Application of a rice promoter whose expression is regulated by external salt

By constructing and applying the promoter-GUS expression vector of the rice OsANT1 gene, the problem of insufficient research on the regulation of the amino acid transport gene in rice was solved, and specific expression in rice roots and leaves was achieved under salt induction, which enhanced the salt tolerance and accumulation of amino acid substances in rice, and provided a new method for genetic engineering regulation.

CN116064651BActive Publication Date: 2025-09-02WUHAN INST OF BIOENG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210867327.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-22
Publication Date
2025-09-02
Estimated Expiration
2042-07-22

AI Technical Summary

Technical Problem

In the prior art, there are few studies on the regulatory effects of rice amino acid transport genes in other aspects, especially the biological impact of the promoter of the OsANT1 gene on rice, and it is difficult to improve the salt tolerance of rice through genetic engineering.

Method used

The promoter of the OsANT1 gene member of the rice amino acid transporter gene family was constructed, and the promoter-GUS expression vector was obtained through Agrobacterium-mediated transformation into the callus induced by rice mature embryos. Transgenic plants were obtained, and GUS expression activity was detected under salt treatment. It was found that this promoter could promote the specific expression of downstream genes in roots and leaves under external salt induction, enhancing the absorption and transportation of amino acids.

Benefits of technology

The OsANT1 gene promoter is highly expressed in rice roots and leaves under external salt induction, which enhances the salt tolerance and local accumulation of amino acid substances in rice, and provides a new idea to regulate salt tolerance and growth balance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064651B_ABST
    Figure CN116064651B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of a rice promoter whose expression is regulated by external salt, and belongs to the field of plant genetic engineering. The rice promoter whose expression is regulated by external salt is the promoter of the OsANT1 gene, and its sequence is shown in SEQ ID NO.1. The present invention found through the construction of promoter-GUS transgenic plants and GUS expression activity detection that the promoter can be strongly induced by external sodium chloride to promote the high expression of downstream genes in rice roots and leaves. The promoter of the OsANT1 gene is applied to transgenic engineering, which can make plants salt-tolerant and grow by promoting the absorption and transport of amino acids, and can also make the expression products of the target gene accumulate specifically in the roots and leaves, increasing the local expression level. Therefore, the promoter has good application prospects in transgenic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and particularly relates to a rice promoter whose expression is regulated by external salt and an application thereof. Background Art

[0002] Amino acids play a very important role in plant growth and development because they are basic elements for the synthesis of various enzymes and proteins, and are precursors or nitrogen donors of important substances for plant development. Amino acids play an important role in plant resistance to stresses such as biotic and abiotic stresses. Aspartic acid is an important center for metabolite biosynthesis and can respond to abiotic stress and defense (Han M, Zhang C, Suglo P, Sun S, Wang M, Su TL-Aspartate: Anessential metabolite for plant growth and stress acclimation. Molecules, 2021, 26: 1887.). Glutamate can respond to environmental stresses such as salt, cold, heat, drought and pathogen stress (Qiu XM, Sun YY, Ye XY. Li ZG. Signaling role of glutamate in plants. Frontiers in plant science, 2020, 10: 1743.). Changes in the expression of amino acid transport genes can enhance plant stress resistance. For example, increased expression of AtAAP1 increases proline accumulation, contributing to improved salt tolerance in Arabidopsis seedlings (Wang T, Chen Y, Zhang M, Chen J, Liu J, Han H, Hua X. Arabidopsis AMINO ACID PERMEASE1 contributes to saltstress-induced proline uptake from exogenous sources. Frontiers in Plant Science, 2017, 8: 2182.). Knockout of AtAAP3 and AtAAP6 significantly reduces root-knot nematode infestation in Arabidopsis (Pariyar SR, Nakarmi J, Anwer MA, Siddique S, Ilyas M, Elashry A, Grundler FM. Aminoacid permease 6 modulates host response to cyst nematodes in wheat and Arabidopsis. Nematology, 2018, 20: 737-750.).Knocking out the AtLHT1 gene increases Arabidopsis resistance to a broad spectrum of pathogens (Liu G, Ji Y, Bhuiyan NH, Pilot G, Selvaraj G, Zou J, Wei, Y. Amino acidhomeostasis modulates salicylic acid-associated redox status and defense responses in Arabidopsis. Plant Cell, 2010, 22: 3845-3863.).

[0003] Amino acid transport genes are divided into two families based on the amino acid sequence similarity and amino acid absorption characteristics of the genes they encode: the amino acid / auxin permease (AAAP) family and the amino acid polyamine organic cation (APC) family. AAAPs can be further divided into amino acid permeases (AAPs), lysine and histidine transporters (LHTs), γ-aminobutyric acid transporters (GATs), proline transporters (ProTs), indole-3-acetic acid transporters (AUXs), aromatic and neutral amino acid transporters (ANTs), and amino acid transporters (ATLs). The APC family includes cationic amino acid transporters (CATs), amino acid / choline transporters (ACTs), and L-type amino acid transporters (LATs) (Zhao H, Ma H, Yu L, Wang X, Zhao J. Genome-wide survey and expression analysis of amino acid transporter gene family in rice (Oryza sativa L.). PLoS One, 2012, 7(11): e49210.). In Arabidopsis, AtANT1 mainly transports aromatic and neutral amino acids (Chen L, Ortiz-Lopez A, Jung A, Bush DR. ANT1, anaromatic and neutral amino acid transporter in Arabidopsis. Plant Physiology, 2001, 125(4): 1813-1820.).

[0004] There are more than 80 amino acid transport genes in rice. Studies have found that OsAAP6 is expressed in seeds and is positively correlated with grain protein content, affecting rice quality (Peng B, Kong H, Li Y, Wang L, Zhong M, Sun L, He Y. OsAAP6 functions as an important regulator of grain protein content and nutritional quality in rice. Nature Communications, 2014, 5: 4847.). OsAAP3 specifically transports basic and aromatic amino acids (Taylor MR, Reinders A, Ward JM. Transport function of rice amino acid permeases (AAPs). Plant and Cell Physiology, 2015, 56(7): 1355-1363.). Reducing or knocking out the expression of OsAAP3 accelerates the elongation of rice tiller buds, forming more tillers, and increasing rice yield and nitrogen use efficiency (Lu K, Wu B, Wang J, Zhu W, Nie H, Qian J, Fang, Z. Blocking amino acid transporter OsAAP3 improves grain yield by promoting outgrowth buds and increasing tiller number in rice. Plant Biotechnology Journal, 2018, 16(10): 1710-1722.). OsAAP5 mainly regulates the transport of basic amino acids (lysine, arginine) and neutral amino acids (valine, alanine). Reducing the expression of OsAAP5 can lead to increased rice tillering and grain yield (Wang J, Wu B, Lu K, Wei Q, Qian J, Chen Y, Fang Z. The amino acid permease 5 (OsAAP5) regulates tiller number and grain yield in rice. Plant Physiology, 2019, 180(2): 1031-1045.).The two splicing variants of OsAAP4 positively regulate rice tillering and yield by regulating the allocation of neutral amino acids at different concentrations and through nitrogen metabolism and hormone pathways (Fang Z, Wu B, Ji Y. The amino acid transporter OsAAP4 contributes to rice tillering and grain yield by regulating neutral aminoacid allocation through two splicing variants. Rice, 2021, 14: 2.).

[0005] The above demonstrates the important regulatory role of various amino acids in plant growth and development, but research on the regulatory role of amino acid transport genes in other aspects is relatively limited. To date, there have been no reports on the biological effects of the rice OsANT1 gene and its promoter on rice. The present invention discovered that the promoter sequence of the OsANT1 gene can be induced by external salt to drive high gene expression in roots and leaves. In genetic engineering applications, this can increase the local expression of target genes in roots and leaves, enhancing the absorption of amino acids from the external environment or their accumulation in the roots, thereby achieving salt-tolerant growth. Summary of the Invention

[0006] The purpose of the present invention is to solve the problems existing in the prior art and provide an application of a promoter of the OsANT1 gene, a member of the rice amino acid transporter gene family whose expression is regulated by external salt.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The present invention targets the promoter of the OsANT1 gene (shown in SEQ ID NO. 1), a member of the rice ANT gene family. First, the constructed promoter-GUS expression vector is transformed into callus induced from mature rice embryos via Agrobacterium-mediated transfection. Transgenic plants are obtained, positive plants are identified, and then T1 transgenic plants are obtained, followed by T2 mature seeds. GUS histochemical staining is then performed on the root and leaf tissues of the T2 seedlings after salt treatment. GUS expression activity is measured and its spatiotemporal expression specificity is analyzed, providing new insights into how to regulate salt tolerance and growth balance. Results show that the promoter activity is strongly induced by external salt exposure, promoting the specific expression of downstream genes in the roots and leaves of rice. Application of this promoter in transgenic engineering can promote the absorption and transport of amino acids under external salt induction, promoting salt-tolerant growth in rice. It can also cause the expression product of the target gene under this promoter to accumulate specifically in the roots and leaves, increasing local expression. Therefore, the OsANT1 promoter has promising application prospects in transgenic engineering.

[0009] The invention discloses an application of an OsANT1 gene promoter in rice, wherein the promoter can activate downstream genes to be highly expressed in rice roots and leaves under external salt induction.

[0010] The sequence of the promoter is as shown in SEQ ID NO.1, or a DNA sequence having equivalent function obtained by replacing, adding and / or deleting one or several nucleotides from the sequence shown in SEQ ID NO.1 without affecting the expression of downstream genes.

[0011] The method for realizing the application includes the following steps: constructing an expression vector of the promoter-target gene of the OsANT1 gene, and then introducing the expression vector into rice to obtain transgenic rice. The transgenic rice can promote the expression of the target gene in roots and leaves under external salt induction.

[0012] The backbone vector of the expression vector is preferably pCAMBIA-1391Z vector.

[0013] The salt induction is NaCl induction, and the concentration of NaCl is preferably 100 mM.

[0014] This study discovered that the promoter activity of the OsANT1 gene can be induced by external salt. Using this promoter in transgenic rice, it can specifically express downstream genes in the roots and leaves of rice under salt induction. This promoter has promising application prospects in transgenic engineering. This study is of great significance for future research into promoting salt tolerance and growth in rice through the absorption and transport of amino acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is an image showing transgenic plants expressing a promoter-GUS expression vector. M in the image indicates DNA size; lane 1 is a positive control; lane 2, devoid of bands, is a negative control; lanes 3-17 represent T0-generation promoter-GUS-positive plants. This indicates that the promoter-GUS vector has been transferred into the transgenic lines in lanes 3-17.

[0016] Figure 2 Figure 1 shows the effect of salt treatment on GUS expression in the roots and leaves of transgenic plants. Figure A shows root staining before salt treatment, and Figure B shows root staining 2 hours after salt (100 mM NaCl) treatment. Figure C shows leaf staining before salt treatment, and Figure D shows leaf staining 2 hours after salt (100 mM NaCl) treatment. Deep blue staining indicates high GUS expression activity. After salt treatment, OsANT1 gene expression was high in the roots and leaves of Zhonghua 11, indicating that the promoter is regulated by salt.

[0017] Figure 3 Figures 2 and 3 show microscopic observations of paraffin sections of roots and leaves of salt-treated transgenic plants. A shows the root section stained before salt treatment, and B shows the root section stained after salt treatment. C shows the leaf section stained before salt treatment, and D shows the root and leaf sections stained after salt treatment. This further demonstrates that the promoter is induced by external salt.

[0018] Figure 4 This figure shows the expression of OsANT1 in the roots of Zhonghua 11 seedlings 2 hours after salt treatment. The OsANT1 gene expression level in Zhonghua 11 roots was high after salt treatment, indicating that the promoter is regulated by salt.

[0019] Figure 5 This figure shows the expression of OsANT1 in leaves of Zhonghua 11 seedlings 2 hours after salt treatment. OsANT1 gene expression is high in Zhonghua 11 leaves after salt treatment, indicating that the promoter is regulated by salt. DETAILED DESCRIPTION

[0020] The present invention will be further described in detail below with reference to the following examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods and can be performed according to the recombinant techniques described (see Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials and reagents used are all commercially available.

[0021] [Example 1] Construction of OsANT1 gene promoter-GUS transgenic plants

[0022] DNA was extracted from rice variety Zhonghua 11. The OsANT1 promoter sequence (1957 bp) was amplified by PCR using primers F (TTAAGCTTATCTTGGCATGGTTCTTT) and R (TAGGATCCTTCCAGGGAGGGAGTTAG). The fragment was then ligated into the pCAMBIA-1391Z vector using the BamHI and HindIII restriction sites to construct the promoter-GUS expression vector pOsANT1-p1391Z. The promoter-GUS expression vector was then introduced into callus induced from mature rice embryos using Agrobacterium tumefaciens EHA105-mediated genetic transformation.

[0023] All transgenic seedlings were transplanted into boxes with soil, watered and fertilized regularly, and planted in the field when the seedlings were about 10 cm tall. After the seedlings grew up, the T1 generation transgenic plants were tested by PCR. The detection primer pair is:

[0024] Detection primer F: TTCTTCGCTCCCTTCACC,

[0025] Detection primer R: CGCCAGAGTTTGGGTTGT.

[0026] If a 433 bp fragment is amplified, the transgenic plant is considered positive. Positive plants are harvested and planted until homozygous transgenic plants are identified in the T2 generation.

[0027] [Example 2] Detection of promoter-GUS expression activity in transgenic plant seedlings treated with salt

[0028] At the seedling stage, the T2 generation homozygous transgenic plants were treated with salt (100 mM NaCl), and then the roots and leaves were subjected to GUS staining. The specific process is as follows:

[0029] After successfully identified T2 generation seeds are harvested, they are soaked in water and incubated in a 37°C incubator. When the seeds germinate and the buds reach approximately 2 cm, they are sown in 96-well plates and cultured in a greenhouse under illuminated water. When the seedlings reach the stage of germination, they are switched to a rice nutrient solution formulated using the same ingredients as the International Rice Research Institute's standard nutrient solution. When the seedlings reach approximately 10 cm, 100 mM NaCl is added to the nutrient solution for 2 hours. GUS staining is then performed on the leaves and roots of the seedlings before and after salt treatment.

[0030] The above materials were soaked in GUS staining solution and kept at 37℃ overnight. Then they were decolorized with 75% alcohol three times and stored at 4℃. The materials decolorized with alcohol were observed under a microscope. The blue areas were the sites of GUS active expression. Figure 2After staining, it was found that the GUS activity in the roots and leaves was dark blue after salt treatment. The above materials were sent to the company for paraffin section and observed and photographed under a microscope. The results are shown in Figure 3 After sectioning, it was found that the cell tissue was stained darker after salt treatment, which further demonstrated that GUS activity was induced by salt in both roots and leaves.

[0031] [Example 3] Identification of OsANT1 in wild-type japonica rice variety Zhonghua 11 seedlings under salt treatment

[0032] RNA was extracted from leaves and roots of Zhonghua 11, a GUS seedling, before and after salt treatment (100 mM NaCl). RNA was reverse-transcribed into cDNA. Using the cDNA as a template, quantitative PCR (qRT-PCR) was performed using Taq Pro Universal SYBR qPCR Master Mix (Beijing, China). The reaction procedure was as follows: 40 cycles of 95°C pre-denaturation for 30 seconds, 95°C denaturation for 10 seconds, 60°C annealing for 10 seconds, and fluorescence detection. Three replicates were performed for each gene. The quantitative primers for the genes used in this experiment were:

[0033] OsActin-F:CGGTGTCATGGTCGGAAT,

[0034] OsActin-R:GCTCGTTGTAGAAGGTGT,

[0035] Used for amplification of the internal reference gene ACTIN;

[0036] q-OsANT1-F:TGATGCACCCAATCCACG,

[0037] q-OsANT1-R:CCCGAACGCAGGTATTGAA,

[0038] Used for amplification of the OsANT1 gene.

[0039] The results are as follows Figure 4 and Figure 5 As shown, the expression level of the OsANT1 gene in the roots and leaves of Zhonghua 11 seedlings before salt treatment was 1. After two hours of salt treatment, OsANT1 expression levels in both roots and leaves increased. In particular, the expression level in the roots of Zhonghua 11 after salt treatment was 63 times higher than before treatment, indicating that salt treatment induced OsANT1 gene expression.

[0040] The above results indicate that the expression of the OsANT1 gene promoter is induced by external salt. The OsANT1 gene promoter can be used to specifically accumulate the expression product of the target gene in the roots and leaves, thereby increasing the local expression level. Therefore, the OsANT1 gene promoter has good application prospects in transgenic engineering.

[0041] It should be understood that the embodiments of the present invention are not limited to the above-mentioned embodiments, and any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A OsANT1 The application of a gene promoter in rice is characterized by: The application is that the promoter can activate the high expression of downstream genes in rice roots and leaves under NaCl induction; the sequence of the promoter is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The following steps are included: Build OsANT1 The promoter of the gene-expression vector of the target gene is then introduced into rice to obtain transgenic rice. The transgenic rice can promote the expression of the target gene in roots and leaves under NaCl induction.

3. The use according to claim 2, characterized in that: The backbone vector of the expression vector is pCAMBIA-1391Z vector.

4. The use according to claim 1, characterized in that: The concentration of NaCl is 100 mM.