A method for knocking out the Y chromosome in pig cells based on the CRISPR / Cas9 system

Abstract

The present invention relates to a method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system, belonging to the field of biotechnology, and the method mainly includes: (1) finding a specific targeted repetitive sequence located on the Y chromosome according to bioinformatics and designing a corresponding gRNA; (2) preparing a CRISPR / Cas9 vector; (3) electrotransferring the constructed vector into boar fetal fibroblasts, and verifying the decrease in the expression level of the target gene at the cellular level by q-PCR; (4) selecting a gRNA with higher efficiency for electrotransfer, performing flow sorting and dilution to obtain a monoclone, and performing PCR and karyotype analysis on the monoclone for verification. The present invention searches for a repetitive sequence that can be recognized by a specific sgRNA in a specific chromosome of a pig, provides a new tool for the study of a specific chromosome and the function of the gene it carries, and also provides a new technical solution for achieving sex control of large livestock.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for knocking out pig cell Y chromosomes based on the CRISPR / Cas9 system. Background Art

[0002] As the carrier of biological genetic material, chromosomes are particularly important for the current research on life inheritance. As a product of the continuous maturity and development of gene editing technology in recent years, chromosome elimination technology has important application value in the construction of animal models, sex control in livestock breeding and improvement, functional research of specific chromosomes, and treatment of human aneuploidy diseases. At present, this technology has successfully eliminated specific chromosomes in species such as humans, mice, and zebrafish. However, the low targeting efficiency, additional inactivation of non-target sites, and the cumbersome operation process have greatly restricted the development of this technology. However, with the emergence of the new generation of CRISPR / Cas9 technology, flexible target selection, high editing efficiency, and the possibility of multiple cuts on the target have made the popularization of this technology possible.

[0003] At present, researchers have achieved the knockout of target chromosomes through zinc finger nuclease (ZFN) technology, Cre / loxP system, TKNEO gene knock-in and other methods, but these methods have high thresholds, which greatly limit the application of this technology in production and scientific research. For example, due to the long zinc finger protein recognition sequence in ZFN, there is potential toxicity; the Cre / loxP system introduces specific expression elements and its own potential toxicity to cells, making it difficult to really play a role; the cumbersome two-step operation of drug screening after TKNEO target chromosome knock-in, all of which will affect the cutting efficiency of the target gene, greatly restricting the development of this technology. Summary of the invention

[0004] In view of the above problems, the purpose of the present invention is to provide a method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system. Through CRISPR / Cas9 technology, repetitive sequences that can be recognized by specific sgRNA are found in specific chromosomes of pigs, and multi-site cutting is performed to achieve degradation of the target chromosome. It provides a new tool for the study of specific chromosomes and the functions of the genes they carry, and also provides a new technical solution for achieving sex control of large livestock.

[0005] The specific scheme adopted by the present invention is:

[0006] A first aspect of the present invention is to provide an sgRNA for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system, wherein the sgRNA target sequence is AAGAAGCGCTCTAGAACAGG (as shown in SEQ ID NO: 01), and the sgRNA sequence is CACCGAAGAAGCGCTCTAGAACAGG (as shown in SEQ ID NO: 02).

[0007] Preferably, the pig cells are porcine fetal fibroblasts.

[0008] The second aspect of the present invention is to provide the application of the above-mentioned sgRNA in eliminating the Y chromosome of pig cells.

[0009] The third aspect of the present invention is to provide a method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system, comprising the following steps:

[0010] Step 1: Find the specific targeting repetitive sequence on chromosome Y based on bioinformatics and design sgRNA. The sgRNA target sequence is AAGAAGCGCTCTAGAACAGG.

[0011] The sgRNA sequence is CACCGAAGAAGCGCTCTAGAACAGG.

[0012] Step 2: Prepare CRISPR / Cas9 vector: The synthesized sgRNA is annealed to form a double strand, connected and transformed with the linearized px330_Cas9_GFP plasmid, and a single clone is picked;

[0013] Step 3: Electroporate the vector constructed in step 2 into boar fetal fibroblasts, and obtain positive target monoclones after verification.

[0014] Preferably, the CRISPR / Cas9 vector described in step 2 is prepared using the vector HP180_px330_GFP.

[0015] Beneficial effects: The present invention provides a pig chromosome elimination technology based on CRISPR / Cas9, which searches for repetitive sequences that can be recognized by specific sgRNA and performs multi-site cutting to achieve degradation of the target chromosome. The targeting efficiency is high and the off-target rate is low, which provides a new tool for the study of specific chromosomes and the functions of the genes they carry, and also provides a new technical solution for achieving sex control of large livestock. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the comparison results between the target gene and the entire chromosome set;

[0017] Figure 2 This is the structure diagram of the HP180_px330_GFP vector;

[0018] Figure 3 This is the sequencing result diagram of pU6-Cas9-gRNA-GFP plasmid;

[0019] Figure 4 This is the target gene quantitative result diagram;

[0020] Figure 5 This is the flow sorting result diagram;

[0021] Figure 6 This is the result diagram of PCR identification of single clones;

[0022] Figure 7 This is the result of karyotype analysis;

[0023] Figure 8 It is a technical flow chart of the method described in this application. DETAILED DESCRIPTION

[0024] A method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system, characterized by comprising the following steps:

[0025] (1) Using bioinformatics, we identified specific targeting repetitive sequences on chromosome Y and designed corresponding gRNAs based on these sequences;

[0026] (2) Prepare CRISPR / Cas9 vector, anneal the synthesized sgRNA to form a double strand, connect and transform it with the linearized px330_Cas9_GFP plasmid, and pick a single clone;

[0027] (3) The constructed vector was electroporated into boar fetal fibroblasts, and the decreased expression level of the target gene at the cellular level was verified by q-PCR;

[0028] (4) Finally, select the gRNA with higher efficiency for electroporation, perform flow cytometry dilution to obtain single clones, and verify the single clones by PCR and karyotype analysis.

[0029] In step 1), all genes on the Y chromosome need to be downloaded from ensembl and extracted using the awk command.

[0030] In step 1), specific targeted repetitive sequences need to be obtained by comparing each gene on Y with the whole genome sequence.

[0031] In step 1), the target gene of gRNA needs to be stably present in each database and have a large number of copies.

[0032] In step 1), the target gene of gRNA needs to be a dispersed repetitive or clustered sequence.

[0033] In step 2), the CRISPR / Cas9 vector is HP180_px330_GFP, which is convenient for subsequent flow sorting.

[0034] In step 3), the same concentration of DNA is used as a template (target gene non-coding protein) to detect whether its relative content is reduced during quantitative detection.

[0035] In step 4), the object of karyotype analysis is the monoclonal cell cluster identified as positive by PCR.

[0036] The main purpose of the present invention is to provide a method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system, which includes using bioinformatics to find the specific repeat sequence of the Y chromosome, and designing the corresponding sgRNA for verification to select the appropriate target and finally select the target monoclonal. This process is scientifically advanced. Through the present invention, the shortcomings of the prior art are overcome, and a foundation for wide application in pig chromosome knockout is laid.

[0037] First, we found the specific targeting repetitive sequences on the Y chromosome based on bioinformatics, and designed the corresponding gRNA based on these sequences. The designed gRNA was verified by Cas9 cutting in vitro, and the gRNA with higher in vitro cutting efficiency was selected for knockout at the cellular level. Then, the CRISPR / Cas9 vector was prepared, the constructed vector was electroporated into boar fetal fibroblasts, and the decrease in the expression level of the target gene at the cellular level was verified by q-PCR. Finally, the gRNA with higher efficiency was selected for electroporation, and flow sorting and dilution were performed to obtain single clones, which were then verified by PCR and karyotype analysis.

[0038] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0039] The primers used in this example were designed using Primer6 software and synthesized by Beijing Liuhe BGI Technology Co., Ltd. The vector HP180_px330_GFP was provided by the National Engineering Technology Research Center for Swine Breeding. Unless otherwise specified, all reagents used were conventional reagents and methods used were conventional methods.

[0040] 1. Get the entire Y chromosome annotation file in ensembl, extract all genes in the annotation file using the awk command under Linux, and compare each gene with the whole genome sequence one by one on ensembl, and finally screen out the multi-copy genes that meet the conditions.

[0041] 2. Use the online website CCTop-CRISPR / Cas9 target online predictor (https: / / cctop.cos.uni-heidelberg.de / ) to design sgRNA for the selected target gene. The final sequence and site are

[0042] (The last five digits here represent the corresponding Gene_ID):

[0043] 43058_sg1(21558841-21558860):TCACTGGGGACTTGGACTTG,

[0044] 43058_sg2(21558795-21558814):ATGGAGGATTCTGAACCAGT,

[0045] 46447_sg1(22254580-22254599):GATGTGGCTGCAGAAACTCG,

[0046] 46447_sg2(22254625-22254644): AAGAAGCGCTCTAGAACAGG.

[0047] 3. Prepare CRISPR / Cas9 vectors, anneal the synthesized sgRNA to form double strands, connect and transform with linearized px330_Cas9_GFP plasmid, pick single clones, perform bacterial solution PCR and send for testing; extract plasmids from bacterial solution with correct sequencing and subsequently use for electroporation of fetal fibroblasts.

[0048] Among them, the comparison results of the target gene and the entire chromosome group are as follows Figure 1 As shown; HP180_px330_GFP vector structure as shown Figure 2 As shown; the sequencing results of pU6-Cas9-gRNA-GFP plasmid are shown Figure 3 As shown, the sequencing results were consistent with the designed gRNA results, indicating that the vector was successfully constructed.

[0049] 4. The constructed vector was electroporated into boar fetal fibroblasts, and the decreased expression level of the target gene at the cellular level was verified by q-PCR.

[0050] (1) Cell culture and transfection.

[0051] After the fetal fibroblasts were revived, 12% DMEM containing bovine serum was added and cultured in a 38°C, 5% CO2 incubator. When the confluence of the revived cells reached 80-90%, they were digested with 0.05% trypsin and then the cells were counted.6 Add each cell suspension to a 1.5 ml centrifuge tube, add 100 ul of electroporation solution and the target plasmid for electroporation. 24 hours after transfection, take pictures under a fluorescence microscope and observe the intensity of the fluorescence signal of the transfected cells to determine the transfection effect.

[0052] (2) q-PCR detection of Y chromosome knockout efficiency.

[0053] After electroporation of male fetal fibroblasts, the cell DNA was extracted until the confluence reached 80%-90%, and the corresponding target gene and SRY quantitative primers were designed to observe whether their expression levels were significantly reduced. The quantitative results of the target gene are as follows Figure 4 As shown in the figure, the q-PCR results showed that after the target gene knockout, the target genes 43058 and 46447 were significantly decreased by about 20% and 30% respectively (P<0.05), and the corresponding SRY also decreased by 7% and 11%; the knockout effect of 46447 was more significant than that of 43058. The reaction system and reaction products were carried out according to the instructions of the corresponding kit (PrimeScript TM RT reagent Kit withgDNA Eraser and PowerUp TM SYBR TM Green Master Mix). Specific primers are shown in the table below:

[0054]

[0055] 5. Further screen the most suitable sgRNA at the cell level for electroporation, and perform flow cytometry sorting for limiting dilution and culture for a period of time to pick single clones for PCR identification and karyotype analysis to identify the final single clone. Figure 5 As shown in the figure, by sorting EGFP positive cells by FACS, it was found that there was a significant difference in GFP signal between the control group and the experimental group, in which no GFP signal was detected in the control group, while the cell transfection efficiency of the positive control reached 71%. The results of PCR identification of monoclonal Figure 6 As shown, a small amount of DNA was extracted from the monoclonal cell clusters and the corresponding SRY detection was performed, and it was found that no SRY signal was detected in 1 / 3 of the cell clones (8 / 24).

[0056] The specific steps are as follows: After obtaining an appropriate amount of fluorescently labeled transfected cells by flow sorting, perform limiting dilution in a 10cm plate containing DMEMGlutaMix culture medium containing 15% FBS, with an average of 5-6 cell clusters per plate. After 10 days of culture (change the medium once in the middle), use a cloning ring to pick up the cell clusters and transfer them to a 48-well plate. After the cells have adhered to the wall and grown fully, transfer them to a 24-well plate and a 12-well plate in turn. At this time, select a small number of cells from each well for PCR identification. The primers used are SRY primers. Select some negative cells to T25 culture flasks and continue to culture until 70-80% for subsequent karyotype verification. The results are as follows Figure 7 As shown, among the 12 single-cell karyotypes identified, 1 had a complete lack of the Y chromosome.

[0057] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. Application of sgRNA for knocking out Y chromosome in pig cells based on CRISPR / Cas9 system in eliminating Y chromosome in pig cells, characterized by: The sgRNA target sequence is AAGAAGCGCTCTAGAACAGG, The sgRNA sequence was CACCGAAGAAGCGCTCTAGAACAGG; The pig cells are pig fetal fibroblasts.

2. A method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system, characterized in that: The following steps are involved: Step 1: Find the specific targeting repetitive sequence on chromosome Y based on bioinformatics and design sgRNA. The sgRNA target sequence is AAGAAGCGCTCTAGAACAGG. The sgRNA sequence was CACCGAAGAAGCGCTCTAGAACAGG; Step 2: Prepare CRISPR / Cas9 gene editing vector: The synthesized sgRNA is annealed to form a double strand, connected and transformed with the linearized px330_Cas9_GFP plasmid, and a single clone is picked; Step 3: Electroporate the vector constructed in step 2 into boar fetal fibroblasts, and obtain positive target monoclones after verification.

3. A method for knocking out the Y chromosome of pig cells based on the CRISPR / Cas9 system according to claim 2, characterized in that: The vector HP180_px330_GFP was used in the preparation of the CRISPR / Cas9 vector described in step 2.

Images