Application of TRPV protein or its encoding gene in regulating the sensitivity of green peach aphid to diprofenoate

By reducing the expression level or activity of TRPV protein, and using the TRPV protein encoding gene or dsRNA interference method, the sensitivity of peach aphid to bispyribac-methyl was increased, solving the problem of peach aphid resistance to insecticides, enhancing the control effect, and providing a basis for the creation of new insecticides.

CN116064679BActive Publication Date: 2025-10-28CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211073931.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-02
Publication Date
2025-10-28
Estimated Expiration
2042-09-02

AI Technical Summary

Technical Problem

In existing technologies, peach aphids have developed resistance to the chemical insecticide bispyribac-methyl, leading to a decline in control efficacy. It is necessary to improve their sensitivity to bispyribac-methyl in order to delay the development of resistance.

Method used

By reducing the expression level or activity of TRPV protein, the sensitivity of peach aphids to bispyribac-methyl can be enhanced using the encoding gene of TRPV protein or dsRNA interference methods. Specifically, this involves designing and synthesizing dsRNA of TRPV protein and introducing it into the peach aphids through feeding.

Benefits of technology

It significantly increased the sensitivity of peach aphids to bispyribac-methyl, enhanced the control effect, provided a new integrated management strategy for pesticide resistance, and provided a basis for the creation of new insecticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003830618950000051
    Figure BDA0003830618950000051
  • Figure HDA0003830618960000011
    Figure HDA0003830618960000011
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, specifically disclosing the application of TRPV protein or its encoding gene in regulating the sensitivity of peach aphids to bispyribac-methyl. The invention found that double-stranded RNA designed based on the TRPV gene sequence can significantly inhibit the expression of the peach aphid TRPV gene, and that TRPV dsRNA can increase the sensitivity of peach aphids to bispyribac-methyl, thus proposing the application of TRPV protein or its encoding gene in regulating the sensitivity of peach aphids to bispyribac-methyl; the amino acid sequence of the TRPV protein is shown in SEQ ID No. 3 or SEQ ID No. 4. This invention is of positive significance in solving the problems of severe pesticide resistance and decreased control efficacy in peach aphids caused by long-term use of chemical insecticides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to the application of TRPV protein or its encoding gene in regulating the sensitivity of peach aphids to bispyribac-sodium. Background Technology

[0002] The peach aphid is a widespread polyphagous pest, primarily causing damage by sucking plant sap, leading to leaf curling. Its honeydew excretions disrupt the host's photosynthetic processes and promote pathogen growth. It also acts as a vector for plant viruses in various vegetables. Characterized by a short reproductive cycle and high reproduction rate, it can easily cause outbreaks in a short period under suitable conditions, resulting in incalculable losses to agricultural production. While the widespread use of chemical pesticides is very effective in controlling pests, the long-term and large-scale harm they cause to the environment and higher animals cannot be ignored.

[0003] Interfering with insect target genes using molecular biology techniques to increase insect sensitivity to novel pesticides is of great significance for delaying the development of pesticide resistance in pests and formulating new integrated pest management strategies. Utilizing RNA interference-based pest control technology has positive implications for improving the control of peach aphids and addressing their pesticide resistance. Summary of the Invention

[0004] The purpose of this invention is to provide a new method for improving the sensitivity of peach aphids to diclofenac.

[0005] Specifically, the technical solution of the present invention is as follows:

[0006] In a first aspect, the present invention provides the application of TRPV protein or its encoding gene in regulating the sensitivity of peach aphids to bispyribac-methyl; the amino acid sequence of said TRPV protein is shown in SEQ ID No. 3 or SEQ ID No. 4.

[0007] The TRPV protein of the present invention is the TRPV-Nanchung protein or TRPV-Inactive protein encoded by the transotropic vanillic acid transient receptor complex ion channel gene TRPV-Nanchung or TRPV-Inactive. The amino acid sequence of the TRPV-Nanchung protein is shown in SEQ ID No. 3, and the amino acid sequence of the TRPV-Inactive protein is shown in SEQ ID No. 4.

[0008] In the application of the present invention, the sensitivity of peach aphids to bispyribac-methyl is enhanced by reducing the expression level of the TRPV protein (preferably by inhibiting the expression of the gene encoding the TRPV protein) or its activity.

[0009] The nucleotide sequence of the gene encoding the TRPV protein is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0010] Secondly, the present invention provides the application of an expression inhibitor or activity inhibitor of the TRPV protein encoding gene in enhancing the sensitivity of peach aphids to bispyribac-methyl or in the preparation of pesticides for controlling peach aphids; the amino acid sequence of the TRPV protein is shown in SEQ ID No. 3 or SEQ ID No. 4.

[0011] Thirdly, the present invention provides the application of dsRNA of TRPV protein in enhancing the sensitivity of peach aphids to bispyribac-methyl or in the preparation of pesticides for controlling peach aphids; the amino acid sequence of the TRPV protein is shown in SEQ ID No. 3 or SEQ ID No. 4.

[0012] Preferably, the positive strand sequence of the dsRNA of the TRPV protein is shown in SEQ ID No. 5 or SEQ ID No. 6.

[0013] The dsRNA of the present invention can be obtained in the following manner:

[0014] Using the TRPV-Nanchung and TRPV-Inactive genes as templates, partial sequences of the peach aphid TRPV complex ion channel gene were amplified using primers F1: TTTGTTCTTCTGCAGGGGTT and R1: TGAATGCGTTTCATTTCCAA; and primers F2: CGAGGGTCTAGCGTATCTCG and R2: ACAATGGTTTGTCCTGGTCC, respectively (the sequences are shown in SEQ ID No. 5 or SEQ ID No. 6). Then, the above partial sequence of the peach aphid TRPV complex ion channel gene was used to synthesize double-stranded RNA (dsRNA) of the peach aphid TRPV gene using an in vitro transcription kit.

[0015] In the application of this invention, a step of feeding peach aphids with the dsRNA of the TRPV protein is included; specifically, the feeding method involves feeding peach aphids with a feed containing dsRNA for 72 hours, wherein the concentration of dsRNA in the feed is 500 ng·μL. -1 .

[0016] Fourthly, the present invention provides a TRPV protein, the amino acid sequence of which is shown in SEQ ID No. 3.

[0017] Fifthly, the present invention provides a TRPV gene, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0018] In a sixth aspect, the present invention provides a dsRNA of a TRPV protein, the positive strand sequence of which is shown in SEQ ID No. 5 or SEQ ID No. 6.

[0019] The beneficial effects of this invention are at least as follows:

[0020] The full-length TRPV gene of the peach aphid and the sequence for synthesizing dsRNA provided by the present invention can be used to interfere with the expression of the TRPV gene of the peach aphid and increase the sensitivity of the peach aphid to bispyribac-methyl.

[0021] The dsRNA interference method can enhance the sensitivity of peach aphids to bispyribac-methyl, which is of positive significance for solving the problems of severe pesticide resistance and reduced control efficacy in peach aphids caused by long-term use of chemical insecticides. It can also provide a basis for further determining the mechanism of action of bispyribac-methyl and creating novel insecticides through molecular methods. Attached Figure Description

[0022] Figure 1 Statistical results of TRPV-dsRNA inhibiting TRPV gene expression in peach aphids. The horizontal axis represents time; the vertical axis represents relative expression. In the figure, * indicates that the relative expression level of the target gene was significantly reduced in the treatment group compared with the control group. Detailed Implementation

[0023] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0025] Example 1: Cloning of the full-length sequence of the transvanillic acid transient receptor gene TRPV (aphid)

[0026] The full-length coding sequence of the peach aphid TRPV-Nanchung gene is 2709 bp (as shown in SEQ ID No. 1), encoding a protein of approximately 102 kDa (amino acid sequence shown in SEQ ID No. 3), with a theoretical isoelectric point of 6.07. The full-length coding sequence of the peach aphid TRPV-Inactive gene is 2982 bp (as shown in SEQ ID No. 2), encoding a protein of approximately 111 kDa (amino acid sequence shown in SEQ ID No. 4), with a theoretical isoelectric point of 7.77.

[0027] Total RNA was extracted from peach aphids and reverse transcribed to obtain cDNA. Primers were designed using cDNA as a template to amplify the TRPV-Nanchung gene sequence and a partial TRPV-Inactive gene sequence. The full-length TRPV-Inactive gene was obtained by splicing the cDNA ends using rapid cDNA end cloning (RACE) technology.

[0028] The primers used to amplify the TRPV-Nanchung gene are shown in SEQ ID No. 7-8, and the primers used to amplify the TRPV-Inactive gene are shown in SEQ ID No. 9-10.

[0029] Example 2: Synthesis of dsRNA of the TRPV gene in the peach aphid and its interference with TRPV.

[0030] Based on the full-length TRPV genes (TRPV-Nanchung and TRPV-Inactive) cloned in Example 1, primers F1 and R1 (as shown in SEQ ID No. 11-12), and F2 and R2 (as shown in SEQ ID No. 13-14) were designed to amplify sequences of 600 bp (as shown in SEQ ID No. 5) and 599 bp (as shown in SEQ ID No. 6), respectively. The dsRNAs (dsNan and dsIav) of the two TRPV genes were synthesized using the MEGAscript T7 transcription kit. The two dsRNAs were then mixed with artificial feed for peach aphids (0.5 mol·L⁻¹). -1 After mixing with sucrose feed, wingless adult peach aphids (1 day old) were fed for 72 hours. dsRNA was fed using artificial feed as a carrier, with a final concentration of 500 ng·μL in the artificial feed. -1 Each group consisted of 30 peach aphids. A separate control group was set up using GFP dsRNA (dsGFP).

[0031] In the preparation of dsGFP, the GFP sequence was used as a template and amplified using primers dsGFP-F: taatacgactcactatagggagaCAGTGCTTCAGCCGCTAC (SEQ ID No. 15); and dsGFP-R: taatacgactcactatagggagaGTTCACCTTGATGCCGTTC (SEQ ID No. 16) to obtain the GFP fragment sequence (as shown in SEQ ID No. 17). Then, dsGFP was synthesized using an in vitro transcription kit.

[0032] The expression of the TRPV gene in peach aphids was detected by real-time quantitative PCR at 24, 48, and 72 hours after the start of feeding. The results showed that dsNan and dsIav effectively silenced the TRPV gene expression in peach aphids, demonstrating good target gene silencing effects (see results). Figure 1 The internal reference genes are actin and 18S.

[0033] Example 3: The dsRNA of the TRPV gene can enhance the susceptibility of peach aphids to diclofenac.

[0034] The dsNan and dsIav synthesized in vitro in Example 2 were respectively reacted with artificial feed (0.5 mol·L⁻¹). -1 One-day-old wingless adult peach aphids were fed a mixture of sucrose-containing feed and artificial feed. The dsRNA was fed using artificial feed as a carrier, with a final concentration of 500 ng / μL in the artificial feed. -1 The study aimed to observe whether TRPV dsRNA could enhance the sensitivity of peach aphids to bispyribac-methyl. GFP dsRNA (dsGFP) from Example 2 was used as a control group. Each group consisted of 30 peach aphids.

[0035] 72 hours after feeding, the toxicity of bispyribac-sodium in the control and treatment groups of peach aphids was determined using the leaf film method. LC50 50 The reduction in [a certain percentage] was used as a criterion for determining whether TRPV dsRNA treatment could improve the sensitivity of peach aphids to bispyribac-methyl.

[0036] Compared with the control group fed dsGFP, the susceptibility of peach aphid to bispyribac-methyl increased by 1.7 and 10.6 times, respectively, after feeding dsNan and dsIav (Table 1).

[0037] Table 1. Results of toxicity assay of different treatments of peach aphid to diclofenac.

[0038]

[0039] a Slope ± standard error (Slope ± SE); b95% confidence limit (95% CL); c Chi-square value (χ²) 2 ) and degrees of freedom (df); d RR = LC50 of control group / LC50 of treatment group.

[0040] As described above, this invention provides the full-length sequence of the TRPV gene in the peach aphid and the sequence of an effective interfering fragment targeting this gene. This invention also provides a specific method for improving the sensitivity of peach aphids to bispyribac-methyl after treatment with TRPV dsRNA.

[0041] This invention provides an RNA interference method to enhance the control efficacy of bispyribac-methyl, applicable to the control of resistant peach aphids. By interfering with insect target genes using molecular biology techniques, it increases the insect's sensitivity to novel insecticides, which is significant for delaying the development of insecticide resistance and formulating new integrated pest management strategies. The use of RNA interference-based pest control technology is of positive significance for improving the control effect on peach aphids and addressing their resistance to insecticides. Simultaneously, it can provide a basis for further determining the mechanism of action of bispyribac-methyl and creating novel insecticides through molecular methods.

[0042] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The application of TRPV protein or its encoding gene in regulating the sensitivity of peach aphids to bispyribac-methyl; the amino acid sequence of the TRPV protein is shown in SEQ ID No. 3 or SEQ ID No. 4; By reducing the expression level or activity of the TRPV protein, the sensitivity of the peach aphid to bispyribac-methyl is increased.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the TRPV protein is shown in SEQ ID No. 1 or SEQ ID No.

2.

3. The application of dsRNA of TRPV protein in enhancing the sensitivity of peach aphids to bispyribac-methyl or in the preparation of pesticides for controlling peach aphids; the amino acid sequence of the TRPV protein is shown in SEQ ID No. 3 or SEQ ID No.

4.

4. The application according to claim 3, characterized in that, The positive strand sequence of the dsRNA of the TRPV protein is shown in SEQ ID No. 5 or SEQ ID No.

6.

5. The application according to claim 3 or 4, characterized in that, The method includes feeding peach aphids with the dsRNA of the TRPV protein; specifically, feeding peach aphids with a feed containing dsRNA for 72 hours, wherein the concentration of dsRNA in the feed is 500 ng·μL. -1 .