Application of circRNA in enhancing chemotherapy sensitivity of triple-negative breast cancer and prognostic evaluation of breast cancer patients
By overexpressing circRNA-CREIT in TNBC cells, the difficulties of chemotherapy resistance and prognosis assessment are solved, chemotherapy sensitivity is enhanced and new prognostic evaluation methods are provided, achieving effective treatment and prediction of TNBC patients.
Patent Information
- Application Number
- CN202210971785.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-12
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-08-12
AI Technical Summary
In the prior art, patients with triple-negative breast cancer have strong chemotherapy resistance and poor prognosis, and lack effective means of enhancing chemotherapy sensitivity and prognosis evaluation methods.
Through studies, it was found that circRNA-CREIT expressed lower than normal tissues in breast cancer tissues, and overexpressed circRNA-CREIT in TNBC cell lines to enhance chemotherapy sensitivity, provide new therapeutic targets and prognostic evaluation factors, and evaluated using substances and systems that detect circRNA-CREIT expression levels, and enhance chemotherapy effects using substances that promote circRNA-CREIT expression and activity.
It significantly enhances the sensitivity of TNBC cells to chemotherapy drugs, provides new prognostic evaluation methods, improves the accuracy of patient survival prediction, and provides new therapeutic targets and drug screening methods for TNBC patients.
Smart Images

Figure CN116064794B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of disease diagnosis and treatment and molecular biology technology, and specifically relates to the application of circRNA in enhancing the chemotherapy sensitivity of triple-negative breast cancer and in the prognosis assessment of breast cancer patients. Background Art
[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.
[0003] Breast cancer is the most common cancer among women worldwide, and its diagnosis rate has continued to rise in recent years. Based on the expression of estrogen receptors (ER), progesterone receptors (PR), and human epidermal growth factor receptor (HER-2), breast cancer can be divided into three major categories: luminal breast cancer, HER-2-positive breast cancer, and triple-negative breast cancer (TNBC). TNBC, a subtype of breast cancer negative for ER, PR, and HER-2, accounts for approximately 15% of all breast cancer cases. Compared with luminal and HER-2-positive breast cancer, TNBC is more aggressive and has a poorer prognosis. Due to the loss of these receptors, TNBC patients are unable to benefit from traditional endocrine therapy and HER-2-targeted therapies. Chemotherapy remains the mainstay of systemic treatment for TNBC patients. Although TNBC patients have higher sensitivity to anthracyclines and taxanes compared to non-triple-negative breast cancer (non-TNBC), most patients develop chemotherapy resistance during treatment, ultimately leading to recurrence and metastasis. TNBC patients have a significantly higher risk of recurrence 3-5 years after diagnosis than hormone receptor-positive patients. Therefore, exploring the underlying mechanisms of TNBC progression and chemotherapy resistance and identifying effective new therapeutic targets are urgent clinical challenges.
[0004] Circular RNA (circRNA) is a novel endogenous RNA molecule formed by reverse splicing of precursor RNA. Compared to linear RNA, circRNA lacks a 5' cap and a 3' poly(A) tail and is characterized by good biological conservation, high stability, and insensitivity to exonucleases. CircRNAs can influence gene expression through various mechanisms, such as acting as endogenous adsorption sponges for miRNAs, binding to proteins and regulating protein stability or protein-protein interactions, transcriptional regulation, and alternative splicing. Increasing evidence highlights the important regulatory role of circRNAs in cancer development and progression. However, the functions and potential mechanisms by which circRNAs regulate chemotherapy resistance in TNBC remain largely unknown. Therefore, identifying circRNAs that regulate chemosensitivity and investigating their underlying mechanisms may provide new therapeutic targets for TNBC. Summary of the Invention
[0005] In response to the deficiencies in the above-mentioned prior art, the inventors, after long-term technical and practical exploration, have provided the application of circRNA-CREIT in enhancing the chemotherapy sensitivity of triple-negative breast cancer and assessing the prognosis of breast cancer patients. Through research, the present invention found that circRNA-CREIT expression in breast cancer tissue is significantly lower than that in surrounding normal breast tissue, and its expression in TNBC cell lines is significantly lower than that in non-TNBC. In addition, circRNA-CREIT overexpression is significantly correlated with a good prognosis in breast cancer patients. Overexpression of circRNA-CREIT in TNBC cell lines can significantly enhance the sensitivity of cells to the chemotherapy drug doxorubicin. Based on the above research results, the present invention was completed.
[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:
[0007] The first aspect of the present invention provides the use of a substance for detecting the expression level of circRNA-CREIT in the preparation of a breast cancer prognosis assessment product.
[0008] Wherein, the breast cancer is triple-negative breast cancer;
[0009] The breast cancer prognosis assessment includes the assessment of the survival of patients with (triple-negative) breast cancer;
[0010] The survival period includes overall survival (OS).
[0011] In a second aspect, the present invention provides a product comprising a substance for detecting circRNA-CREIT expression, which can be used for breast cancer prognosis assessment.
[0012] A third aspect of the present invention provides a system for breast cancer prognosis assessment, the system comprising:
[0013] i) an analysis module, the analysis module comprising a detection substance for determining the expression level of the circRNA-CREIT selected from the above in a test sample of a subject, and;
[0014] ii) an evaluation module, comprising determining the prognosis of the subject based on the expression of the circRNA-CREIT determined in i).
[0015] A fourth aspect of the present invention provides the use of circRNA-CREIT as a target in the treatment of breast cancer and / or screening of breast cancer drugs.
[0016] A fifth aspect of the present invention provides the use of a substance that promotes the expression and / or activity of circRNA-CREIT in any one or more of the following:
[0017] (a) enhancing the sensitivity of breast cancer cells to chemotherapeutic drugs or preparing a product that enhances the sensitivity of breast cancer cells to chemotherapeutic drugs;
[0018] (b) treating breast cancer or preparing a product for treating breast cancer.
[0019] Wherein, the breast cancer may be triple-negative breast cancer.
[0020] A sixth aspect of the present invention provides a method for treating breast cancer, comprising administering to a subject the above-mentioned substance that promotes the expression and / or activity of circRNA-CREIT.
[0021] Specifically, overexpression of circRNA-CREIT in TNBC cell lines can significantly enhance the sensitivity of breast cancer cells to the chemotherapy drug doxorubicin, thereby achieving the purpose of treating breast cancer.
[0022] Compared with the existing technical solutions, the above one or more technical solutions have the following beneficial effects:
[0023] TNBC patients are prone to developing drug resistance during chemotherapy, leading to worsening of their condition and even death. This study found that circRNA-CREIT could provide a novel therapeutic target for enhancing chemotherapy sensitivity in TNBC and a novel predictive factor for prognosis in breast cancer patients, thus possessing promising practical application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.
[0025] Figure 1This is a structural model diagram of circRNA-CREIT.
[0026] Figure 2 In the embodiment of the present invention, the expression of circRNA-CREIT in breast cancer tissue is significantly lower than that in surrounding normal tissue.
[0027] Figure 3 In the embodiment of the present invention, the prognosis of breast cancer patients with high expression of circRNA-CREIT was significantly better than that of the low expression group.
[0028] Figure 4 In the embodiment of the present invention, the expression of circRNA-CREIT in TNBC is significantly lower than that in non-TNBC.
[0029] Figure 5 The sequencing results show the linker sequence of circRNA-CREIT.
[0030] Figure 6 In the examples of the present invention, overexpression of circRNA-CREIT in TNBC cells can enhance the sensitivity of cells to doxorubicin (DOX). DETAILED DESCRIPTION
[0031] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.
[0032] It should be noted that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. In the following specific embodiments, if the experimental methods of specific conditions are not specified, they are generally in accordance with the conventional methods and conditions of molecular biology within the technology of the art, and such techniques and conditions are fully explained in the literature.
[0033] In a typical embodiment of the present invention, the use of a substance for detecting the expression level of circRNA-CREIT in the preparation of a breast cancer prognosis assessment product is provided.
[0034] Wherein, the breast cancer is triple-negative breast cancer;
[0035] The breast cancer prognosis assessment includes the assessment of the survival of patients with (triple-negative) breast cancer;
[0036] The survival period includes overall survival (OS).
[0037] The circRNA-CREIT is formed by cyclization of exons 6-7 of the host gene SPIDR, and its chromosome location is chr8:48308935-48320523.
[0038] Its nucleotide sequence is shown below:
[0039] CCAAGTTCTATAGAAATTTTAGAGTATTCATCAGATAGTGAAAAAGAAGATGATTTGGAAAATGTCCTACTCATTGATTCAGAATCCCCTCACAAATACCACGTGCAGTTTGCATCGGATGCAAGACAGATTATGGAGAGACTGATAGATCCAAGGACAAAATCAACAGAGACCATTT TGCATACACCTCAGAAACCCACAGCTAAGTTTCCAGGACTCCAGAAAATTCAGCAAAGAAGAAGCTTTTAAGAGGTGGACTAGCAGAAAGACTAAATGGACTGCAGAATCGAGAGATCTGCTATTTCTTTGTGGAGACATCAATGTATTTCTTACCAAAAGACACTTTCAG(SEQ ID NO.1).
[0040] Using biological techniques, the present invention discovered that circRNA-CREIT expression is significantly lower in breast cancer tissue than in surrounding normal breast tissue, and in TNBC cell lines than in non-TNBC. Furthermore, circRNA-CREIT overexpression is significantly correlated with a favorable prognosis in breast cancer patients. Overexpression of circRNA-CREIT in TNBC cell lines significantly enhances the cells' sensitivity to the chemotherapy drug doxorubicin. This suggests that the present invention may provide a novel therapeutic target for TNBC and a new predictor of prognosis in breast cancer patients.
[0041] In the present invention, the substance for detecting the expression level of circRNA-CREIT is not specifically limited, and includes but is not limited to quantitative and / or qualitative detection substances; preferably, the substance for detecting the expression level of circRNA-CREIT is a substance for quantitatively detecting the expression level of circRNA-CREIT in a sample to be tested.
[0042] Wherein, the sample to be tested can be breast cancer cells or tissues of a subject.
[0043] The subject is a breast cancer patient, specifically a triple-negative breast cancer patient.
[0044] In another specific embodiment of the present invention, the substance for detecting the expression level of circRNA-CREIT in the sample to be tested is one or more selected from gene amplification primers (such as SEQ ID NO. 2-3), probes, and gene chips.
[0045] In another specific embodiment of the present invention, a product is provided, which contains a substance for detecting circRNA-CREIT expression, and the product can be used for breast cancer prognosis assessment.
[0046] In another specific embodiment of the present invention, the substance for detecting the expression level of circRNA-CREIT in the sample to be tested is one or more selected from gene amplification primers (such as SEQ ID NO. 2-3), probes, and gene chips.
[0047] In another specific embodiment of the present invention, the product can be a detection reagent, a detection kit, a biosensor, etc., which is not specifically limited here.
[0048] A third aspect of the present invention provides a system for breast cancer prognosis assessment, the system comprising:
[0049] i) an analysis module, the analysis module comprising a detection substance for determining the expression level of the circRNA-CREIT selected from the above in a test sample of a subject, and;
[0050] ii) an evaluation module, comprising determining the prognosis of the subject based on the expression of the circRNA-CREIT determined in i).
[0051] Wherein, the subject is a patient with triple-negative breast cancer, the sample to be tested includes but is not limited to breast cancer cells or tissues of the breast cancer patient, and the prognosis is but not limited to evaluating the survival period of the breast cancer patient; the survival period includes overall survival (OS).
[0052] More specifically, the prognosis of the subject is determined as follows: when the circRNA-CREIT is highly expressed, it indicates that the subject has a better prognosis (longer overall survival); otherwise, it indicates that the subject has a poor prognosis (shorter overall survival).
[0053] In another embodiment of the present invention, the use of circRNA-CREIT as a target in the treatment of breast cancer and / or screening of breast cancer drugs is provided.
[0054] In another embodiment of the present invention, the method for screening breast cancer drugs comprises:
[0055] 1) Treating a system expressing and / or containing the circRNA-CREIT with a candidate drug; setting up a parallel control without treatment with the candidate drug;
[0056] 2) After completing step 1), detecting the expression level of the circRNA-CREIT in the system; if the expression level of the circRNA-CREIT in the system treated with the candidate drug is significantly increased compared to the parallel control, the candidate substance can be used as a candidate breast cancer treatment drug.
[0057] The breast cancer therapeutic drug may be a triple-negative breast cancer therapeutic drug. More specifically, the triple-negative breast cancer therapeutic drug is a drug that enhances the sensitivity of breast cancer to chemotherapy drugs.
[0058] In another embodiment of the present invention, there is provided the use of a substance for promoting the expression and / or activity enhancement of circRNA-CREIT in any one or more of the following:
[0059] (a) enhancing the sensitivity of breast cancer cells to chemotherapeutic drugs or preparing a product that enhances the sensitivity of breast cancer cells to chemotherapeutic drugs;
[0060] (b) treating breast cancer or preparing a product for treating breast cancer.
[0061] In another embodiment of the present invention, the breast cancer may be triple-negative breast cancer;
[0062] Substances that promote the expression and / or activity of circRNA-CREIT include, but are not limited to, substances that upregulate the expression and / or activity of circRNA-CREIT using gene-specific technologies; such as artificially synthesized short hairpin RNA (shRNA) or promoters or lentiviruses that upregulate the expression of circRNA-CREIT; and also include compound promoters.
[0063] The product can be a drug or an experimental reagent, and the experimental reagent can be used for basic research. For example, a triple-negative breast cancer cell model can be constructed and the mechanism of its resistance to chemotherapy drugs can be explored by overexpressing its circRNA-CREIT.
[0064] According to the present invention, when the product is a medicine, the medicine further comprises at least one inactive pharmaceutical ingredient.
[0065] The inactive pharmaceutical ingredients may be carriers, excipients, and diluents commonly used in pharmacy. Furthermore, according to conventional methods, the pharmaceutical composition may be prepared into oral preparations, external preparations, suppositories, and sterile injectable solutions in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.
[0066] The non-drug active ingredients such as carriers, excipients and diluents that may be included are well known in the art, and those skilled in the art can determine whether they meet clinical standards.
[0067] In another embodiment of the present invention, the medicament of the present invention can be administered into the body by known means. For example, systemic delivery via a vein. Alternatively, administration can be performed intravenously, transdermally, intranasally, via a mucosal membrane, or other delivery method. Such administration can be performed via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dosage to be administered in the present invention can vary greatly depending on a variety of factors, such as the target cell, the type of organism or its tissue, the general condition of the subject to be treated, the route of administration, the mode of administration, and the like.
[0068] In another embodiment of the present invention, the subject of drug administration can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, orangutans, etc., preferably humans.
[0069] In another embodiment of the present invention, a method for treating breast cancer is provided, comprising administering to a subject the above-mentioned substance that promotes the expression and / or activity of circRNA-CREIT.
[0070] Specifically, overexpression of circRNA-CREIT in TNBC cell lines can significantly enhance the sensitivity of breast cancer cells to the chemotherapy drug doxorubicin, thereby achieving the purpose of treating breast cancer.
[0071] The present invention will be further described below with reference to specific examples, which are only intended to illustrate the present invention.
[0072] Any simple modification, equivalent change and modification made to the implementation mode according to the technical essence of the present invention shall fall within the scope of the technical solution of the present invention.
[0073] In the following examples, the materials, reagents, plasmids, special kits, etc. used were obtained from commercial sources unless otherwise specified.
[0074] Example
[0075] (1) Experimental materials and procedures
[0076] 1) Cell culture and passaging
[0077] Breast cancer cell lines MDA-MB-231, MDA-MB-468, and HS578T were cultured in complete DMEM supplemented with 10% fetal bovine serum and 100 U / ml penicillin-streptomycin. MDA-MB-436, MCF-7, ZR-75-1, ZR-75-30, and SKBR3 were cultured in complete RPMI-1640 supplemented with 10% fetal bovine serum and 100 U / ml penicillin-streptomycin. All cells were cultured in a 37°C incubator containing 5% CO2. For cell passaging, adherent cells were digested with EDTA-trypsin, digested with complete medium, centrifuged at 800 rpm for 5 minutes, the supernatant discarded, and the cell pellet resuspended in complete medium. The pellet was then added to a clean, sterile culture dish and cultured.
[0078] 2) Extraction of total cell RNA and real-time quantitative PCR experiments
[0079] Total cellular RNA was extracted using RNA-easy separation solution from Nanjing Novozymes, and the experimental operation was performed according to the manufacturer's instructions. The purity, integrity, and concentration of the extracted RNA were detected using the NanoDrop 2000 instrument of the American Thermo Fisher Scientific brand. 500 ng of total cellular RNA was used for reverse transcription experiments, and the kit used in this experiment was the PrimeScript reverse transcription kit of the Takara brand. The real-time quantitative PCR experiment used the Light Cycler480II real-time quantitative PCR instrument of Roche and the SYBR Premix Ex TaqII kit of Takara. The primer sequences used in this experiment are shown in Table 1 below (β-Actin was used as an internal reference):
[0080] Table 1
[0081]
[0082] 3) Extraction of RNA from breast cancer tissue and real-time quantitative PCR experiment.
[0083] Remove the breast cancer surgical specimen from the -80°C freezer and cut the tissue into 3-4 mm pieces on ice. Place the fragments in a clean, RNase-free Eppendorf tube. Add approximately 500 μL of RNA-easy extraction reagent to the tube and add two grinding beads. Place the tube in a -30°C freezer grinder and grind for 60 seconds, then 30 seconds. Secure the grinder lid and start the grinding process. Grind approximately 5-8 times until the tissue is homogenized. Tissue RNA extraction and real-time quantitative PCR follow the same procedures as for cellular RNA extraction.
[0084] 4) PCR experiments and Sanger sequencing
[0085] To verify the sequence of circRNA-CREIT in triple-negative breast cancer cells, we performed Sanger sequencing. First, using cDNA obtained by reverse transcription of total RNA from MDA-MB-231 cells as a template, we amplified the DNA fragment near the specific reverse splicing site of circRNA-CREIT using circRNA-CREIT-specific primers (see Table 1) and the ApexHF HS DNA Polymerase FS premixed PCR kit from Aikerui Biotechnology Co., Ltd. The DNA fragment was then purified and extracted using the DNA purification and recovery kit from Tiangen Biochemical Technology Co., Ltd. After determining the concentration and purity, the DNA fragment was sent to Boshang Biotechnology Co., Ltd. for Sanger sequencing.
[0086] 5) Chemosensitivity testing of breast cancer cells
[0087] To examine the effect of circRNA-CREIT on the sensitivity of triple-negative breast cancer to doxorubicin (DOX), we performed an MTT assay. First, a certain number of triple-negative breast cancer cells were seeded into a 96-well cell culture plate. After 24 hours of culture, the culture medium was replaced with complete culture medium supplemented with varying concentrations of DOX, 100 μl per well, and culture continued for 48-72 hours. 20 μl of 5 mg / ml MTT solution was added, and after incubation at 37°C for 4-6 hours, the culture medium was carefully aspirated and discarded. Then, 100 μl of dimethyl sulfoxide solution was added, and the culture plate was gently tapped until the blue-purple crystals were completely dissolved. The absorbance of each well at 490 nm was measured in a microplate reader.
[0088] 6) Data statistics and analysis
[0089] Statistical analysis was performed using GraphPad Prism V8.3.0, and data are presented as mean ± standard deviation. Unpaired two-tailed Student's t-tests were used to compare differences in gene expression in tissues or cells between different groups. Kaplan-Meier curves and the log-rank test were used to compare the survival rates of patients with high and low expression of the circRNA CREIT. In our study, p < 0.05 was considered statistically significant.
[0090] (2) Experimental results and discussion
[0091] By searching the online database Circinteractome, we found that circRNA-CREIT is composed of exons 6 and 7 of the SPIDR gene. Using the UCSC genome browser, we found that its sequence is well conserved among different species ( Figure 1Real-time quantitative PCR experiments showed that the expression of circRNA-CREIT in breast cancer tissues was significantly lower than that in surrounding normal tissues ( Figure 2 ), and the Kaplan-Meier survival curve showed that the overall survival rate of breast cancer patients with high expression of circRNA-CREIT in breast cancer tissue was significantly better than that of patients with low expression of circRNA-CREIT ( Figure 3 In addition, we found that the expression of circRNA-CREIT in TNBC subtype cells was significantly lower than that in non-TNBC subtype cells ( Figure 4 ), which suggests that circRNA-CREIT may have a potential regulatory role in the progression of TNBC. To further verify the expression of circRNA-CREIT in TNBC cells, we used the cDNA of MDA-MB-231 cells as a template and performed PCR experiments with circRNA-CREIT specific primers. The PCR products were then subjected to Sanger sequencing. By analyzing the sequencing results, we confirmed the reverse splicing site of circRNA-CREIT ( Figure 5 ). Next, we used MTT experiments to find that circRNA-CREIT overexpression can significantly enhance the sensitivity of TNBC cells to the chemotherapy drug doxorubicin ( Figure 6 ).
[0092] In this study, we discovered for the first time that circRNA-CREIT is abnormally expressed in breast cancer, particularly TNBC, and revealed its potential as a novel prognostic factor and biomarker for breast cancer. Furthermore, we demonstrated for the first time that enhancing circRNA-CREIT expression may be an effective means of improving TNBC's sensitivity to chemotherapy, which has important clinical and socioeconomic implications.
[0093] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.
Claims
1. Application of substances for detecting circRNA-CREIT expression levels in the preparation of products for the prognosis assessment of triple-negative breast cancer.
2. The use according to claim 1, characterized in that The triple-negative breast cancer prognosis assessment includes assessing the survival of patients with triple-negative breast cancer.
3. The use according to claim 2, characterized in that The survival period includes overall survival.
4. The use according to claim 1, characterized in that The substance for detecting the expression level of circRNA-CREIT is a substance for quantitatively detecting the expression level of circRNA-CREIT in a sample to be tested.
5. The use according to claim 4, characterized in that The sample to be tested is breast cancer cells or tissues of the subject; The subject is a patient with triple-negative breast cancer.
6. The use according to claim 1, characterized in that The substance for detecting the expression level of circRNA-CREIT in the sample to be tested is one or more selected from gene amplification primers, probes, and gene chips.
7. The use according to claim 6, characterized in that The gene amplification primers are shown in SEQ ID NO. 2-3.
8. A system for breast cancer prognosis assessment, characterized in that: The system comprises: i) an analysis module, the analysis module comprising a detection substance for determining the expression level of circRNA-CREIT in a test sample of a subject, and; ii) an evaluation module, comprising determining the prognosis of the subject based on the expression level of the circRNA-CREIT determined in i); The subject is a patient with triple-negative breast cancer, the sample to be tested includes breast cancer cells or tissues of the breast cancer patient, and the prognosis includes evaluating the survival period of the breast cancer patient; the survival period includes overall survival; The prognosis of the subject is determined as follows: when the circRNA-CREIT is highly expressed, it indicates that the subject has a better prognosis and a longer overall survival period; otherwise, it indicates that the subject has a poor prognosis and a shorter overall survival period.
Citation Information
Patent Citations
CircRNA marker for breast cancer metastasis and / or prognosis and application
CN114015774A