A method for coordinately improving tomato yield and fruit quality by using the G protein gene SlGGC1

Abstract

The present invention discloses a method for coordinately improving tomato yield and fruit quality by using the G protein gene SlGGC1, belonging to the field of biotechnology. The method specifically involves knocking out or silencing the SlGGC1 gene in tomatoes. The present invention uses the CRISPR / Cas9 gene editing technology to obtain tomato SlGGC1 gene-edited mutants, and finds that the mutants grow faster and have significantly increased yields compared to wild-type plants. Moreover, the vitamin C content in the fruits is increased, the carotenoid content is increased, and the quality of tomato fruits is improved. It can be used for the breeding of high-yield and high-quality tomato germplasms.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a method for synergistically improving the yield and fruit quality of tomatoes by using G protein genes SlGGC1 Background Art

[0002] The cultivated area of vegetables in the world has been showing an increasing trend since 2000, and the cultivated area of solanaceous and fruit vegetables accounts for nearly 20%. Tomato ( Solanum lycopersicum L.) is one of the main solanaceous and fruit vegetables and is widely cultivated worldwide. China is the country with the largest tomato cultivation area and the highest output in the world. With global climate change, extreme weather occurs frequently, and pests and diseases caused by adverse environments also occur from time to time. The cultivation of tomatoes is affected, resulting in a decrease in the yield of tomato plants and a deterioration in the fruit flavor; therefore, it is still very necessary to improve the yield of tomato plants.

[0003] With the improvement of living standards, people's demand for natural and healthy foods such as fruits and vegetables has changed from "quantity" to "quality". Tomatoes are low in calories, rich in vitamins, minerals and carotenoids, and have high nutritional value, and are deeply loved by consumers. Vitamin C is an essential vitamin for the human body and has important functions such as preventing scurvy, anti-arteriosclerosis, and maintaining dental health; in addition, vitamin C also has functions such as antioxidant, anti-aging and beauty care. The vitamin C content in tomatoes is relatively high, and about 10-25 mg of vitamin C is contained in every 100 g of unprocessed tomatoes. In addition to vitamins, carotenoids are also important active ingredients in tomatoes. Carotenoids are the general name of various natural pigments, mainly including lycopene, β-carotene and lutein, etc. Lycopene has the effects of preventing and assisting in anti-cancer, assisting in antioxidant, assisting in reducing blood lipid and blood pressure, and beauty care, and is called "the gold hidden in tomatoes". However, due to the emergence of extreme weather and the pursuit of tomato yield in the market, the quality of tomatoes sometimes declines. It is also crucial to improve the quality of tomatoes and increase the content of vitamin C and lycopene in tomato fruits.

[0004] ​Considering both the comprehensive yield and quality, finding effective and eco-friendly methods to effectively improve tomato yield and fruit quality is a research hotspot in current vegetable production and scientific research; breeding high-quality varieties that can increase yield and fruit quality is a good solution and has important practical production significance. G proteins are widely present in animals and plants. Compared with animal G proteins, the types of plant G protein subunits are relatively few, mainly divided into α subunits, β subunits, and γ subunits; in recent years, G proteins, as proteins that can improve the resistance of various crops to pathogens, have been widely studied (Jiao Wang et al., "Glucose sensing by regulator of G protein signaling 1 (RGS1) plays a crucial role in coordinating defense in response to environmental variation in tomato" New Phytologist, 2022, 236, 561-575), but there are few studies on yield and quality. SlGGC1 It belongs to the γ subunit of tomato G protein, and there is no report on its effect on tomato plant yield and fruit quality.

[0005] In recent years, the gene editing technology - CRISPR / Cas9 gene editing technology, which has received great attention from researchers, has developed rapidly. This technology can accurately and specifically identify target sites, obtain gene knockout materials, thereby precisely changing crop traits, quickly obtaining ideal germplasms, and the offspring can self-cross to screen lines in which the target gene is edited and does not contain Cas9, avoiding the transgenic technology that requires the introduction of foreign genes, providing an important way for studying the complex traits and functions of horticultural crops, and also having important significance for the genetic improvement and precision breeding of horticultural crops. Summary of the Invention

[0006] Based on the above problems in the prior art, the present invention provides a method for synergistically improving tomato yield and fruit quality using the G protein gene SlGGC1 to provide a basis for cultivating high-yield and high-quality tomatoes.

[0007] The specific technical solutions adopted are as follows:

[0008] The present invention provides SlGGC1 the application of the gene in improving tomato yield and / or improving tomato fruit quality, and the SlGGC1 nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.1, its protein coding region length is 630bp, and the full gene DNA sequence is shown in SEQ ID NO.6.

[0009] The present invention also provides SlGGC1 the application of the protein encoded by the gene in increasing the yield of tomatoes and / or improving the quality of tomato fruits, wherein SlGGC1 the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2. This SlGGC1 gene-encoded protein belongs to type C of the γ subunit in the G protein family and consists of 209 amino acids.

[0010] Specifically, improving the quality of tomato fruits includes increasing the vitamin C content and carotenoid content of tomato fruits.

[0011] Through the CRISPR P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), sequence analysis was performed on the SlGGC1 gene (gene number: XM_004243655.4, NCBI website https: / / www.ncbi.nlm.nih.gov / ), the PAM sequence was searched, the 20 bp before NGG was defined as sgRNA, and an sgRNA sequence located in the protein coding region of the gene and having high specificity was selected. The DNA sequence of the sgRNA specifically targeting the SlGGC1 protein coding region of the gene is shown in SEQ ID NO.3.

[0012] The present invention also provides a method for synergistically improving the yield and fruit quality of tomatoes by using the G protein gene SlGGC1 Specifically, it is to knockout or silence the negative regulatory factor SlGGC1 gene in tomatoes; the SlGGC1 nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.1.

[0013] Specifically, the method includes the following steps:

[0014] (1) Select a target fragment for gene knockout or silencing in the protein coding region of the SlGGC1 gene, design primers, and construct a CRISPR / Cas9 vector for knocking out or silencing the SlGGC1 gene;

[0015] (2) Construct an Agrobacterium genetic engineering bacterium containing the CRISPR / Cas9 vector described in step (1);

[0016] (3) Transform the cotyledons of tomatoes with the genetic engineering bacterium described in step (2), and culture to obtain a homozygous mutant line that does not contain foreign proteins and is stably inherited.

[0017] The target fragment for gene knockout is a target fragment containing a PAM structure. The nucleotide sequence of the first 20 bases before the PAM structure of the target fragment is shown in SEQ ID NO.3. The PAM structure is NGG, where N represents any base.

[0018] Furthermore, the nucleotide sequence of the upstream primer for constructing the CRISPR / Cas9 vector is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5.

[0019] Preferably, the Agrobacterium genetic engineering bacterium is Agrobacterium tumefaciens strain GV3101.

[0020] In the present invention, by measuring the plant height and stem diameter of tomato plants, and counting the single fruit weight, the number of fruits per plant and the yield per plant, it is found that Slggc1 The gene mutant plants grow faster and have a significantly increased yield compared to the wild-type plants.

[0021] Furthermore, by measuring the relevant quality indexes of the tomato fruits of the gene mutant plants, it is found that Slggc1 The content of vitamin C in the fruits of the gene mutant plants is increased, the content of carotenoids is increased, and the quality of tomato fruits is improved compared to the fruits of the wild-type plants.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention uses the CRISPR / Cas9 gene editing technology to obtain tomato SlGGC1 gene editing mutants, and it is found that the mutants can promote the growth of tomato plants, significantly improve the yield and fruit quality of tomato plants, and can be used for the breeding of high-yield and high-quality tomato germplasms. Description of the Drawings

[0024] Figure 1 It is the gene editing site map of the T1 generation mutant plants obtained in Example 2; among them, Slggc1 #1 lacks one base compared to the control without gene editing, Slggc1 #2 lacks 12 bases compared to the control without gene editing.

[0025] Figure 2 It is the plant height statistical chart and optical picture of the control and Slggc1 gene mutant tomatoes in Example 3. Among them, A is the plant height statistical chart, B is the optical picture, and a and b represent significant differences at the 5% level between different plants.

[0026] Figure 3 It is the control and Slggc1Statistical chart of stem diameter and optical pictures of gene - mutated tomatoes. Among them, A is the statistical chart of stem diameter, B is the optical picture, and a and b represent significant differences at the 5% level between different plants.

[0027] Figure 4 For the control and Slggc1 Statistical chart of the yield of gene - mutated tomatoes in Example 3. Among them, A is the single - fruit weight, B is the number of fruits per plant, and C is the yield per plant; a and b represent significant differences at the 5% level between different plants.

[0028] Figure 5 For the control and Slggc1 Determination results of vitamin C content in fruits of gene - mutated tomatoes in Example 4. a and b represent significant differences at the 5% level between different plants.

[0029] Figure 6 For the control and Slggc1 Determination results of lycopene content in fruits of gene - mutated tomatoes in Example 5. a and b represent significant differences at the 5% level. Detailed implementation mode

[0030] The present invention will be further clarified below in conjunction with the examples and the attached drawings. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0031] The tomato variety used in the following examples is the conventional wild - type tomato variety CR (Condine Red), and the ordinary tomato without gene editing is used as the control.

[0032] Find on the NCBI website https: / / www.ncbi.nlm.nih.gov / SlGGC1 the DNA sequence of (XM_004243655.4), whose sequence is shown in SEQ ID NO.6, and input it into http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR the website, and find a 20 - bp base sequence TGAGGTGGTGATTTTGGGCG (sgRNA, SEQ ID NO.3) before a PAM structure with a high onscore and a GC content > 40% and located in the protein - coding region.

[0033] Design CRISPR primers as follows:

[0034] CRISPR forward primer:

[0035] GATTGTGAGGTGGTGATTTTGGGCG (SEQ ID NO.4);

[0036] CRISPR reverse primer:

[0037] AAACCGCCCAAAATCACCACCTCAC (SEQ ID NO.5).

[0038] Take 5 μL each of the above-mentioned CRISPR forward primer and reverse primer, mix them evenly, and anneal them into double strands using a PCR instrument. The intermediate vector pMD18-T was Bbs digested with a single enzyme I, purified using a common DNA purification kit, and then the double strands were ligated to the vector using T4 ligase and ligated overnight at 16°C. Heat shock transformation was carried out at 42°C and plated, and the resistance was ampicillin.

[0039] Pick monoclonal colonies and perform PCR verification using the CRISPR forward primer (SEQ ID NO.4): GATTGTGAGGTGGTGATTTTGGGCG and the vector reverse primer (SEQ ID NO.7): CTACTTATCGTCATCGTCTTTG.

[0040] Send the bacterial liquid with the correct band size to the company for sequencing. The sequencing results showed that the vector contained the sgRNA sequence. Extract the plasmid, and after Hind digestion with III and Kpn I double digestion, it was ligated to the binary expression vector pCAMBIA1301. The re-sequencing results showed that the final vector contained sgRNA. The obtained final plasmid was electrotransformed into competent Agrobacterium tumefaciens GV3101. After culturing at 28°C for two days, pick plaques for PCR verification to obtain an Agrobacterium strain that can be used to construct its CRISPR / Cas9 gene editing material.

[0041] Example 2 Slggc1 Preparation and identification of gene mutant materials

[0042] Count an appropriate amount of tomato CR seeds, shake and seed them at 28°C for 6 - 8 h, disinfect them with 70% alcohol for 20 - 30 s, and shake and disinfect them with 10% sodium hypochlorite solution for 15 min, and then sow them on the sterilized 1 / 2MS sowing medium. After 3 days of dark treatment, place them under normal light, and after 7 days, cut the cotyledons onto the KC medium. Use the Agrobacterium infection method to transform the final plasmid prepared in Example 1 into the cotyledons, and utilize the totipotency of plant cells to obtain T0 generation gene-edited tomatoes.

[0043] Detection of T0 generation gene-edited tomato seedlings. Use the rapid extraction method to extract the genomic DNA of T0 generation plants and use it as a template. Design the following primers approximately 200 bp before and after the DNA sequence containing sgRNA for PCR amplification and sequencing verification:

[0044] Verification forward primer (SEQ ID NO.8): ATGGCAGGGGCTGGTTCAAT;

[0045] Verified primer (SEQ ID NO.9): GATATCCCAGCAAATCCTAAAT;

[0046] The obtained PCR products were sent to the company for sequencing. The sequencing results were compared with the original sequence of this gene segment using DNAMAN software. Plants with base deletions in the sgRNA sequence and showing a single peak in sequencing were selected for self-pollination and seed multiplication to obtain T0-generation seeds.

[0047] The above T0-generation seeds were planted in a plant factory to obtain T1-generation plants. The base editing of the sgRNA sequence in the T1-generation plants was detected using the same method as above. At the same time, the DNA of the T1-generation plants was PCR amplified using the CRISPR forward primer (SEQ ID NO.4) and the vector reverse primer (SEQ ID NO.7) to detect whether the Cas9 sequence was present. T1-generation plants with mutated sgRNA and no Cas9 protein were selected and identified as two lines of gene-edited plants, named Slggc1 #1 and Slggc1 #2 respectively, and their gene editing sites are as Figure 1 shown. Slggc1 #1 lacked 1 base compared with the control plants, Slggc1 #2 lacked 12 bases compared with the control plants. After self-pollination and seed multiplication of the T1-generation seeds of the above two lines, stable genetic T2-generation plants without the exogenous gene Cas9 and with mutated sgRNA were obtained.

[0048] The following examples were all carried out using the T2-generation plants of the above two homozygous lines as materials.

[0049] Example 3 Slggc1 Yield study of gene-edited mutants

[0050] Sow the control plants CR and the mutant plants Slggc1 #1 and Slggc1 #2 of the two lines, and cultivate them in the same and suitable environment. The environmental temperature was controlled at about 25 °C, the relative air humidity was about 75%, and the light intensity was about 400 μmol m -2 s -1 . Two weeks after the first batch of flowers bloomed, measure the plant height and stem diameter of the control plants and the mutant plants, and take pictures for record. The results are shown in A and B in Figure 2 and A and B in Figure 3 respectively, Slggc1 The mutants can significantly promote the growth of tomato plants, increasing plant height and stem diameter.

[0051] Another part of the control plants and the two lines of mutant plants were selected and planted in the greenhouse. After most of the tomato fruits turned color, the single fruit weight, the number of fruits per plant, and the yield per plant were counted and pictures were taken for record. The results are shown in Figure 4as shown in A-C in Slggc1 The mutant can significantly increase the yield of tomato plants and the fruit weight.

[0052] Example 4 Slggc1 Determination of vitamin C content in the mutant and control tomatoes

[0053] Record the control plants CR and the mutant plants Slggc1 Record the flowering date and the fruit breaker time. Take the pericarp samples at 8 days after breaker (Break+8). After grinding the samples, weigh 0.1 g of the samples for the determination of vitamin C content; add 1 mL of 5% metaphosphoric acid, centrifuge at 15000 g for 20 min, pipette 200 μL of the supernatant into a 2 mL conical bottom centrifuge tube, add 200 μL of 150 mM PBS solution and 200 μL of water respectively, vortex, and let stand at room temperature for 30 s; then add 400 μL of 10% TCA solution, 400 μL of 44% metaphosphoric acid solution, 400 μL of 2,2-bipyridine solution and 200 μL of 3% FeCl3 solution, vortex and then place in a 37°C incubator for 1 h. Pipette 200 μL of the mixed solution and measure the vitamin C content at a wavelength of 525 nm.

[0054] From Figure 5 it can be seen that Slggc1 The vitamin C content in the fruits of the two mutant plant lines is significantly higher than that in the fruits of the control plants, and the fruit quality of the mutant plants is improved.

[0055] Example 5 Slggc1 Determination of lycopene content in the mutant and control tomatoes

[0056] Record the control plants CR and the mutant plants Slggc1 Record the flowering date and the fruit breaker time. Take the pericarp samples at 8 days after breaker (Break+8). After grinding the samples, weigh 0.1 g of the samples for the determination of carotenoid content; add 350 μL of methanol, 700 μL of chloroform and 350 μL of ddH2O in sequence, vortex, centrifuge at 10000 rpm for 15 min, collect the chloroform phase into a new tube; add 700 μL of chloroform to the remaining liquid, vortex and then centrifuge; combine the two chloroform phases, blow dry with nitrogen; add 350 μL of methanol containing 6% KOH, vortex, derivatize at 60°C for 30 min; then add 700 μL of chloroform, vortex, centrifuge at 10000 rpm at 4°C for 10 min, collect the chloroform phase, add 700 μL of ddH2O to remove chlorophyll, vortex and centrifuge, dry the chloroform phase with N2, and store at -80°C; before sending for testing, re-dissolve with a 1:1 mixed solution of dimethyl sulfoxide and isopropanol, and perform high performance liquid chromatography analysis.

[0057] The results are asFigure 6 As shown Slggc1 The lycopene content in the fruits of two lines of mutant plants was significantly higher than that in the fruits of control plants, and the fruit quality of mutant plants was improved.

[0058] The above-described embodiments have described the technical solutions of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, supplements, or substitutions in a similar manner within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of knocking out or silencing SlGGC1 a gene in increasing tomato yield and / or improving tomato fruit quality, wherein SlGGC1 the nucleotide sequence of the protein coding region of the gene is as shown in SEQ ID NO.1; improving tomato fruit quality means increasing the vitamin C content and lycopene content of tomato fruits.

2. Reduction SlGGC1 Use of a protein encoded by a gene in increasing tomato yield and / or improving tomato fruit quality, wherein SlGGC1 the amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO.2; improving tomato fruit quality means increasing the vitamin C content and lycopene content of tomato fruits.

3. A method for coordinately improving tomato yield and fruit quality by using G protein genes SlGGC1 which is characterized in that Knock out or silence the SlGGC1 gene in tomato; the SlGGC1 nucleotide sequence of the protein-coding region of the gene is shown in SEQ ID NO.1; improving the quality of tomato fruits means increasing the vitamin C content and lycopene content of tomato fruits.

4. The method according to claim 3, characterized in that comprising the following steps: (1) Select a target fragment for gene knockout or silencing in the SlGGC1 gene protein coding region, design primers, and construct a CRISPR / Cas9 vector for knocking out or silencing the SlGGC1 gene; (2) constructing an Agrobacterium genetic engineering bacterium containing the CRISPR / Cas9 vector described in step (1); (3) transforming the cotyledons of tomatoes with the genetic engineering bacterium described in step (2), and culturing to obtain a homozygous mutant line that does not contain foreign proteins and is stably inherited.

5. The method according to claim 4, wherein The target fragment for gene knockout is a target fragment containing a PAM structure, and the nucleotide sequence of the first 20 bases before the PAM structure of the target fragment is shown in SEQ ID NO.

3.

6. The method according to claim 4, wherein The nucleotide sequence of the upstream primer for constructing the CRISPR / Cas9 vector is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

5.

7. The method according to claim 4, wherein The Agrobacterium genetic engineering bacterium is Agrobacterium tumefaciens strain GV3101.

Images