Rpa-cas12a detection system and application thereof in detection of liver and pancreatic necrosis disease

Abstract

This invention discloses an RPA-Cas12a detection system and its application in the detection of hepatopancreatic necrosis disease (AHPND). The system includes a Cas12a premix and primers and reagents for amplifying RPA products. The Cas12a premix comprises ssDNA, Cas12a, and crRNA; the ssDNA is a single-stranded DNA modified at both ends with a fluorescent group FAM and a quenching group BHQ1, respectively; the crRNA is a guide RNA sequence that guides Cas12a to target and recognize AHPND RPA products. This invention combines the high amplification performance of RPA with the high specificity of CRISPR-Cas12a to construct an RPA-CRISPR detection method, which exhibits high sensitivity and good stability, providing a highly sensitive, accurate, and stable on-site detection method for AHPND in aquaculture industries such as shrimp and crab farming.

Description

Technical Field

[0001] This invention pertains to rapid on-site detection of important aquatic diseases, specifically involving an RPA-Cas12a detection system and its application in the rapid on-site detection of hepatopancreatic necrosis, an important infectious disease in aquaculture. Background Technology

[0002] Hepatopancreatic necrosis disease (AHPND) is a serious infectious disease that severely threatens the aquaculture industry. It is commonly found in farmed shrimp, crabs, and other aquatic animals. Animals infected with AHPND show symptoms quickly, typically developing clinical symptoms and spreading rapidly within 25-30 days of stocking, with mortality rates reaching 100% within less than a week. Since its initial discovery in 2009, it has caused enormous economic losses to the aquaculture industry. Treatment options for AHPND-infected shrimp are very limited; minimizing losses largely depends on early diagnosis, followed by the disposal of infected shrimp and disinfection of the aquaculture environment. Therefore, developing rapid on-site detection methods for AHPND is crucial.

[0003] Several detection methods for AHPND have been reported, including nested PCR, quantitative real-time PCR, LAMP, RPA-nfo-based lateral flow test strips, and RPA-exo-based fluorescence methods. However, these methods all have certain limitations. For example, nested PCR and quantitative real-time PCR require thermal cycling equipment, making them highly dependent on laboratories and skilled operators, and unsuitable for on-site testing. Furthermore, LAMP-based detection methods require a precise temperature of 65°C, demanding high instrument temperature accuracy and prone to false positives. Recombinase polymerase isothermal amplification (RPA) is a popular technique developed in recent years for on-site detection, offering strong amplification performance, an optimal reaction temperature of 37-42°C, and low equipment dependence. However, RPA-nfo-based lateral flow test strips and RPA-exo-based fluorescence methods require expensive specific probes, resulting in high detection costs. The reaction signal originates from probe cleavage, leading to complex and unstable systems. Therefore, there is a need to establish a rapid on-site detection method that is inexpensive, simple in system, highly sensitive, and stable. Summary of the Invention

[0004] Objective: To address the problems existing in current technologies, this invention provides an RPA-Cas12a detection system. This system leverages the advantages of RPA technology in on-site detection method development, combining the high amplification performance of RPA with the high specificity of CRISPR-Cas12a to establish an RPA-CRISPR detection system. The detection signal originates from the fluorescence signal generated by Cas12a specifically recognizing the RPA amplicon and cleaving ssDNA in the system. This system adds specific recognition and signal amplification steps to nucleic acid amplification, providing a highly sensitive, accurate, and stable AHPND on-site detection system for aquaculture industries such as shrimp and crab farming. It effectively avoids dependence on RPA-specific probes while adding a CRISPR-Cas12a recognition step, improving detection sensitivity. This system is simpler and more stable, making it suitable for application to the detection of other target genes.

[0005] This invention also provides the application of the RPA-Cas12a detection system in the rapid on-site detection of hepatopancreatic necrosis, an important infectious disease in aquaculture.

[0006] Technical Solution: To achieve the above objectives, the present invention provides an RPA-Cas12a detection system, comprising a Cas12a premix and primers and reagents for amplifying RPA products. The Cas12a premix comprises ssDNA, Cas12a, and crRNA. The ssDNA is a single-stranded DNA with a fluorescent group FAM and a quenching group BHQ1 modified at both ends, respectively. The crRNA is a guide RNA sequence that can guide Cas12a to target and recognize AHPND RPA products.

[0007] The ssDNA sequence is 5'FAM-TTATT-3'BHQ1.

[0008] The crRNA sequence is UAAUUUCUACUAAGUGUAGAUAUUUUGCUAUCCAAUAUUCCA.

[0009] Preferably, the RPA product is formed by adding forward primer RPA-F and reverse primer RPA-R, A Buffer, and the DNA template of the sample to be tested to the reaction system, and finally adding B Buffer, mixing, and incubating. Both A Buffer and B Buffer are components of the RPA kit. Specifically, A Buffer provides the buffering conditions for the RPA reaction; B Buffer is magnesium acetate, used to initiate the RPA reaction, and the DNA template is DNA containing the AHPND pirB virulence gene.

[0010] Preferably, the sequence of RPA-F is CATCTTTGACGGAATTTAACCCTAACAAT; and the sequence of RPA-R is TAACTAAACCAATGTAATCATCTTTTGC.

[0011] The DNA template of the sample to be tested is a DNA template that may or may not contain a conserved sequence on the AHPND virulence gene pirB that distinguishes it from other species.

[0012] When the test sample is positive, the RPA product is a conserved sequence on the AHPND virulence gene pirB that is distinct from other species. In this case, the RPA product sequence is SEQ ID NO.1.

[0013] SEQ ID NO.1

[0014] ATGAGCCAGATATTGAAAACATTTGGGAACAATTACGTGACAGAATCCAAGATTTAGTAGATGAATCGATTATAGATGCCATCAATGGAATATTGGATAGCAAAATCAAAGAGACACGCGATAAAATTCAAGACATTAATGAGACTATCGAAAACTTCGGTTATGCTGCGGCAAAAGATGATTACATTGGTTTAGTTA

[0015] The RPA-Cas12a detection system includes a Cas12a premix solution comprising ssDNA with a final concentration of 250nM-500nM, Cas12a with a final concentration of 30nM-100nM, 1x NEB Buffer 2.1, 30-300nM, and DEPC water.

[0016] Preferably, the RPA-Cas12a detection system includes a Cas12a premix comprising ssDNA at a final concentration of 250 nM, Cas12a at a final concentration of 50 nM, 1x NEB Buffer 2.1, 30 nM crRNA, and DEPC water.

[0017] In this invention, there are no specific requirements for the volume ratio of Cas12a premix and RPA product. The principle of system configuration is to ensure that the final concentration of each component in the Cas12a reaction system is within the specified range.

[0018] The RPA-Cas12a detection system described in this invention is used for rapid on-site detection of hepatopancreatic necrosis, an important infectious disease in aquaculture.

[0019] The application of the RPA-Cas12a detection system described in this invention in the preparation of rapid on-site detection reagents for hepatopancreatic necrosis, an important infectious disease in aquaculture.

[0020] This invention proposes a field detection method for AHPND with high sensitivity, high accuracy, and good stability.

[0021] The rapid on-site detection method is as follows: Cas12a, ssDNA, and crRNA are incubated, and then RPA product is added. The reaction is carried out in a qPCR instrument at 20-48℃ for 80-100 min, with FAM fluorescence signal read once per minute. The RPA product is added to the reaction system with forward primer RPA-F, reverse primer RPA-R, A Buffer, and the DNA template of the sample to be tested, and finally B Buffer is added, mixed, and incubated.

[0022] Preferably, the rapid on-site detection method involves incubating Cas12a, ssDNA, and crRNA, then adding RPA products, and incubating the reaction in a qPCR instrument at 37°C for 90 minutes, reading the FAM fluorescence signal once per minute. 37°C is closest to human body temperature and is suitable for developing on-site detection methods.

[0023] This invention combines the high amplification performance of RPA technology with the specific recognition characteristics of CRISPR-Cas12a technology. The detection signal originates from the non-specific single-stranded DNA cleavage activity activated by Cas12a after specifically recognizing the RPA amplicon. This avoids the cumbersome screening process for RPA-specific probes, and the system is simpler, more stable, and suitable for application to the detection of other target genes. This invention utilizes RPA amplification technology to amplify a conserved DNA sequence on the AHPND virulence gene, and then uses CRISPR-Cas12a technology to target and cleave the RPA amplicon, simultaneously activating the non-specific ssDNA activity of Cas12a. This results in the cleavage of 5'FAM-TTATT-3'BHQ1 in the reaction system, generating a fluorescent signal.

[0024] This invention combines the high amplification performance of RPA technology with the specific recognition characteristics of CRISPR-Cas12a technology. The detection signal originates from the non-specific single-stranded DNA cleavage activity activated after Cas12a specifically recognizes the RPA amplicon. This avoids the cumbersome screening process for RPA-specific probes, and the system is simpler, more stable, and suitable for application to the detection of other target genes.

[0025] This invention is an application development of a rapid detection method for AHPND, a significant disease in aquaculture, combining the high amplification performance of RPA with the high specificity of CRISPR-Cas12a. It provides a rapid on-site detection method for AHPND, which improves sensitivity by an order of magnitude compared to RPA alone. The designed crRNA sequence in this method is specifically designed for AHPND, exhibiting high specificity.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0027] This invention combines the high amplification performance of RPA with the high specificity of CRISPR-Cas12a to establish an RPA-CRISPR detection system and construct an RPA-CRISPR detection method. The detection signal originates from the fluorescence signal generated by Cas12a's specific recognition of the RPA amplicon and subsequent cleavage of ssDNA in the system. Compared to existing detection technologies, this method adds specific recognition and signal amplification steps to nucleic acid amplification, increasing sensitivity from 10... 2 Upgraded to 10 1 This provides a highly sensitive, accurate, and stable on-site detection method for aquaculture industries such as shrimp farming and crab farming.

[0028] The RPA-Cas12a detection method of this invention is inexpensive, simple, highly sensitive, and stable, and does not rely on instruments or equipment. It is very suitable for on-site detection and helps reduce the economic losses caused by AHPND infection in aquaculture. Attached Figure Description

[0029] Figure 1 Schematic diagram of RPA-Cas12a for detecting AHPND;

[0030] Figure 2 The endpoint fluorescence values ​​generated by Cas12a nonspecific cleavage of ssDNA in each reaction tube under different crRNA guidance;

[0031] Figure 3 For RPA-Cas12a detection of AHPND specificity test;

[0032] Figure 4 Sensitivity test for AHPND detection using RPA-Cas12a. Detailed Implementation

[0033] The present invention will be further described below with reference to specific embodiments and accompanying drawings.

[0034] Unless otherwise specified, all materials and reagents used in the embodiments are commercially available.

[0035] The sample source was Vibrio parahaemolyticus, which caused AHPND in the examples. AHPND (Environmental isolates from Nantong, China, provided by Jiangsu Provincial Marine Fisheries Research Institute, Pei Wang; Chao Ma; Lei Liao; Junwei Yu; Longyu Yi; Yi Qiao; Xin Liu; Song Gao; Hui Shen; Qunwei Lu; Simultaneous visual diagnosis of acute hepatopancreatic necrosis disease and Enterocytozoon hepatopenaei infection in shrimp with duplex recombinase polymerase amplification, Journal of Fish Diseases, 2021. Summer, 44:1753-1763), and clinical samples used in the experiment were all from Jiangsu Provincial Marine Fisheries Research Institute (Nantong, China).

[0036] Vibrio parahaemolyticus (ATCC 17802), Vibrio harveyi (ATCC 43516), Vibrio cholerae (ATCC 14100), Vibrio alginolyticus (ATCC 17749), Vibrio splenium (MCCC 1A00057), Vibrio vulnificus (ATCC 27562), Vibrio mimicus (MCCC1A02602), and Vibrio scutellariae (MCCC 1A00057).

[0037] Reagents and instruments: RAA nucleic acid amplification reagent (basic type) was purchased from Hangzhou Zhongce Biotechnology Co., Ltd. (containing A Buffer and B Buffer); T7 High Yield RNA Transcription kit was purchased from Nanjing Novizan Biotechnology Co., Ltd. Cas12a (Cpf1) was purchased from NEB; TIANprep Mini Plasmid kit and Magnetic Universal Genomic DNA Kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.; Roche LightCycler 480 real-time PCR instrument was purchased from Roche Pharmaceuticals Shanghai Co., Ltd.

[0038] Example 1

[0039] 1. RPA primer and specific crRNA design

[0040] Based on the published RPA-nfo-based lateral flow test strip method (Pei Wang; Chao Ma; Lei Liao; Junwei Yu; Longyu Yi; Yi Qiao; Xin Liu; Song Gao; Hui Shen; Qunwei Lu; Simultaneous visual diagnosis of acute hepatopancreatic necrosis disease and Enterocytozoon hepatopenaei infection in shrimp with duplex recombinase polymerase amplification, Journal of Fish Diseases, 2021. Summer, 44:1753-1763), the target gene of AHPND was identified as pirB (GeneBank: NC_025152.1). The RPA primer sequences were referenced from the RPA-nfo reaction primer and probe sequences. Specific crRNA sequences were designed using Geneious software based on the RPA amplicon sequences. Primers were synthesized by General Biosystems (Anhui) Co., Ltd., and their sequences are shown in Table 1.

[0041] Table 1 Primer sequences

[0042]

[0043] 2. crRNA preparation and optimization

[0044] Based on the principle of in vitro transcription using T7 RNA polymerase, a T7 promoter-crRNA-transcription terminator sequence (TAATACGACTCACTATAGGG) was designed. TAATTTCTACTAAGTGTAGATGGAACAATTACGTGACAGAAT The protein (TCCATCTGTTTTCTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT) was synthesized by Universal Biotechnology and inserted into the pUC57 vector (purchased from Universal Biosystems (Anhui) Co., Ltd.) to obtain pUC57-crRNA1 (inserted between the two restriction sites BamHI and XhoI in the multiple cloning site region of the pUC57 plasmid), which was used for in vitro transcription of crRNA1.

[0045] Subsequently, using this plasmid as a template, two plasmids, pUC57-crRNA 2 and pUC57-crRNA 3, were constructed using molecular cloning technology for in vitro transcription of other crRNA sequences.

[0046] The sequences used for transcription in the two plasmids are: TAATACGACTCACTATAGGG TAATTTCTACTAAGTGT AGATGTAGATGAATCGATTATAGAT ATTCCATCTGTTTTCTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT and TAATACGACTCACTATAGGG TAATTTCTACTAAGTGTAGATATTTTGCTATCCAATATTCCA TTCCATCTGTTTTCTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT. pUC57-crRNA 3 corresponds to the crRNA used in this invention.

[0047] Subsequently, three linearized crRNA plasmids were prepared using the restriction endonuclease Xho I (all procedures were performed according to the reagent manufacturer's instructions). In vitro transcription was performed using the purified linearized pUC57-crRNA plasmid as a template. The reaction system was prepared according to the recommended system of the T7 High Yield RNA Transcription kit, and the reaction was carried out in a PCR instrument at 37°C for 16 hours. The crRNA was purified by phenol / chloroform extraction, and its concentration was determined by qubit 4. Finally, the crRNA was aliquoted and stored at -80°C.

[0048] 3. AHPND plasmid extraction and bacterial genomic DNA preparation

[0049] The AHPND standard plasmid was extracted from the bacterial suspension of Vibrio parahaemolyticus, which causes AHPND, and its name is pVPA3-1. The specific steps are as follows: Take 10 μl of glycerol bacterial suspension stored at -80℃ (Vibrio parahaemolyticus, which causes AHPND). AHPND The plating was streaked onto a solid medium containing alkaline peptone (1L deionized water containing 20g peptone, 20g sodium chloride, and 10g agar powder, pH 8.6±0.2), and then inverted in a 30°C incubator overnight. The next day, one single colony was picked and inoculated into 5mL of liquid alkaline peptone medium (1L deionized water containing 20g peptone and 20g sodium chloride, pH 8.6±0.2), and cultured at 200 rpm for 12 hours in a 30°C shaker. The pVPA3-1 plasmid was then extracted from the bacterial culture using a TIANprep Mini Plasmid kit, and finally eluted with 50μl of elution buffer to obtain the AHPND standard plasmid. The concentration was determined using a Nanodrop micro spectrophotometer, and used in subsequent Examples 2-4.

[0050] The bacterial genomic DNA used for specific experiments was prepared by boiling. The specific procedure is as follows: Take 1 ml of the logarithmic phase culture medium of each of the above bacteria (Vibrio parahaemolyticus (ATCC 17802), Vibrio harveyi (ATCC 43516), Vibrio cholerae (ATCC 14100), Vibrio alginolyticus (ATCC 17749), Vibrio splenium (MCCC 1A00057), Vibrio vulnificus (ATCC 27562), Vibrio mimicus (MCCC 1A02602), and Vibrio spp. (MCCC 1A00057), centrifuge at 8000 rpm for 5 min, add 200 μl of sterile water to resuspend, boil at 100℃ for 10 min, centrifuge at 13000g for 5 min, and take 1 μl of the supernatant as a template for subsequent Example 3.

[0051] 4. Clinical Sample Preparation

[0052] Shrimp tissue for clinical samples was sterilized with ethanol, and 1g was added to 9mL of PBS and homogenized using a handheld third-generation tissue homogenizer. Genomic DNA was extracted from the shrimp tissue using 10-50mg of the Magnetic Universal Genomic DNA Kit according to the instructions. The concentration of the purified genomic DNA was determined using a Nanodrop micro-spectrophotometer, which was used in Example 5.

[0053] Example 2

[0054] Construction of RPA-Cas12a Detection System and its Fluorescence Detection Method Based on CRISPR-Cas12a System

[0055] 1. RPA Nucleic Acid Amplification: The RPA amplification system was performed according to the instructions for use of the RAA Nucleic Acid Amplification Reagent (Basic Type). According to the kit, each 50 μl reaction system of RPA enzyme powder contained 400 nM forward primer (RPA-F) and reverse primer (RPA-R) (Table 1 in Example 1), 25 μl of A Buffer, and 1 μl of DNA template (AHPND plasmid, concentration 10). 6 (Copy), and finally add 2.5 μl of B Buffer to the centrifuge tube cap, and make up the remainder with DEPC water. Cap the tube, invert it to mix thoroughly, and centrifuge at low speed for 10 s. Incubate the reaction tube in a 37°C constant temperature metal bath for 30 min to obtain the RPA product, the sequence of which is SEQ ID NO.1.

[0056] 2. Construction of the RPA-Cas12a detection system: 20 μl of Cas12a premix solution included ssDNA (sequence 5'FAM-TTATT-3'BHQ1) at a final concentration of 250 nM, Cas12a at a final concentration of 50 nM, 1x NEB Buffer 2.1, and 30 nM crRNA (prepared in Example 1), and was brought to a final volume of 20 μL using DEPC water. Before the reaction, the 20 μl Cas12a premix solution was incubated at 25 °C for 10 min, and then 5 μl of RPA product was added to the reaction tube.

[0057] 3. CRISPR-Cas12a-based fluorescence detection method: Incubate 20 μl of the Cas12a premix prepared in step (2) at 25°C for 10 min, then add 5 μl of RPA product to the reaction tube, and incubate at 37°C for 90 min continuously, reading the FAM fluorescence signal once per minute. The presence or absence of AHPND can be determined based on the fluorescence signal. Subsequently, place the reaction tube under blue light and observe the fluorescence intensity of each reaction tube visually. The entire RPA-Cas12a detection principle for AHPND is as follows: Figure 1 As shown.

[0058] 4. Different crRNAs screen for Cas12a nonspecific ssDNA cleavage activity

[0059] Using the AHPND RPA product as a template, three crRNAs were tested to screen for the crRNA corresponding to the highest Cas12a nonspecific ssDNA cleavage activity. The specific steps are as follows: 20 μl of Cas12a premix solution included ssDNA (sequence 5'FAM-TTATT-3'BHQ1) at a final concentration of 250 nM, Cas12a at a final concentration of 50 nM, 1x NEB Buffer 2.1, and 30 nM crRNA 1 / 2 / 3 (prepared in Example 1). The 20 μl Cas12a premix solution was first incubated at 25°C for 10 min, and then 1 μl of the purified AHPND RPA product prepared in step 1 was added to the reaction tube. Finally, the reaction solution was placed in a qPCR instrument at 37°C for 60 min, with FAM fluorescence signals read once per minute. The Cas12a nonspecific ssDNA cleavage activity was determined based on the endpoint fluorescence values ​​of different reaction tubes. Subsequently, the reaction tubes were placed under blue light, and the fluorescence intensity of each reaction tube was observed visually. Fluorescence values ​​of each reaction tube and endpoint fluorescence results are as follows: Figure 2 The results showed that, compared with the other two crRNAs, Cas12a exhibited the highest nonspecific ssDNA cleavage activity under the guidance of crRNA3. This crRNA3 (UAAUUUCUACUAAGUGUAGAUAUUUUGCUAUCCAAUAUUCCA) was used as the crRNA in subsequent examples for further detection.

[0060] Example 3

[0061] Specificity testing of the RPA-Cas12a detection system and method

[0062] The method established in step (3) of Example 2 was applied to evaluate the specificity of the method by detecting several Vibrio species commonly found in shrimp farming.

[0063] AHPND plasmids and bacterial genomic DNA prepared according to step (3) of Example 1 were used to evaluate the specificity of the method established in this study.

[0064] RPA amplification was performed according to step (1) of Example 2, and the RPA products were detected for fluorescence according to step (3) of Example 2. The primers and reagents used for RPA amplification with genomic DNA of each bacterium as templates were the same as those in Example 2.

[0065] The results are as follows Figure 3 , Figure 3 Several common Vibrio species in shrimp farming, including Vibrio parahaemolyticus (ATCC 17802), Vibrio harveyi (ATCC 43516), Vibrio cholerae (ATCC 14100), Vibrio alginolyticus (ATCC 17749), Vibrio splenium (MCCC 1A00057), Vibrio vulnificus (ATCC 27562), Vibrio mimicus (MCCC 1A02602), and Vibrio spp. (MCCC1A00057), were used to prepare corresponding genomic DNA according to step (3) of Example 1. The RPA-Cas12a method established in this invention was then used for detection. The fluorescence curves corresponding to different templates are shown in the left figure, and the endpoint fluorescence of each reaction tube under blue light is shown in the right figure. The established RPA-Cas12a method can only detect AHPND; other similar bacteria cannot be detected, indicating that the method has good specificity.

[0066] Example 4

[0067] Sensitivity Testing of RPA-Cas12a Detection System and Method

[0068] The need for early detection of AHPND in aquaculture has driven the demand for highly sensitive detection technologies. The method established in step (3) of Example 2 was applied to detect AHPND at 10-fold serial dilutions. 0 -10 4 The sensitivity of this method was evaluated by using copies / μl of AHPND standard plasmid.

[0069] Specifically, the AHPND standard plasmid was extracted according to step (3) of Example 1, and its concentration was determined using Nanodrop. Then, the copy number was calculated based on the plasmid size of 69168 bp. The plasmid was then serially diluted 10-fold to prepare 10 4 10 3 10 2 10, 10 0 AHPND standard plasmid copies / μl were prepared. RPA amplification was performed according to step (1) of Example 2, and the RPA product was subjected to fluorescence detection according to step (3) of Example 2.

[0070] The results are as follows Figure 4 , Figure 4 The AHPND standard plasmid was serially diluted 10-fold to prepare 10 4 10 3 10 2 10, 10 0 Copies / μl were tested according to the RPA-Cas12a method established in this invention. The fluorescence curves corresponding to different templates are shown in the left figure, and the endpoint fluorescence of each reaction tube under blue light is shown in the right figure. The detection limit of the established RPA-Cas12a method is 10. 1 copies / μl.

[0071] Example 5

[0072] Comparison of RPA-Cas12a detection system and method with industry standard detection method nested PCR (AP4)

[0073] 1. The specific process of RPA-Cas12a is as follows: 22 shrimp hepatopancreatic tissues from 31 clinical samples were processed according to the method of step (4) in Example 1 above to prepare shrimp genomic DNA as DNA template samples for clinical tissues; the processing method for 9 pond water samples was as follows: 5 ml of water sample was taken, centrifuged at 6000g for 5 min to collect the precipitate. Then, the precipitate was resuspended in 100 μl of water and boiled at 100℃ for 10 min to serve as DNA template samples for clinical water samples.

[0074] Take 1 μl of the clinical sample DNA prepared according to the above steps as a template, and perform RPA amplification using step (1) of Example 2 (with the same primers and reagents). Prepare Cas12a premix according to step (2) of Example 2. Finally, use the method established in step (3) of Example 2 to test 22 shrimp hepatopancreas tissues and 9 aquaculture pond water samples from 31 clinical samples.

[0075] 2. AP4 method: Take 1 μl of the clinical sample DNA prepared according to the above steps as a template and perform PCR amplification using the AP4-1F and AP4-1R primer pairs in Table 1 (94℃, 3 min; [94℃, 30 s; 55℃, 30 s; 72℃, 90 s] 30 cycles; 72℃, 2 min). Then take 1 μl of the previous round PCR product as a template for the second round of PCR amplification (94℃, 3 min; [94℃, 30 s; 55℃, 30 s; 72℃, 30 s] 25 cycles; 72℃, 2 min). Perform agarose gel electrophoresis on the PCR product. If a 230 bp fragment (its sequence is as shown in SEQ ID NO.4) is present, it is positive.

[0076] SEQ ID NO.4

[0077] TTGAGAATACGGGACGTGGGGAGCTTACCATTCAATACCAATGGGGTGCGCCATTTATGGCTGGCGGCTGGAAAGTGGCTAAATCACATGTGGTACAACGTGATGAAACTTACCATTTACAACGCCCTGATAATGCATTCTATCATCAGCGTATTGTTGTAATTAACAATGGCGCTAGTCGTGGTTTCTGTACAATCTATTACCACTAAGAAGGTGCTCACATGACTAAC

[0078] Using the method established in step (3) of Example 2 above, 31 clinical samples (22 shrimp hepatopancreas tissues and 9 aquaculture pond water samples) were tested and compared with the industry standard detection method nested PCR (AP4), and three independent replicate experiments were performed.

[0079] The results showed that the actual detection results of the two methods were completely consistent (Table 2).

[0080] Table 2 Clinical Sample Detection

[0081]

[0082]

Claims

1. The application of an RPA-Cas12a detection system in the preparation of a rapid, accurate, and stable on-site detection reagent for hepatopancreatic necrosis, an important infectious disease in aquaculture; the application is as follows: Cas12a, ssDNA, and crRNA are incubated, then RPA products are added, and the reaction is carried out in a qPCR instrument at 20-48℃ for 80-100 min, with FAM fluorescence signals read once per minute; The RPA-Cas12a detection system includes a Cas12a premix and primers and reagents for amplifying RPA products. The Cas12a premix includes ssDNA, Cas12a, and crRNA. The ssDNA is a single-stranded DNA modified at both ends with a fluorescent group FAM and a quenching group BHQ1, respectively. The crRNA is a guide RNA sequence that can guide Cas12a to target and recognize the AHPND RPA product. The RPA product is formed by adding forward primer RPA-F, reverse primer RPA-R, A buffer, and the DNA template of the sample to be tested to the reaction system, and finally adding B buffer, mixing, and incubating. A buffer provides the buffering conditions for the RPA reaction, and B buffer is magnesium acetate. The sequence of the ssDNA is 5'FAM-TTATT-3'BHQ1; The crRNA sequence is UAAUUUCUACUAAGUGUAGAUAUUUUGCUAUCCAAUAUUCCA; The sequence of RPA-F is ATGAGCCAGATATTGAAAACATTTGGGAAC; the sequence of RPA-R is TAACTAAACCAATGTAATCATCTTTTGC; The DNA template of the sample to be tested may or may not contain the AHPND virulence gene. pirB The DNA template with a conserved sequence that distinguishes it from other species; The Cas12a premix comprises ssDNA at a final concentration of 250 nM-500 nM, Cas12a at a final concentration of 30 nM-100 nM, 1x NEB Buffer 2.1, 30-300 nM crRNA, and DEPC water.

Images