A method for preparing scoparone using a high-activity O-methyltransferase gene

Abstract

The present invention relates to an artificially designed high-activity O-methyltransferase gene, the nucleotide sequence of which is shown in SEQ ID NO.2. It can be used for heterologous expression of the O-methyltransferase gene, and further synthesizes scopolamine with scopoletin as a substrate. The preparation method is simple, efficient, safe and non-toxic, and can efficiently and greenly produce scopolamine on a large scale, expand the application range of scopolamine in medicine or pesticides, and improve its application value. The substrate can be simply added directly when the recombinant Escherichia coli expressing the gene is induced to express, for the production of scopolamine. It is also possible to use the purified enzyme protein, add S-adenosyl-L-methionine and scopolamine to synthesize scopolamine in vitro, and have a conversion rate of up to 92.6%.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biosynthesis and relates to a method for preparing scoparone using a high-activity O-methyltransferase gene. Background Art

[0002] Scoparone is a well-known coumarin compound, a natural biological resource from renewable plants. It was first isolated from the Chinese herbal medicine Artemisia capillaris Thunb. and has attracted the attention of many researchers as the main extract of Artemisia capillaris. Scoparone has a wide range of pharmacological effects, such as anti-tumor, liver protection and choleretic, anti-asthmatic, anti-allergic and anti-inflammatory effects. In addition, scoparone plays an increasingly important role in the agricultural field. A large number of studies have shown that scoparone has high selective toxicity to herbivorous mites, but is almost non-toxic to natural enemies, and also has insecticidal and fungicidal activities. In 2018, scoparone obtained the pesticide scientific name of "dimethoxyfenanthene" (Agricultural Standard No. 2018 No. 003, National Pesticide Standardization Technical Committee). These studies fully demonstrate that scoparone has the value and potential to be developed into a new generation of botanical pesticides.

[0003] At present, there are two main methods for obtaining artemisinin. The first is to directly extract it from the plant Artemisia capillaris. However, this method is limited by plant resources and the extraction process is complex, the yield is low, and the pollution is serious. The second is through chemical synthesis. DuH SB and Parihar used p-hydroxyphenol as a raw material, reacted with acetic anhydride to produce 1,2,4-benzenetriol triethyl ester, and then reacted with 2-hydroxybutyl ester to generate fraxin, which was then methylated to obtain artemisinin; Zhang Shufen et al. used benzoquinone to react with acetic anhydride to generate 1,2,4-benzenetriol triethyl ester, and then cyclized with malic acid to obtain fraxin, which was then methylated to obtain artemisinin. The existing methods for preparing artemisinin mainly use traditional preparation methods, which have the disadvantages of more production process steps, high toxicity and serious pollution. These factors seriously limit the efficient and green large-scale production of artemisinin and hinder its further development and utilization. Summary of the invention

[0004] In view of this, the object of the present invention is to provide an O-methyltransferase gene sequence, which can express highly active O-methyltransferase in host cells and can catalyze the production of scopoletin using scopoletin as a substrate.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] 1. A highly active O-methyltransferase gene, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0007] 2. A highly active O-methyltransferase, the amino acid sequence of which is shown in SEQ ID NO.3.

[0008] 3. A recombinant expression vector, consisting of an empty vector and a target gene inserted into the empty vector, wherein the target gene is an O-methyltransferase gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0009] 4. A recombinant bacterium, comprising the above-mentioned recombinant expression vector, or integrating the gene shown in SEQ ID NO.2 into its genome.

[0010] 5. Use of the above O-methyltransferase gene, the above O-methyltransferase, the above recombinant expression vector or the above recombinant bacteria in the preparation of artemisinin.

[0011] The above-mentioned O-methyltransferase gene, the above-mentioned recombinant expression vector or the above-mentioned recombinant bacteria can be prepared by bioengineering to obtain an O-methyltransferase protein, which has an amino acid sequence as shown in SEQ ID NO.3. The enzyme has an O-methyltransferase catalytic function and can catalyze the synthesis of scopoletin from scopoletin.

[0012] 6. A method for preparing a highly active O-methyltransferase is also provided, comprising the following steps:

[0013] 1) Construct the gene described in Technical Solution 1 into a vector; then transform it into a host strain to obtain a recombinant expression strain;

[0014] 2) The recombinant expression strain of step 1) is cultured in TB liquid culture medium and induced by adding IPTG. After fermentation is completed, a soluble recombinant O-methyltransferase protein is obtained.

[0015] 7. A method for preparing scopolamine using a highly active O-methyltransferase gene is also provided, the method comprising: using the above O-methyltransferase gene, the above recombinant expression vector or the above recombinant bacteria to prepare O-methyltransferase protein by bioengineering, and then using scopolamine as a substrate to catalyze the preparation of scopolamine.

[0016] Furthermore, the method for preparing scopolamine by using a highly active O-methyltransferase gene includes two specific methods, wherein the specific method 1 is: inoculating a recombinant bacterium having the gene shown in SEQ ID NO.2 into a TB liquid culture medium for culture, and adding IPTG for induction, after inducing expression for 4 hours, adding scopolamine to the culture medium in stages, culturing until the fermentation is completed, and the supernatant contains scopolamine after catalysis;

[0017] Alternatively, the specific method 2 is: inoculating the recombinant bacteria having the gene shown in SEQ ID NO.2 into TB liquid culture medium, adding IPTG for induction, and culturing until the fermentation is completed; taking the strain cell body and performing high-pressure homogenization and crushing, collecting the supernatant of the lysate after crushing, and obtaining the OMT-containing Syn Protein crude enzyme solution; OMT Syn Protein, S-adenosyl-L-methionine and scopoletin are reacted together at 30°C for more than 1 hour to obtain artemisinin.

[0018] 1 mg of 6'-O-methyltransferase and 500 μM of substrate scopoletin were added to the reaction system.

[0019] Furthermore, in the method for preparing scopolamine with a high-activity O-methyltransferase gene, the recombinant bacteria are inoculated in TB liquid culture medium and cultured at 35-40°C until OD600 is 0.6-0.8; after adding scopolamine, the culture temperature is 28-30°C.

[0020] Further, in the method for preparing artemisinin with a high-activity O-methyltransferase gene, in the specific method 2, OMT Syn OMT Syn Protein crude enzyme solution, or containing OMT Syn The crude protein enzyme solution was further purified to obtain OMT Syn protein.

[0021] Furthermore, in the method for preparing artemisinin using a highly active O-methyltransferase gene, the specific preparation method of the recombinant bacteria having the gene shown in SEQ ID NO.2 is as follows: using primers to amplify the gene shown in SEQ ID NO.2 and an empty vector plasmid respectively, recovering the target fragment using a DNA recovery kit, and integrating it at the EcoRI / NotI position of the empty vector plasmid by homologous recombination to obtain a recombinant plasmid; and then transforming the recombinant plasmid into a host strain to obtain a recombinant expression strain.

[0022] The primer sequence for amplifying the gene shown in SEQ ID NO.2 is:

[0023] P1: gatctggaagttctgttccaggggcccctgggatccccggatgaccaccaccgaactgat;

[0024] P2: accgaaacgcgcgaggcagatcgtcagtcagtcacgatgcttatttcagaaattccataatccaggtattgtgcg.

[0025] Preferably, the empty vector plasmid is pGEX-6p-1.

[0026] Preferably, the host strain is Escherichia coli BL21 (DE3).

[0027] The beneficial effects of the present invention are as follows: the present invention provides an artificially designed O-methyltransferase and an artificial gene sequence expressing the enzyme, which can be artificially expressed by gene recombination for highly active O-methyltransferase, and also provides a new use of the enzyme for catalyzing scopoletin to produce scopolamine, wherein the enzyme can catalyze scopoletin to add a methyl group at the 6' position to obtain scopolamine, and the preparation method is simple, efficient, safe and non-toxic, and can efficiently and greenly produce scopolamine on a large scale, thereby expanding the application range of scopolamine in medicine or pesticides and improving its application value. The substrate can be simply added directly when the recombinant Escherichia coli expressing the gene is induced to express, and the substrate can be used to produce scopolamine, and 300 mg / L of scopoletin can be catalyzed to generate 50.5 mg / L of scopolamine within 72 hours, and the molar conversion rate is 15.7%. The purified enzyme protein can also be used to add S-adenosyl-L-methionine and scopoletin to synthesize artemisinin in vitro, further proving that the artificial enzyme OMT Syn It has 6'-O-methyltransferase catalytic function and has a conversion rate as high as 92.6%. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0029] Figure 1 Scopolamine undergoes OMT Syn Schematic diagram of the catalytic production of artemisinin.

[0030] Figure 2 This is the electrophoresis diagram of PCR identification of pGEX-6p-1 / OMTsyn bacterial solution (lanes 1-6 and 8 are the results of recombinant bacterial testing, and lane 7 is the positive control).

[0031] Figure 3 This is the restriction enzyme digestion identification diagram of pGEX-6p-1 / OMTsyn.

[0032] Figure 4 is OMT in E. coli yGJ88 of Example 3 Syn HPLC detection results of fermentation broth with scopoletin as substrate.

[0033] Figure 5 This is a protein purification diagram of OMT translated and expressed by SEQ ID NO.1, wherein M is a reference, 1 is the original E. coli total protein, 2 is the induced E. coli supernatant protein with a recombinant expression vector, and 3 is the purified protein.

[0034] Figure 6 This is the restriction enzyme digestion identification diagram of pGEX-6p-1 / OMT.

[0035] Figure 7 This is the HPLC detection chart of metabolites of strain yGJ87.

[0036] Figure 8 For OMT Syn , wherein M is the reference, 1 is the original E. coli total protein, 2 is the induced E. coli total protein with the vector, 3 is the induced E. coli supernatant protein with the recombinant expression vector, and 4 is the purified protein.

[0037] Fig. 9 This is the HPLC detection chart of the enzymatic synthesis of artemisinin. DETAILED DESCRIPTION

[0038] The preferred embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. The experimental methods without specific conditions in the embodiments are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0039] Example 1

[0040] LB medium: 5 g / L yeast powder, 10 g / L peptone, 5 g / L sodium chloride. Add ampicillin to a final concentration of 50 μg / mL as needed.

[0041] TB medium: 24 g / L yeast powder, 12 g / L peptone, 4 mL / L glycerol.

[0042] Add 20 g / L agar powder to the solid culture medium.

[0043] Buffer A: 20 mM K2PO4, 20 mM KH2PO4, 50 mM NaCl, pH 7.4.

[0044] Buffer B: 20 ​​mM K2PO4, 20 mM KH2PO4, 50 mM NaCl, 500 mM GSH, pH 7.4.

[0045] PBS buffer: 160 mL of 20 mM NaH2PO4 was mixed with 840 mL of 20 mM Na2HPO4 (pH 7.5).

[0046] Detection method:

[0047] The sample was detected by Agilent HPLC, C18 reverse phase column (4.6mm×250mm), column temperature 25°C. The mobile phase was methanol (A): 0.1% formic acid water (B) = 40:60, flow rate 1mL / min, injection volume 10μL, detection wavelength 343nm. Scopolamine peaked at 7.9min, and scopolamine peaked at 11.6min.

[0048] Methyltransferase activity detection method: Take 400μL protein solution in a 1.5mL centrifuge tube, add 400μL PBS solution dissolved with 5mM S-adenosyl-L-methionine and 200uL PBS solution dissolved with 2.5mM scopoletin. Mix by blowing and place in a 30℃ water bath for 1h. Take 800μL reaction solution in a 5mL centrifuge tube, add 800μL ethyl acetate, mix thoroughly and centrifuge at 13400rpm for 5min, and take the supernatant for liquid phase detection.

[0049] Invention corresponding to OMT Syn The amino acid sequence is shown in SEQ ID NO. 3. Compared with the original amino acid sequence, the optimized sequence has two prominent changes (D271A / N325A).

[0050] Table 1 Genotypes of strains and plasmids

[0051]

[0052]

[0053] Example 1: Construction of recombinant plasmid

[0054] (1) Based on the characteristics of methyltransferase combined with computer-aided design and other technologies and according to the codon preference of Escherichia coli, the whole gene of OMT was synthesized after artificial design syn Gene, compared with the original amino acid sequence, the optimized sequence has two prominent changes (D271A / N325A). The original nucleotide sequence is shown in the sequence list SEQ ID NO.1, the artificially designed sequence is shown in the sequence list SEQ ID NO.2, and the corresponding amino acid sequence is shown in the sequence list SEQ ID NO.3.

[0055] SEQ ID NO.2 was amplified using primers P1 / P2, the target fragment was recovered using a DNA recovery kit, and then connected to the EcoRI / NotI position of the linearized expression vector pGEX-6p-1 by homologous recombination to obtain the recombinant plasmid pGEX-6p-1 / OMT syn .

[0056] Table 2 Base and amino acid sequences of all genes

[0057]

[0058]

[0059] Table 3 Primer sequences

[0060]

[0061]

[0062] Note: Lowercase letters represent homologous sequences, which are used for homologous recombination.

[0063] Example 2: Construction of recombinant Escherichia coli

[0064] The recombinant plasmid pGEX-6p-1 / OMT constructed in Example 1 was transformed into syn The recombinant E. coli was transformed into BL21 (DE3), and the transformation solution was spread on a LB solid culture medium plate containing 50 μg / mL. After overnight culture at 37°C, a single colony grew, which was the recombinant E. coli. The positive strain was obtained through bacterial inspection, enzyme digestion and sequencing verification, and the strain with correct sequencing was named yGJ88. Figure 2 pGEX-6p-1 / OMT syn Electrophoresis diagram of bacterial solution PCR identification (lanes 1-6 and 8 are the results of recombinant bacterial testing, and lane 7 is the positive control). Figure 3 pGEX-6p-1 / OMT syn Enzyme digestion identification diagram.

[0065] Example 3: Production of artemisinin by recombinant Escherichia coli yGJ88

[0066] The recombinant Escherichia coli yGJ88 constructed in Example 2 was subjected to fermentation verification, using scopoletin as a substrate to detect whether there was substrate consumption and new substance generation.

[0067] Fermentation conditions were as follows: Fermentation conditions in 250 mL shake flasks: Pick at least 10 single colonies and inoculate them in a 250 mL shake flask containing 20 mL of LB liquid medium. After culturing at 37°C and 220 rpm for 10-12 h, the starting OD 600The concentration of 0.01 was transferred to a 250mL shake flask containing 20mL of fresh TB liquid culture medium, and ampicillin with a final concentration of 50μg / mL was added to the culture medium. After culturing at 37°C and 220rpm for 3-4h, IPTG with a final concentration of 1mM was added to induce expression. At the same time, the temperature was lowered to 30°C. After 4h of induction expression, 75mg / L of substrate was added to the culture medium at 12, 24, 36 and 48h, respectively, for a total of 300mg / L. Fermentation was terminated after culturing at 30°C and 220rpm for 72h. 500μL of fermentation broth was placed in a 2mL centrifuge tube and an equal volume of methanol was added. After shaking and mixing, centrifuge at 13500rpm for 5min. The supernatant was taken and passed through a 0.22μm nylon membrane for use in liquid phase detection. The liquid phase results showed that OMT syn It has the ability to catalyze the synthesis of scopoletin from scopoletin. Figure 1 Scopolamine undergoes OMT Syn Schematic diagram of catalytic production of scopolamine. After 72 hours of fermentation, 300 mg / L of scopolamine can be catalyzed to obtain 50.5 mg / L of scopolamine. Figure 4 is OMT in E. coli yGJ88 of this example Syn HPLC detection results of fermentation broth with scopoletin as substrate.

[0068] Using the published transcriptome data, primers were designed, the target gene was amplified by RT-PCR and connected to the cloning vector. The amplified target gene native sequence is shown in SEQ ID NO.1 in the sequence table. The above methyltransferase gene sequence was double-digested with EcoRI and NotI, and connected to the pGEX-6p-1 expression vector that was also double-digested with EcoRI and NotI. The recombinant vector pGEX-6p-1 / OMT was transferred into BL21 (DE3) competent cells according to the bacterial transformation method, and the positive transformants obtained by screening were picked and named yGJ87. The recombinants were induced to express and transform 300 mg / L of scopoletin in strict accordance with Example 3. After the fermentation was completed, samples were taken and liquid phase detection was performed. After 72 hours of fermentation, the liquid phase results showed that the content change of scopoletin was almost undetectable. Figure 5 This is a protein purification diagram of OMT translated and expressed by SEQ ID NO.1, wherein M is a reference, 1 is the original E. coli total protein, 2 is the induced E. coli supernatant protein with a recombinant expression vector, and 3 is the purified protein. Figure 6 This is the restriction enzyme digestion identification diagram of pGEX-6p-1 / OMT. Figure 7The HPLC detection diagram of the metabolites of strain yGJ87 shows that only the sequence shown in SEQ ID NO.2 of the DNA sequence table modified according to the characteristics of the methyltransferase sequence provided by the present invention and synthesized by the codon preference of Escherichia coli can achieve efficient functional expression of the target protein and realize the methylation reaction of the C6 hydroxyl group of scopoletin.

[0069] Example 4: OMT syn Enzymatic synthesis of scoparone

[0070] OMT Syn Protein purification: harvest the strain after induced expression in Example 3, centrifuge at 4°C, 5000rpm for 10min, remove the supernatant, resuspend the precipitate twice with 50mL PBS buffer, centrifuge at 4°C, 5000rpm for 10min, and remove the supernatant. Resuspend the precipitate with 50mL PBS and add it to a high-pressure homogenizer that has been precooled to 4°C. Adjust the high-pressure homogenizer to 850bar, turn it on and crush it twice, then collect the lysate. Centrifuge the lysate at 4°C, 13400rpm for 10min, retain the supernatant, and filter the supernatant through a 0.45μm filter membrane for later use. The filtrate is the protein containing OMT. Syn Crude enzyme solution of protein.

[0071] Figure 8 In this embodiment, OMT Syn Protein purification electrophoresis diagram, where M is the reference, 1 is the original E. coli supernatant, 2 is the induced E. coli supernatant with the vector pGEX-6p-1, and 3 is the supernatant with the recombinant expression vector pGEX-6p-1 / OMT Syn 4 is the supernatant of E. coli after induction, and 4 is the purified protein.

[0072] Affinity chromatography will be used to recover OMT syn Protein. Use buffer A to balance a 1 mL nickel column, then load the crude enzyme solution at a flow rate of 1 mL / min, rinse 10 nickel column volumes of buffer A at a flow rate of 1 mL / min, then rinse the nickel column with buffer B at a flow rate of 1 mL / min, and collect the elution peak according to the UV value. Desalt the collected elution peak using a desalting column (HitrapDesalting, 5 mL), and elute and recover the target protein with PBS at pH 7.5 at a flow rate of 5 mL / min. Use NanoDrop to quantify the recovered target protein, dilute it with PBS at pH 7.5 to a protein concentration of 2.5 mg / mL, and place it on ice at 4°C for later use.

[0073] Take 400μL of protein solution in a 1.5mL centrifuge tube, and add 400μL of PBS solution dissolved with 5mM S-adenosyl-L-methionine and 200μL of PBS solution dissolved with 2.5mM scopoletin in turn. Mix by blowing and place in a 30℃ water bath for 1h. Take 800μL of reaction solution in a 5mL centrifuge tube, add 800μL of ethyl acetate, mix thoroughly and centrifuge at 14000rpm for 5min, and take the supernatant for liquid phase detection. The results show that in the pure enzyme catalytic system, 1mg of enzyme protein can catalyze 500μM scopoletin (96.1mg / L) to obtain 462.9μM artemisinin (95.4mg / L), and the molar conversion rate is 92.58%. Fig. 9 For OMT syn HPLC detection chart of the enzymatic synthesis of artemisinin using scopoletin as substrate.

[0074] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A highly active O-methyltransferase gene, characterized in that: The nucleotide sequence of the O-methyltransferase gene is shown in SEQ ID NO.

2.

2. A highly active O-methyltransferase, characterized in that The amino acid sequence of the O-methyltransferase is shown in SEQ ID NO.

3.

3. A recombinant expression vector, consisting of an empty vector and a target gene inserted into the empty vector, characterized in that: The target gene is the O-methyltransferase gene according to claim 1.

4. A recombinant bacterium, characterized in that: The recombinant bacterium contains the recombinant expression vector according to claim 3, or has the gene shown in SEQ ID NO.2 integrated into its genome.

5. Use of the O-methyltransferase gene according to claim 1, the highly active O-methyltransferase according to claim 2, the recombinant expression vector according to claim 3 or the recombinant bacteria according to claim 4 in the preparation of artemisinin.

6. A method for preparing a highly active O-methyltransferase, characterized in that: The following steps are involved: 1) constructing the gene described in claim 1 into a vector; Then transform it into a host strain to obtain a recombinant expression strain; 2) The recombinant expression strain of step 1) is cultured in LB liquid culture medium and induced by adding IPTG. After fermentation, a soluble recombinant O-methyltransferase protein is obtained.

7. A method for preparing scoparone using a highly active O-methyltransferase gene, characterized in that: The method is: According to the O-methyltransferase gene of claim 1, the recombinant expression vector of claim 3 or the recombinant bacteria of claim 4, the O-methyltransferase protein is prepared by bioengineering, and then scopoletin is used as a substrate to catalyze the production of artemisinin.

8. The method according to claim 7, characterized in that The specific method 1 is: inoculating the recombinant bacteria with the gene shown in SEQ ID NO.2 into TB liquid culture medium for culture, and adding IPTG for induction. After 4 hours of induction expression, scopoletin is added to the culture medium in stages, and culture is carried out until the fermentation is completed, and the supernatant contains catalyzed scopoletin. Alternatively, the specific method 2 is: inoculating the recombinant bacteria constructed with the gene shown in SEQ ID NO.2 into TB liquid culture medium for culture, adding IPTG for induction, and culturing until the fermentation is completed; taking the strain cell body for high-pressure homogenization and crushing, collecting the supernatant of the lysate after crushing, and obtaining a crude enzyme solution containing O-methyltransferase protein; reacting the O-methyltransferase protein, S-adenosyl-L-methionine and scopoletin together at 30°C for 1-4 hours to obtain artemisinin.

9. The method according to claim 8, characterized in that In the specific method 2, the O-methyltransferase protein is a crude enzyme solution containing the O-methyltransferase protein, or an O-methyltransferase protein obtained by further purifying the crude enzyme solution containing the O-methyltransferase protein.

10. The method according to any one of claims 8 to 9, characterized in that: The specific preparation method of constructing the recombinant bacteria with the gene shown in SEQ ID NO.2 is as follows: using primers to amplify the gene shown in SEQ ID NO.2 and the empty vector plasmid respectively, then recovering the target fragment with a DNA recovery kit, integrating it into the EcoRI / NotI position of the empty vector plasmid through Gibson assembly, and obtaining a recombinant plasmid; and then transforming the recombinant plasmid into a host strain to obtain a recombinant expression strain.

Images