Non-coding sRNA for regulating gene expression and use thereof

Abstract

The application discloses a non-coding sRNA for regulating gene expression and application thereof, and belongs to the technical field of biology. The application firstly finds that the non-coding sRNA formed by the combination of any one of the transcription terminator (or endogenous terminator) independent of the rho factor and a specific mRNA complementary pairing region of a target gene can play a gene regulation function. The discovery is taken as a basic and universal principle to design the non-coding sRNA, so that the purpose of specifically regulating the expression of any gene can be achieved. Taking the gfp, ftsZ gene and the synthesis bypass pathway of the ergothioneine synthesis substrate as examples, it is verified that the non-coding sRNA designed under the design principle can effectively regulate the expression of the gfp and ftsZ, or improve the ergothioneine yield. The method of the application can provide more effective and convenient regulation technology for the gene regulation of prokaryotes, and can realize the rapid regulation of any gene.

Description

Technical Field

[0001] This invention relates to a non-coding sRNA that regulates gene expression and its applications, belonging to the field of biotechnology. Background Technology

[0002] Gene expression regulation is the control node in the process of transforming genetic information into life phenotypes, and it is also a necessary condition for the orderly operation of all life activities. Purposeful artificial gene regulation to control or improve life processes is a fundamental operational strategy in the fields of biotechnology and synthetic biology. The direct results of gene expression regulation can be categorized as the activation, enhancement, weakening, or shutdown of regulated gene expression. The specific regulatory process of gene expression involves various stages at the genomic, transcriptional, translational, and post-translational levels. Gene expression regulation has corresponding regulatory tools at each stage. One of the important tools for gene regulation in prokaryotes is non-coding sRNA.

[0003] Non-coding sRNAs (sRNAs) typically contain 50 to 500 nucleotides and are a type of RNA that does not encode proteins. They mainly consist of two functional regions: the first is the target mRNA pairing region, which is responsible for forming the double-stranded structure between the sRNA and the target gene mRNA, promoting or inhibiting the degradation of the double-stranded RNA region by RNases; or covering or exposing the necessary translation initiation site in the target mRNA, thereby inhibiting or promoting translation initiation. The second functional element is the neck loop structure region within the sRNA, composed of two or more neck loops of varying sizes. The neck loop region is generally located downstream of or to the sides of the target mRNA pairing region of the non-coding sRNA, mainly serving to stabilize the non-coding sRNA. In addition, the neck loop structure can also provide binding sites for Hfq or other RNA chaperones, thereby assisting in the binding process between the sRNA and the target mRNA. However, all naturally evolved sRNAs can only target the mRNA of one or a few specific genes and cannot be directly used to regulate other arbitrary target genes. By modifying the pairing regions of natural non-coding sRNAs, non-coding sRNAs can bind to the mRNAs of any gene, thereby enabling experimental artificial regulation of any gene through sRNAs.

[0004] Currently, artificially designed or modified non-coding RNAs (sRNAs) primarily regulate genes at the translational level. The main modification methods involve replacing the natural target pairing region of a non-coding sRNA with the reverse complementary sequence of any other gene's mRNA to regulate any target gene; or constructing a randomized non-coding sRNA library and screening mutant libraries to find non-coding sRNAs that can regulate target genes. Non-coding sRNAs generated in this way still retain some characteristics of the original sRNA, such as relatively long sRNA sequences, complex secondary structures, the presence of unknown functional regions, and dependence on RNA chaperones like Hfq. To expand the regulatory scope of sRNAs and increase their versatility, it is essential to redesign and modify the entire non-coding sRNA. Summary of the Invention

[0005] This invention constructs sRNA by linking a non-p-factor-dependent terminator to a sequence complementary to the CDS region of a target gene. The non-coding sRNA designed in this invention achieves significant simplification in both structure and length.

[0006] The first objective of this invention is to provide an sRNA comprising a first region and a second region; the first region being 24–32 nt in length, which forms a strictly inverse complementary relationship with the start codon of the target mRNA and a downstream region of 24–32 nt; the start codon being ATG or GTG; and the second region being a transcription terminator structure independent of the p factor.

[0007] In one embodiment, the p-independent transcription terminator structure is a stem-loop structure.

[0008] A second objective of the present invention is to provide a vector containing the sRNA.

[0009] In one embodiment, the carrier is ptarget-F.

[0010] A third object of the present invention is to provide cells containing the sRNA, or cells containing the vector.

[0011] A fourth objective of this invention is to provide the application of the sRNA in suppressing the expression of a target gene.

[0012] In one implementation, the application includes the following steps:

[0013] (1) Design an sRNA for regulating the target gene; the first region of the sRNA forms a strict reverse complement to the start codon and downstream region of the target gene's mRNA, totaling 24-32 nt;

[0014] (2) Express the sRNA designed in step (1) in microbial cells carrying the target gene.

[0015] In one embodiment, the microorganisms include, but are not limited to, Escherichia coli.

[0016] In one embodiment, the Escherichia coli includes, but is not limited to: E. coli BL21 (DE3), E. coli Rosetta (DE3), or E. coli JM109 (DE3).

[0017] In one embodiment, the application involves increasing ergothioneine production by inhibiting genes related to ergothioneine synthesis via the sRNA.

[0018] In one embodiment, the application involves linking the sRNA to a vector and transforming it into cells carrying the target gene.

[0019] In one embodiment, the carrier is ptarget-F.

[0020] In one embodiment, the sRNA contains any of the nucleotide sequences described in SEQ ID NO. 2 to 15.

[0021] In one embodiment, the application is to use any of the sRNAs shown in SEQ ID NO.2 to 15 to inhibit the expression of at least one gene among Escherichia coli dapA, moaA, speD, speE, pyrE, pyrD, pyrF, purD, purF, gadB, gshB, pssA, cysM, and cysQ.

[0022] Beneficial Effects: This invention is the first to discover that any transcription terminator independent of the p-factor can be used to construct non-coding sRNAs. The sRNA structures designed using the method of this invention are simpler and more diverse, making the construction of their expression vectors much simpler. Taking the GFP and FTSZ genes and the synthetic bypass pathway for ergothioneine substrates as examples, this invention demonstrates that non-coding sRNAs can be artificially designed using the design principles of this invention, effectively regulating the expression of GFP or FTSZ, or increasing ergothioneine production. The method of this invention will provide a more effective and convenient regulatory technology for gene regulation in prokaryotes, enabling rapid regulation of any gene. Attached Figure Description

[0023] Figure 1 : Diagrams of artificially designed non-coding sRNA structures and expression plasmids.

[0024] Figure 2 A schematic diagram illustrating the principle of artificially designed non-coding sRNA regulating gene expression.

[0025] Figure 3 Artificially designed non-coding sRNAs regulate the expression of the gfp gene.

[0026] Figure 4 Artificially designed non-coding sRNAs regulate the expression of the ftsZ gene.

[0027] Figure 5 The inhibitory efficiency was determined by altering the length of the paired regions of artificially designed non-coding sRNAs.

[0028] Figure 6 Artificially designed non-coding sRNA strategies enhance ergothionein production. Detailed Implementation

[0029] Strains: *E. coli* BL21(DE3), *E. coli* JM109; Culture medium: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride (NaCl) 10 g / L. Inducer: Isopropyl β-D-Thiogalactoside (IPTG) 0.1 mM. Antibiotics: Spectinomycin (50 μg / ml), kanamycin (50 μg / ml). Incubation temperature: 37℃. Fluorescence microscope and fluorescent 96-well plate reader.

[0030] Table 1 Primers used for constructing recombinant plasmids ptarget-sRNA and pcola-gfp

[0031]

[0032] Example 1: Design and expression of sRNA; Construction of the sRNA recombinant plasmid ptarget-sRNA

[0033] Figure 1 The non-coding sRNA designed for this invention is divided into three regions, where the first region is the target gene pairing region, and the second region is any transcription terminator (or neck loop structure, hairpin structure) independent of the ρ factor.

[0034] The working principle of this sRNA is that the non-coding sRNA binds to the mRNA of the target gene with high specificity through the complementary pairing region of the target mRNA, thereby inhibiting the translation of the target mRNA by the ribosome and specifically regulating the expression of the target gene.

[0035] A recombinant plasmid, ptarget-sRNA-anti-gfp, was constructed to regulate the expression of the exogenous gene gfp using a non-coding sRNA. The coding sequence of the sRNA regulating gfp gene expression was designed as: GAAAAGTTCTTCTCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT. Using anti-gfp-F and anti-gfp-R as primers and ptarget-F plasmid as a template, PCR was performed. The obtained PCR fragment was recovered by adsorption column and directly heat-shocked (42℃, 90 seconds) into competent E. coli JM109 cells.

[0036] A recombinant plasmid, ptarget-sRNA-anti-ftsZ, was constructed to regulate the expression of the endogenous gene ftsZ. The coding sequence of the sRNA regulating ftsZ gene expression was designed as: GGTAAGTTCCATTGGTTCAAACATGGGCGCGTCAGCGCGCCCTTTTTTTTT. PCR was performed using anti-ftsZ-F and anti-ftsZ-R primers and the ptarget-sRNA-anti-gfp plasmid as a template. The obtained PCR fragment was recovered by adsorption column and directly heat-shocked (42℃, 90 seconds) into competent E. coli JM109 cells.

[0037] A recombinant plasmid, ptarget-sRNA-anti-nowhere (this plasmid is a blank control), was constructed to regulate the expression of non-coding sRNAs that do not bind to any specific region. Using anti-nowhere-F and anti-nowhere-R as primers, PCR was performed with the ptarget-sRNA-anti-gfp plasmid as a template. The obtained PCR fragment was recovered via an adsorption column and directly heat-shocked (42℃, 90 seconds) into competent *E. coli* JM109 cells. The sequence accuracy of the plasmid was confirmed using Sanger sequencing.

[0038] Example 2: Construction of the recombinant plasmid pcola-gfp expressing the exogenous target gene gfp

[0039] Using gfp-F and gfp-R primers and pUC19-gfp as a template, the gfp gene was amplified. The gfp gene (shown in SEQ ID NO.1) and the pCOLADuet-1 plasmid linearized with BglII and XhoI were then assembled using Gibson assembly. Subsequently, the plasmid was heat-shock transformed (42℃, 90 seconds) into competent E. coli JM109 cells. The sequence accuracy of the constructed pCOLA-gfp plasmid was confirmed by Sanger sequencing.

[0040] Example 3: Non-coding sRNA regulates GFP expression

[0041] The ptarget-sRNA-anti-gfp dual plasmids constructed in Example 1 and pcola-gfp constructed in Example 2, as well as the ptarget-sRNA-anti-nowhere dual plasmids constructed in Example 1 and pcola-gfp constructed in Example 2, were heat-shock transformed into *E. coli* BL21(DE3). Two strains, *E. coli* BL21(DE3)anti-gfp and *E. coli* BL21(DE3)anti-nowhere, were obtained, respectively. Both strains were inoculated into LB medium containing 0.1 mM IPTG and cultured in shake flasks at 37°C for 12 h, with OD values ​​recorded at time intervals. 600 And fluorescence density, the results are as follows Figure 3 As shown, after 9 hours of cultivation, the fluorescence intensity of the recombinant anti-GFP strain decreased by 87% compared to the control strain. The GFP fluorescence intensity measurement conditions were: excitation wavelength 475 nm, emission wavelength 510 nm, and signal analog gain 50.

[0042] Example 4: Non-coding sRNA regulates ftsZ expression

[0043] ftsZ is a protein in E. coli associated with the initiation of cell division. When knocked out or severely inhibited, the bacterial cell division process exhibits significant defects, resulting in a significantly elongated cell morphology. Following the method described in Example 1, plasmids ptarget-sRNA-anti-ftsZ carrying sRNA targeting the ftsZ gene and ptarget-sRNA-anti-nowhere constructed in Example 1 were heat-transformed into E. coli BL21(DE3). Two recombinant E. coli strains, E. coli BL21(DE3)antiftsZ and E. coli BL21(DE3)antinowhere-sRNA, were obtained. After plating, they were incubated on LB agar plates at 37°C for 36 h. The differences in cell length between E. coli BL21(DE3)antigfp and E. coli BL21(DE3)antinowhere-sRNA were then observed under a microscope.

[0044] The results are as follows Figure 4 As shown, sRNA targeting the ftsZ gene affects cell morphology, making cells elongated. This demonstrates that non-coding sRNA can inhibit the expression of the ftsZ gene.

[0045] Example 5: Non-coding sRNA regulates ergothionein production

[0046] Following the same strategy as in Examples 1-3, sRNAs and recombinant genetically engineered bacteria that regulate the expression of genes dapA, moaA, speD, speE, pyrE, pyrD, pyrF, purD, purF, gadB, gshB, pssA, cysM, and cysQ on the Escherichia coli genome were constructed, wherein the sequences encoding the sRNAs are as shown in SEQ ID NO. 2-15, respectively.

[0047] sRNA regulating dapA gene expression (SEQ ID NO.2):

[0048] CGCGACAATACTTCCCGTGAACATGGGGCCCGACCGGGCCCCTTTTTTTTT;

[0049] sRNA regulating moaA gene expression (SEQ ID NO.3):

[0050] TGCATCAGTCAGTTGTGAAGCCATGTGGCGGAGTCCCGCCACTTTTTTTTT;

[0051] sRNA regulating speD gene expression (SEQ ID NO.4):

[0052] TTGAAAAAAACTGAAACTGCATGGCACGGTGGGATACCACCGTTTTTTTTTTT;

[0053] sRNA regulating speE gene expression (SEQ ID NO.5):

[0054] ATGCCACTGTTTTTTTTCGGCCATAGCCTGGGGCTCCAGGCTTTTTTTTTT;

[0055] sRNA regulating pyrE gene expression (SEQ ID NO.6):

[0056] GGCGATACCGACAATACCGCACATGCGGTTGAAATCAACCGCTTTTTTTTTT;

[0057] sRNA regulating pyrD gene expression (SEQ ID NO.7):

[0058] ATCCGTTACTTGCTTCTTTATCCATGGCCTCCTCCGGGAGGCCTTTTTTTTTT;

[0059] sRNA regulating pyrF gene expression (SEQ ID NO.8):

[0060] CATCACGATGCCGAGCTTGATCATACGGACCGTCCGGTCCGTTTTTTTTTT;

[0061] sRNA regulating purD gene expression (SEQ ID NO.9):

[0062] ATTACGCTTAAATTTTGACAACATGAGGCGGGCAACCGCCTCTTTTTTTTT;

[0063] sRNA regulating purF gene expression (SEQ ID NO.10):

[0064] TATTGTTTGTTCTAATGTACTCACTCCCACCGTTTGGTGGGATTTTTTTT;

[0065] sRNA regulating gadB gene expression (SEQ ID NO.11):

[0066] AAGCTGGCATACTTGATCTAACATTCGGAGGGTTACCTCCGATTTTTTTTTT;

[0067] sRNA regulating gshB gene expression (SEQ ID NO.12):

[0068] CATCACGATGCCGAGCTTGATCATACGGACCGTCCGGTCCGTTTTTTTTTT;

[0069] sRNA regulating pssA gene expression (SEQ ID No. 13):

[0070] ATTACGCTTAAATTTTGACAACATGAGGCGGGCAACCGCCTCTTTTTTTTT;

[0071] sRNA regulating cysM gene expression (SEQ ID No. 14):

[0072] TATTGTTTGTTCTAATGTACTCACTCCCACCGTTTGGTGGGATTTTTTTT;

[0073] sRNA regulating cysQ gene expression (SEQ ID No. 15):

[0074] AAGCTGGCATACTTGATCTAACATTCGGAGGGTTACCTCCGATTTTTTTTTT.

[0075] The constructed regulatory plasmid containing sRNA was transformed into ergothioneine-producing strain E1 (disclosed in the paper "Construction and Optimization of Ergothioneine-Producing Escherichia coli Engineered Strains"). The resulting recombinant cells were inoculated into an inorganic salt medium (20 g / L glucose, 16 g / L (NH4)2SO4, 16 g / L Na2HPO4·12H2O, 3 g / L KH2PO4, 2 g / L yeast extract, 5 mmol / L MgSO4, 0.1 mmol / L CaCl2, pH 6.8–7.0), and the OD after inoculation was controlled. 600 The concentration was 0.1, and the mixture was incubated at 30°C for 72 hours. The results are as follows... Figure 6 As shown, when moaA or purD were inhibited, ergothioneine production increased by 40% and 64%, respectively.

[0076] Comparative Example: Quantitative Regulation of Gene Repression Rate by Complementary Pairing Region Length of Different Target Genes

[0077] Recombinant genetically engineered bacteria containing sRNAs regulating GFP gene expression were constructed, with complementary pairing regions of 8 nt, 12 nt, 16 nt, 20 nt, 24 nt, 28 nt, and 32 nt, respectively. The corresponding sRNA sequences are as follows:

[0078] 8nt:TTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0079] 12nt:TCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0080] 16nt: CTTCTCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0081] 20nt:AGTTCTTCTCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0082] 24nt:GAAAAGTTCTTCTCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0083] 28nt: CAGTGAAAAGTTCTTCTCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0084] 32nt: ACTCCAGTGAAAAGTTCTTCTCCCTTACCCATGGCCACTCACGAGTGGCCTTTTTTTTT;

[0085] A recombinant plasmid expressing sRNA was constructed using the same strategy as in Example 1, and co-transformed with the recombinant plasmid pcola-gfp constructed in Example 2 into E. coli BL21(DE3). The fluorescence intensity of GFP was detected using the same method as in Example 3. The results showed that ( Figure 5 8–16 nt sRNA has no significant inhibitory effect on GFP; 20 nt or more can reduce GFP fluorescence intensity by more than 83%, 24 nt or more can reduce GFP fluorescence intensity by more than 87%, and the inhibition effect of 32 nt sRNA can reach 89.8%.

[0086] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An sRNA, characterized in that, The sRNA includes a first region and a second region; the first region is 24-32 nt in length, and the nucleotide sequence of this region is strictly inversely complementary to the nucleotide sequence of the start codon of the target mRNA and its downstream 24-32 nt region; the start codon is ATG or GTG; the second region is a transcription terminator structure independent of the p factor; the nucleotide sequence encoding the sRNA is shown in any of SEQ ID NO. 2-15.

2. A vector containing the sRNA of claim 1.

3. A cell containing the sRNA of claim 1, or containing the vector of claim 2.

4. Use of the sRNA of claim 1 for inhibiting expression of a gene of interest, characterized in that, The application is to use sRNA shown in SEQ ID NO. 2~15 to inhibit expression of the following genes of E. coli respectively dapA , moaA , speD , speE , pyrE , pyrD、 pyrF , purD, purF, gadB , gshB , pssA , cysM or cysQ .

5. Use according to claim 4, characterized in that, The sRNA shown in any of SEQ ID NO.2~15 was ligated with ptarget-F and transformed into E. coli cells.

6. A method of inhibiting expression of a gene of interest, comprising contacting the gene of interest with a compound of claim 1. The gene of interest is the dapA 、 moaA 、 speD 、 speE 、 pyrE 、 pyrD, pyrF 、 purD, purF, gadB 、 gshB 、 pssA 、 cysM or cysQ gene of E. coli; the method steps are as follows: (1) Design an sRNA for regulating the target gene; the first region of the sRNA forms strict reverse complementarity with the start codon of the mRNA of the target gene and its downstream region of 24-32 nt; the nucleotide sequence encoding the sRNA is shown in any of SEQ ID NO.2-15; (2) Express the sRNA designed in step (1) in microbial cells carrying the target gene.

7. The method of claim 6, wherein, Step (2) involves linking the sRNA to a vector and transforming it into cells carrying the target gene; the vector is pTarget-F.

Images