for 30 min at 4℃, collect the supernatant, and filter the supernatant through a 0.22μm pore size filter membrane. Collect the filtrate. In this step, 10 ml of crude extraction buffer is prepared for every gram of wet weight of bacterial cells. Crude extraction buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM PMSF, and the balance is ddH2O.

[0143] 2. Affinity chromatography was used to purify the fusion protein.

[0144] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; finally, elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0145] Ni-NTA agarose column: GenScript, L00250 / L00250-C, 10ml packing material. Equilibration buffer: Contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, balance ddH2O. Buffer solution: Contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, balance ddH2O. Elution buffer: Contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, balance ddH2O.

[0146] IV. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0147] 1. Take 15 ml of the post-column solution collected in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0148] 2. Add the commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His6-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0149] 3. Take the solution from step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4-5.5 ml).

[0150] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity). Then add it to the enzyme stock solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution. Enzyme stock solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, and the balance is ddH2O.

[0151] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.

[0152] The NCN protein used in subsequent embodiments was provided by an NCN protein solution.

[0153] Example 2: Performance of NCN protein

[0154] The following two gRNA targets targeting the TTN gene were selected:

[0155] TTN-gRNA1 target: AGAGCACAGTCAGCCTGGCG;

[0156] TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.

[0157] The primers used to identify target fragments containing gRNA from the TTN gene are as follows:

[0158] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0159] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0160] I. Preparation of gRNA

[0161] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates

[0162] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0163] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0164] 2. Obtain gRNA through in vitro transcription

[0165] Using TTN-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0166] Using TTN-T7-gRNA2 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA2 was recovered and purified using the Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0167] II. Optimization of the ratio of gRNA to NCN protein

[0168] 1. Co-transfection of porcine primary fibroblasts

[0169] Group 1: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1 : 0.5 μg TTN-gRNA2 : 4 μg NCN protein.

[0170] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1 : 0.75 μg TTN-gRNA2 : 4 μg NCN protein.

[0171] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0172] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1 : 1.25 μg TTN-gRNA2 : 4 μg NCN protein.

[0173] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0174] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0175] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0176] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0177] See electrophoresis image Figure 3 The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0178] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0179] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.

[0180] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0181] 1. Co-transfection of porcine primary fibroblasts

[0182] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0183] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0184] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-B protein.

[0185] Control group: porcine primary fibroblasts were co-transfected with TTN-gRNA1 and TTN-gRNA2. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2.

[0186] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0187] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0188] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0189] See electrophoresis image Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein was 28.5%, that using NCN protein was 85.6%, and that using commercial Cas9-B protein was 16.6%.

[0190] The results showed that, compared with commercially available Cas9 protein, the NCN protein prepared using this invention significantly improved gene editing efficiency.

[0191] Example 3: Screening for highly efficient gRNA targets of the ATM gene

[0192] Information on the porcine ATM gene: Encoding ATM serine / threonine kinase; located on chromosome 9; Gene ID: 100101922, Sus scrofa. The amino acid sequence of the protein encoded by the porcine ATM gene is shown in SEQ ID NO: 8. The ATM gene in the porcine genomic DNA contains 66 exons, with the third coding exon and its upstream and downstream 250 bp regions shown in SEQ ID NO: 9.

[0193] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 of patent application 202010084343.6. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 395-680 form the CMV enhancer, nucleotides 682-890 form the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode polypeptide P2A (the amino acid sequence of polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, with the break point at…). Nucleotides 5333-6046 (between the first and second amino acid residues at the C-terminus) encode the EGFP protein, nucleotides 6056-6109 encode polypeptide T2A (the amino acid sequence of polypeptide T2A is “EGRGSLLTCGDVEENPGP”, with the break point between the first and second amino acid residues at the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 form the WPRE sequence element, nucleotides 7382-7615 form the 3'LTR sequence element, and nucleotides 7647-7871 form the bGH poly(A)signal sequence element. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of the self-cleaving peptide P2A and the self-cleaving peptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0194] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 of patent application 202010084343.6. In SEQ ID NO: 3 of patent application 202010084343.6, nucleotides 2280-2539 form the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone. In use, a DNA molecule of approximately 20 bp (the target sequence binding region for gRNA transcription) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid. The recombinant plasmid is then transcribed into gRNA in cells.

[0195] I. Conservation analysis of the pre-defined deletion region of the ATM gene and adjacent genomic sequences

[0196] Ten newborn Bama miniature pigs were selected, including six females (named BC1, BC2, BC3, BC4, BC5, and BC6) and four males (named BX1, BX2, BX3, and BX4).

[0197] ATM-E3-JDF62:CAAAAACAGGTCGTTGGCTGAA;

[0198] ATM-E3-JDR515:GTGAGGTCATTTGGCAGCTATAA;

[0199] ATM-E3-JDF80:GTTGGCTGAATTTTGTCCCTGG;

[0200] ATM-E3-JDR522:TTAAACTGTGAGGTCATTTGGCA.

[0201] Genomic DNA was extracted from ear tissue of a pig named BX4 and used as a template. PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. See the electrophoresis image below. Figure 5 . Figure 5 In the study, primer pairs were used in four groups: Group 1: ATM-E3-JDF62 and ATM-E3-JDR515; Group 2: ATM-E3-JDF62 and ATM-E3-JDR522; Group 3: ATM-E3-JDF80 and ATM-E3-JDR515; and Group 4: ATM-E3-JDF80 and ATM-E3-JDR522. The results showed that the primer pair using ATM-E3-JDF62 and ATM-E3-JDR515 was preferred for amplifying the target fragment.

[0202] Using genomic DNA from 10 pigs as templates, PCR amplification was performed using primer pairs consisting of ATM-E3-JDF62 and ATM-E3-JDR515, followed by 1% agarose gel electrophoresis. (See electrophoresis image below.) Figure 6 PCR amplification products were recovered and sequenced. The sequencing results were compared and analyzed with ATM gene sequences in public databases. Conserved regions common to 10 pigs were selected for gRNA target design.

[0203] II. Target Screening

[0204] Several targets were initially screened by NGG (avoiding possible mutation sites), and four targets were further screened out after preliminary experiments.

[0205] The four target points are as follows:

[0206] ATM-E3-gRNA1 target: TGAAGGACATTCTTTCAGTG;

[0207] ATM-E3-gRNA2 target: TTATAGCAATATATTGCTGA;

[0208] ATM-E3-gRNA3 target: AGTTCTTGACATTTTAGCCT;

[0209] ATM-E3-gRNA4 target: AGAACTCTTGAATTATATCA.

[0210] III. Preparation of gRNA

[0211] The pKG-U6gRNA plasmid was digested with restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0212] ATM-E3-gRNA1-S and ATM-E3-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(ATM-E3-gRNA1). Plasmid pKG-U6gRNA(ATM-E3-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10. ATM-E3-gRNA1 sgRNA ATM-E3-gRNA1 (SEQ ID NO: 10):

[0213] UGAAGGACAUUCUUUCAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0214] ATM-E3-gRNA2-S and ATM-E3-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(ATM-E3-gRNA2). Plasmid pKG-U6gRNA(ATM-E3-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11. ATM-E3-gRNA2 sgRNA ATM-E3-gRNA2 (SEQ ID NO: 11):

[0215] UUAUAGCAAUAUAUUGCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0216] ATM-E3-gRNA3-S and ATM-E3-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(ATM-E3-gRNA3). Plasmid pKG-U6gRNA(ATM-E3-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12. ATM-E3-gRNA3 sgRNA ATM-E3-gRNA3 (SEQ ID NO: 12):

[0217] AGUUCUUGACAUUUUAGCCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0218] ATM-E3-gRNA4-S and ATM-E3-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(ATM-E3-gRNA4). Plasmid pKG-U6gRNA(ATM-E3-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13. ATM-E3-gRNA4 sgRNA ATM-E3-gRNA4 (SEQ ID NO: 13):

[0219] AGAACUCUUGAAUUAUAUCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0220] ATM-E3-gRNA1-S: caccgTGAAGGACATTCTTTCAGTG;

[0221] ATM-E3-gRNA1-A: aaacCACTGAAAGAATGTCCTTCAc;

[0222] ATM-E3-gRNA2-S: caccgTTATAGCAATATATTGCTGA;

[0223] ATM-E3-gRNA2-A:aaacTCAGCAATATATTGCTATAAc;

[0224] ATM-E3-gRNA3-S:caccgAGTTCTTGACATTTTAGCCT;

[0225] ATM-E3-gRNA3-A:aaacAGGCTAAAATGTCAAGAACTc;

[0226] ATM-E3-gRNA4-S:caccgAGAACTCTTGAATTATATCA;

[0227] ATM-E3-gRNA4-A:aaacTGATATAATTCAAGAGTTCTc.

[0228] ATM-E3-gRNA1-S, ATM-E3-gRNA1-A, ATM-E3-gRNA2-S, ATM-E3-gRNA2-A, ATM-E3-gRNA3-S, ATM-E3-gRNA3-A, ATM-E3-gRNA4-S, and ATM-E3-gRNA4-A are all single-stranded DNA molecules.

[0229] IV. Comparison of editing efficiency for different target combinations

[0230] 1. Co-transfection

[0231] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (ATM-E3-gRNA1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (ATM-E3-gRNA1): 1.08 μg of plasmid pKG-GE3.

[0232] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (ATM-E3-gRNA2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (ATM-E3-gRNA2): 1.08 μg of plasmid pKG-GE3.

[0233] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (ATM-E3-gRNA3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (ATM-E3-gRNA3): 1.08 μg of plasmid pKG-GE3.

[0234] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (ATM-E3-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (ATM-E3-gRNA4): 1.08 μg of plasmid pKG-GE3.

[0235] Group 5: Primary porcine fibroblasts were electroporated without plasmids using the same electroporation parameters.

[0236] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0237] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0238] 3. After completing step 2, cells were digested and collected using trypsin, lysed, and genomic DNA was extracted. PCR amplification was performed using primer pairs consisting of ATM-E3-JDF62 and ATM-E3-JDR515, followed by 1% agarose gel electrophoresis to detect mutations in target genes.

[0239] After gel extraction and recovery of the target product, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different targets. The gene editing efficiencies of the first, second, third, and fourth groups were 45%, 22%, 5%, and 36%, respectively, while no gene editing occurred in the fifth group. The results indicate that the ATM-E3-gRNA1 and ATM-E3-gRNA4 targets have high editing efficiencies.

[0240] Example 4: Preparation of ATM gene knockout Bama miniature pig single-cell clone

[0241] Two highly efficient gRNA targets (ATM-E3-gRNA1 target and ATM-E3-gRNA4 target) selected from Example 3 were chosen.

[0242] I. Preparation of gRNA

[0243] 1. Preparation of ATM-T7-gRNA1 and ATM-T7-gRNA4 transcription templates

[0244] The ATM-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.

[0245] The ATM-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.

[0246] 2. Obtain gRNA through in vitro transcription

[0247] ATM-T7-gRNA1 transcription template was used, and in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TMThe ATM-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). ATM-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 16.

[0248] ATM-T7-gRNA4 transcription template was used, and in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The ATM-gRNA4 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). ATM-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 17.

[0249] ATM-gRNA1 (SEQ ID NO: 16):

[0250] GGUGAAGGACAUUCUUUCAGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0251] ATM-gRNA4 (SEQ ID NO: 17):

[0252] GGAGAACUCUUGAAUUAUAUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0253] II. Transfection of porcine primary fibroblasts

[0254] 1. Co-transfect porcine primary fibroblasts with ATM-gRNA1, ATM-gRNA4, and NCN protein. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg ATM-gRNA1 : 1 μg ATM-gRNA4 : 4 μg NCN protein. Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0255] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0256] 3. After completing step 2, digest and collect cells with trypsin, wash with complete culture medium, resuspend in complete culture medium, and then pick each single clone and transfer it to a 96-well plate (1 cell per well, 100 μl of complete culture medium per well) and culture for 2 weeks (replace with fresh complete culture medium every 2-3 days).

[0257] 4. After completing step 3, digest the cells with trypsin and collect them (about 2 / 3 of the cells obtained from each well are seeded into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0258] 5. Take the 6-well plate from step 4, culture until the cells reach 80% confluence, digest with trypsin and collect the cells, and freeze the cells using cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio).

[0259] 6. Take the centrifuge tube from step 4, collect the cells, lyse the cells and extract genomic DNA. Perform PCR amplification using primers consisting of ATM-E3-JDF62 and ATM-E3-JDR515, followed by electrophoresis. Use porcine primary fibroblasts as wild-type controls (WT).

[0260] 7. After completing step 6, recover the PCR amplification products and sequence them.

[0261] If a single-cell clone has only one sequencing result, its genotype is wild-type (also known as homozygous wild-type). If a single-cell clone has two sequencing results, one consistent with the sequencing result of a primary porcine fibroblast and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the genotype of that single-cell clone is heterozygous. If a single-cell clone has two sequencing results, both showing mutations (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is biallelic mutant. If a single-cell clone has only one sequencing result and shows a mutation (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is biallelic mutant. If a single-cell clone has only one sequencing result and is consistent with the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is wild-type (also known as homozygous wild-type).

[0262] The results are shown in Table 1. The genotype of single-cell clone numbered 23 was wild-type. The genotypes of single-cell clones numbered 3, 5, 8, 10, 11, 14, 16, 17, 25, and 27 were heterozygous. The genotypes of single-cell clones numbered 4, 6, 12, 13, 18, 26, 28, and 30 were biallelic mutants. The genotypes of single-cell clones numbered 1, 2, 7, 9, 15, 19, 20, 21, 22, 24, and 29 were biallelic mutants. The success rate of obtaining ATM gene-editing single-cell clones was 96.7%.

[0263] Example sequencing alignment results can be found in Figure 7 to Figure 10 . Figure 7 The result is the alignment of the forward sequencing of single-cell clone number 23 with the wild-type sequence, and it is determined to be wild-type. Figure 8 The result is the alignment of the forward sequencing of single-cell clone number 8 with the wild-type sequence, which indicates that it is heterozygous. Figure 9 The results are the forward sequencing and wild-type sequence alignment of single-cell clone number 6, showing different biallelic mutants. Figure 10 The results are from the forward sequencing of single-cell clone number 7 and the comparison of the wild-type sequence, showing that it is a biallelic mutant.

[0264] Table 1. Genotyping results of ATM gene-edited single-cell clones

[0265]

[0266]

[0267]

[0268] The aforementioned heterozygous, biale-identical mutant, and biale-different mutant single-cell clones are all target single-cell clones. Using these cells as nuclear transfer donor cells for somatic cell cloning yields cloned pigs, which are the ataxia-telangiectasia model pigs.

[0269] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A kit comprising ATM-gRNA1, ATM-gRNA4 and NCN protein; The ATM-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16; the ATM-gRNA4 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17; the NCN protein is shown as in SEQ ID NO: 3; The ratio of ATM-gRNA1, ATM-gRNA4 and NCN protein is as follows: 1 μg ATM-gRNA1 : 1 μg ATM-gRNA4 : 4 μg NCN protein; The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected; (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare ataxia-telangiectasia model pigs; (c) to prepare ataxia-telangiectasia cell model, ataxia-telangiectasia tissue model, or ataxia-telangiectasia organ model.

2. Application of ATM-gRNA1, ATM-gRNA4, and NCN proteins in the preparation of the kit; ATM-gRNA1 is the ATM-gRNA1 described in claim 1; ATM-gRNA4 is the ATM-gRNA4 described in claim 1; The NCN protein is the NCN protein as described in claim 1; The ratio of ATM-gRNA1, ATM-gRNA4 and NCN protein is as follows: 1 μg ATM-gRNA1 : 1 μg ATM-gRNA4 : 4 μg NCN protein; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare ataxia-telangiectasia model pigs; (c) to prepare ataxia-telangiectasia cell model, ataxia-telangiectasia tissue model, or ataxia-telangiectasia organ model.

3. A method for preparing recombinant porcine cells, comprising the following steps: co-transfecting porcine cells with ATM-gRNA1, ATM-gRNA4 and NCN protein to obtain recombinant porcine cells; ATM-gRNA1 is the ATM-gRNA1 described in claim 1; ATM-gRNA4 is the ATM-gRNA4 described in claim 1; NCN protein is the NCN protein described in claim 1; the ratio of ATM-gRNA1, ATM-gRNA4 and NCN protein is as follows: 1 μg ATM-gRNA1 : 1 μg ATM-gRNA4 : 4 μg NCN protein.

Images