Molecular marker for detecting soybean epidermal pubescence morphology and application thereof

Abstract

The application provides a molecular marker for detecting the epidermal hair morphology of soybean and an application thereof, and belongs to the technical field of molecular markers. The nucleotide sequence of the molecular marker is shown as SEQ ID NO:1. A primer set designed by the molecular marker comprises an upstream primer WUF / a downstream primer WUR and an upstream primer YOUF / a downstream primer YOUR, and the nucleotide sequences are shown as SEQ ID NO:2-5 in sequence. The molecular marker and the primer set can accurately and effectively identify the epidermal morphology of soybean, and provide a theoretical basis for the subsequent screening of excellent soybean varieties.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker for detecting the morphology of soybean epidermal hairs and its application. Background Technology

[0002] Soybean epidermal hairs play a crucial role in resisting adverse external environments, and their morphology is considered a domestication-related trait. Almost all wild soybeans have epidermal hairs that lie close to the leaves, hence the morphology of wild soybean epidermal hairs is oblique. In contrast, most cultivated soybeans have epidermal hairs that are at an angle to the leaves. Based on the angle of the epidermal hairs, the morphology of cultivated soybean epidermal hairs can be divided into semi-erect hairs or erect hairs. Current research indicates that decades ago, most soybeans had oblique epidermal hairs, but now at least 30% of soybeans have erect hairs, suggesting that the current soybean epidermal hairs are evolving towards an erect shape. Soybeans with erect epidermal hairs are better adapted to the current environment, have stronger stress resistance, and are more advantageous for agricultural production. Currently, the molecular regulatory mechanisms leading to different gene expression levels in soybeans with different epidermal hair morphologies remain unclear, and the molecular markers regulating soybean epidermal hair morphology have not yet been discovered. Summary of the Invention

[0003] This invention provides a molecular marker for detecting the morphology of soybean epidermal hairs and its application. The molecular marker provided by this invention can effectively identify the morphology of soybean epidermal hairs with inverted or erect hairs, which is beneficial for the screening of superior soybean varieties.

[0004] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0005] This invention provides a molecular marker for detecting the morphology of soybean epidermal hairs, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] The present invention provides a primer set for detecting the molecular marker of claim 1, the primer set comprising upstream primer WUF, downstream primer WUR, upstream primer YOUF, and downstream primer YOUR, the nucleotide sequences of which are shown in SEQ ID NO:2 to 5 in sequence.

[0007] The present invention provides a kit for detecting the morphology of soybean epidermal hairs, the kit containing one or two pairs of the primer set described above.

[0008] Preferably, the kit further includes gene extraction reagents and / or PCR amplification reagents.

[0009] This invention provides the application of the molecular marker, the primer set, or the kit in detecting the morphology of soybean epidermal hairs.

[0010] This invention provides a method for detecting the morphology of soybean epidermal hairs, comprising the following steps:

[0011] (1) Extract genomic DNA from soybean samples;

[0012] (2) Perform PCR amplification of the genomic DNA from step (1) using the primer set;

[0013] (3) Perform gel electrophoresis analysis on the amplification products. If the product amplified using WUF and WUR primers has a band of 266bp and the product amplified using YOUF and YOUR primers has no band, then the soybean epidermal hair morphology is backward hair; if the product amplified using WUF and WUR primers has no band and the product amplified using YOUF and YOUR primers has a band of 492bp, then the soybean epidermal hair morphology is upright hair.

[0014] Preferably, the PCR amplification reaction system comprises: 2 μL of 300 ng / μL genomic DNA template, 1 μL each of upstream and downstream primers, 10 μL of Taq PCR mix, and ddH2O added to a total volume of 20 μL.

[0015] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 58℃ annealing for 25 s, 72℃ extension for 8 s, for a total of 32 cycles; 72℃ extension for 5 min; and storage at 4℃.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The molecular markers provided by this invention can identify the epidermal hair morphology of soybeans with either upright or downward-pointing hairs, with high accuracy and specificity. Soybeans with upright hairs, as identified by this invention, demonstrate strong environmental adaptability and resilience. Attached Figure Description

[0018] Figure 1 A comparison of the Mao1 promoter sequences in soybeans with different epidermal hair morphologies.

[0019] Figure 2 Validation results of dual-luciferase activity assay (Figure A shows the schematic diagram of the vector construction used in the dual-luciferase activity assay, and Figure B shows the dual-luciferase activity assay results for the corresponding vector).

[0020] Figure 3 A one-hybrid plate image of a yeast library for screening AbA concentrations.

[0021] Figure 4 Results of yeast one-hybrid point-to-point experiment (Figure A shows the yeast one-hybrid point-to-point experiment, and Figure B shows the gel retardation electrophoresis experiment).

[0022] Figure 5The effect of GBP on Mao1 expression was verified by a dual-luciferase activity assay.

[0023] Figure 6 Electrophoresis images of samples with inverted and erect hair morphology amplified by two pairs of primers. Detailed Implementation

[0024] This invention provides a molecular marker for detecting the morphology of soybean epidermal hairs, the nucleotide sequence of which is shown in SEQ ID NO:1. The nucleotide sequence of the molecular marker of this invention is: GCAAAAGAAATTCAGAATGGAAGAGAGAATAATCAGAGAGGAAGAGAATTTTCATTCATCATACATCATGCCTATCACACTCCCACTACTTTCCCTTATACACTAGTGGGATTCCGTTATTTTCCAACTTGGTTTCTTCTCTCTCTTCCCACGTCCCAATTCCTCAAAATCAGCAAGTTTGTTATGCAATCCTCTCTCACTTGATGACTCAGCAGTATTGTTAACCTTCTCCCCACGTGACATTCCATTCGTTAC (SEQ ID NO:1). The molecular marker of this invention is derived from the Ty3 / Gypsy family retrotransposon in the promoter region of the soybean Mao1 gene. The nucleotide sequence of the Ty3 / Gypsy family retrotransposon of this invention is shown in SEQ ID NO:6.

[0025] This invention provides a primer set for detecting the aforementioned molecular marker. The primer set includes an upstream primer WUF and a downstream primer WUR, an upstream primer YOUF and a downstream primer YOUR, with nucleotide sequences as shown in SEQ ID NO: 2–5. The specific nucleotide sequences of the primer set of this invention are shown in Table 1. The primer set of this invention was developed based on the flanking sequence spanning the insertion site of the Mao1 promoter and the Ty3 / Gypsy retrotransposon. The primer set of this invention is used to determine whether the Mao1 promoter region contains the insertion of the Ty3 / Gypsy retrotransposon. Multiple copies of the RT300 or the Ty3 / Gypsy retrotransposon described in this invention exist in the soybean genome.

[0026] Table 1. Nucleotide sequences of the primer sets

[0027]

[0028] This invention provides a kit for detecting the morphology of soybean epidermal hairs, the kit comprising the aforementioned primer set. The kit also includes dNTPs, Taq DNA polymerase, and Mg... 2+At least one of the following: PCR reaction buffer.

[0029] This invention provides a method for detecting the morphology of soybean epidermal hairs, comprising the following steps: (1) extracting genomic DNA from a soybean sample; (2) performing PCR amplification on the genomic DNA from step (1) using the primer set described in claim 2; (3) if the product amplification using WUF and WUR primers produces a band of 266 bp, and the product amplification using YOUF and YOUR primers produces no band, then the soybean epidermal hair morphology is inverted hairs; if the product amplification using WUF and WUR primers produces no band, and the product amplification using YOUF and YOUR primers produces a band of 492 bp, then the soybean epidermal hair morphology is upright hairs. The PCR amplification reaction system of this invention comprises: 2 μL of 300 ng / μL genomic DNA template, 1 μL each of upstream and downstream primers, 10 μL of Taq PCR mix, and ddH2O added to a total volume of 20 μL. The PCR amplification reaction program of this invention is as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 25 s, annealing at 58℃ for 25 s, extension at 72℃ for 8 s, for a total of 32 cycles; extension at 72℃ for 5 min; and storage at 4℃. Genomic DNA is extracted from samples using the CTAB method. The two primer pairs in the primer set described in this invention are used for PCR amplification.

[0030] This invention provides the application of the molecular markers, primer sets, or kits described herein in the detection of soybean epidermal hair morphology. The molecular markers, primer sets, or kits described herein exhibit high accuracy and specificity in identifying soybean epidermal hair morphology; multiple verification experiments have confirmed their ability to identify the epidermal hair morphology of samples.

[0031] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0032] The technical solutions of this invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0033] Example 1

[0034] 1. Alignment of Mao1 promoter sequence in soybeans with different epidermal hair morphologies

[0035] The promoter region of the Mao1 gene in six soybeans with different epidermal hair morphologies (C02, C08, and C14 are soybeans with erect hairs, while C11, W01, and W02 are soybeans with inverted hairs) was compared using BioEdit software. The comparison results are as follows: Figure 1As shown in the figure, the location indicated by the black arrow is a large 5kb fragment insertion (abbreviated by the arrow due to the length of the sequence). This alignment result shows that, compared to the inverted hairy soybean variety, the Mao1 promoter region of the upright hairy soybean variety contains a large fragment insertion. Blast analysis using this large fragment sequence in the NCBI database revealed that the fragment is a Ty3 / Gypsy family retrotransposon, and its nucleotide sequence is shown in SEQ ID NO:6.

[0036] 2. Verification of the difference in Mao1 expression caused by the insertion of the Ty3 / Gypsy retrotransposon

[0037] The activity of different types of promoters was verified by using the Mao1 promoter sequence with or without the Ty3 / Gypsy retrotransposon sequence in a dual-luciferase activity assay.

[0038] The 1.7kb and 2.0kb promoter sequences of Mao1 were amplified by PCR using genomic DNA from soybean varieties with upright hairs (Qihuang 34) and those with downward-growing hairs (Jidou 17). These promoter sequences were then ligated into the pGreen II-0800-Luc plasmid to construct dual-luciferase reporter vectors, which were named Dao-1.7, Li-1.7, Dao-2.0, and Li-2.0, respectively. Figure 2 A). Dao-1.7 and Li-1.7 are the 1.7kb promoter sequences of the Mao1 gene in *Soybean simulans* (both pubescent and upright), respectively. Neither sequence contains the Ty3 / Gypsy retrotransposon sequence; they only contain multiple Indels and SNP differences. Dao-2.0 and Li-2.0 are the 2.0kb promoter sequences of the Mao1 gene in *Soybean simulans* (both pubescent and upright), respectively. The Dao-2.0 sequence does not contain the Ty3 / Gypsy retrotransposon sequence, while the Li-2.0 sequence includes a 255bp Ty3 / Gypsy retrotransposon sequence, specifically bp 5006 to 5260 of the aforementioned Ty3 / Gypsy retrotransposon sequence. This sequence is named RT255. Figure 2 The black area in A represents the region of interest. Dual-luciferase assay results showed no difference in promoter activity between Dao-1.7 and Li-1.7, indicating that the Indel and SNP in the 1.7kb promoter do not lead to differences in downstream gene expression levels. Figure 2 B). The Li-2.0 promoter activity was significantly higher than that of Dao-2.0, indicating that the 255bp sequence on the Ty3 / Gypsy retropox in the 2.0kb promoter of the Mao1 gene in soybean significantly increases the expression of downstream genes. Figure 2 B).

[0039] 3. Identification of GBP gene expression in the Mao1 gene regulated by the RT255 sequence

[0040] 3.1 Using the RT255 sequence selected in step 2 as a bait sequence, a one-hybrid screening of the soybean cDNA yeast library was performed (according to the Clontech manual). The specific steps are as follows:

[0041] (1) PCR amplification of the RT255 sequence.

[0042] (2) Using homologous recombination, RT255 was ligated to the pBait-AbAi vector (prokaryotic resistance was ampicillin). First, the vector was linearized. The linearization enzyme digestion system was as follows: total volume 50 μL, 10×CutSmart Buffer 5 μL, KpnI 1 μL, XhoI 1 μL, pBait-AbAi (1000 ng / μL) 2 μL, dd H2O 41 μL. The fragment was then homologously recombinated with the vector to form a bait vector.

[0043] (3) The constructed bait vector was linearized by single-enzyme digestion with BbsI restriction enzyme, and the linearized vector was recombined into the Y1HGold yeast genome to complete the construction of the bait yeast strain. The specific steps are as follows:

[0044] A. Dilute the Y1HGold strain and spread it on YPD solid medium for activation, then incubate it upside down at 30°C for 2 days.

[0045] B. Pick a single colony from the plate and incubate overnight at 30°C and 220 rpm with gentle shaking. Transfer the incubated culture to 50 ml of YPD liquid medium and adjust the OD value to 0.15. Incubate the OD-adjusted culture at 30°C and 220 rpm for 3-4 hours until the OD reaches between 0.4 and 0.6. It is important to note that yeast produces gas, so sealed centrifuge tubes or similar containers should not be used for incubation.

[0046] C. Transfer the yeast to centrifuge tubes for enrichment, centrifuge at 6000 rpm for 5 min, remove the supernatant, and resuspend the bacterial culture in 50 mL of sterile water. After enriching the bacterial culture by centrifuging at 6000 rpm for 5 min, remove the supernatant again.

[0047] D. Add an appropriate amount of 1×TE / LiAc (10×TE:10×LiAc:H2O=1:1:8) to 100μL of competent yeast for each reaction and place on ice for later use.

[0048] E. Boil the carrier DNA at 100°C for 20 minutes and set aside, then freeze quickly on ice.

[0049] F. Take 1 μg of linearized bait plasmid and mix it with 10 μL of carrier DNA, then add it to 100 μL of competent yeast cells and mix thoroughly.

[0050] G. Add 600 μL of PEG / LiAc / TE (50% PEG: 10×TE: 10×LiAc = 8:1:1) to the competent cells and mix thoroughly.

[0051] H. Incubate the mixed yeast at 30°C and 220 rpm for 30 min on a shaker. Add 70 μL of DMSO to the yeast, mix well, and heat shock in a 42°C water bath for 15 min. After heat shock, place on ice for 2 min to complete the transformation and yeast genome recombination.

[0052] I. Centrifuge at 12000 rpm for 30 s to remove supernatant, resuspend yeast in 500 μL 1×TE and spread 100 μL on a single-celled SD / -Ura culture plate and incubate upside down at 30 °C for 3 days.

[0053] (4) After the bait yeast produced single colonies, the background expression level of AbA in the yeast strains was detected to determine the selection concentration of AbA (basidiomycin A) in the screening library. The specific method is as follows: The single colonies of the bait yeast strains were diluted with 100 μL of sterile water and spread on Ura single-cell culture plates containing 100 μg / mL, 200 μg / mL, 300 μg / mL, 400 μg / mL, 500 μg / mL, and 600 μg / mL, respectively, and incubated upside down at 30℃ for 3 days. After the culture was completed, the AbA concentration at which no yeast colonies were found was used as the screening concentration. In this study, the AbA concentration of 500 μg / mL was selected to ensure strong interaction. Note that the AbA powder needs to be dissolved in ethanol to prepare a 500 μg / mL stock solution first.

[0054] (5) After completing the construction and self-activation verification of the bait yeast, a yeast single-hybrid screening library was performed. The specific steps are as follows:

[0055] A. Preparation of competent bait yeast cells according to the above-described yeast competent cell preparation steps.

[0056] B. Take 5 μg of cDNA library plasmid and 20 μL of carrier DNA, mix them thoroughly, and then add them to 600 μL of bait yeast competent cells. Mix thoroughly by large-scale shaking.

[0057] C. Add 2.5 mL of PEG / LiAc / TE (50% PEG: 10×TE: 10×LiAc = 8:1:1) and shake vigorously.

[0058] D. Let stand in a 30℃ water bath for 45 minutes, and mix once every 15 minutes.

[0059] E. Add 160 μL of DMSO and mix gently.

[0060] Let it stand in a 42℃ water bath for 20 minutes, stirring every 10 minutes. After that, place it on ice for 2 minutes.

[0061] G. Centrifuge at 3000 rpm for 5 min to remove the supernatant and resuspend in 10 ml of LYPD liquid.

[0062] Incubate at 30℃ in a shaker at 220 rpm for 90 min.

[0063] I. Resuspend the yeast in 3-6 mL of 1×TE solution and spread 200 μL onto a 15 cm diameter SD / -Ura / -Leu bivalve plate. Incubate upside down at 30 °C for 3-5 days.

[0064] J. Sequencing of the capture plasmids from surviving yeast strains to determine the DNA sequences of the interacting proteins.

[0065] like Figure 3 The RT255 sequence self-activation activity test results showed that 100 ng / μl of AbA (acupuncture point A) was sufficient to inhibit the background self-activation activity of RT255. To ensure the screening of transcription factors that strongly interact with RT255, an AbA concentration of 300 ng / μl was selected as the screening threshold concentration. Nine cDNA sequences that strongly interact with RT255 were ultimately screened, six of which were partial sequences of the Glyma.09G170400 gene. However, Glyma.09G170400 encodes a GAGA-binding protein that can bind to GA repeat sequences. It is a transcription factor of the soybean chlorophyll and heme synthase gene Gsa1, known as the GBP gene, and its nucleotide sequence is shown in SEQ ID NO:7.

[0066] 3.2 To further confirm that the GBP gene can bind to the RT255 sequence, yeast one-hybrid point-to-point experiments were performed using a high-GA-content sequence (GAER) on the RT255 sequence as a probe. Figure 4 A) and gel retardation electrophoresis experiment ( Figure 4 B). Experimental results all showed that GBP can bind to the GAER sequence on the Ty3 / Gypsy retrotransposon.

[0067] The steps for a yeast one-hybrid point-to-point experiment are as follows:

[0068] RT255 and GAER sequences were amplified by PCR to serve as bait sequences. The DNA sequence was ligated to the bait vector pLacZi (ampicillin-resistant) using homologous recombination. The enzyme digestion system was as follows: total volume 50 μL, 10×CutSmart Buffer 5 μL, SalI 1 μL, XhoI 1 μL, pLacZi (1000 ng / μL) 2 μL, dd H2O 41 μL.

[0069] The CDS sequence of GBP was amplified by PCR to obtain the capture protein sequence. The DNA sequence was ligated to the capture vector pB42AD (ampicillin-resistant) using homologous recombination. The enzyme digestion system was as follows: total volume 50 μL, 10×CutSmart Buffer 5 μL, EcoRI 1 μL, XhoI 1 μL, pB42AD (1000 ng / μL) 2 μL, dd H2O 41 μL.

[0070] The constructed capture plasmid and bait plasmid were co-transformed into the EGY48 yeast strain. Co-transformation can be performed directly without linearizing the plasmid. The transformed yeast strain was plated on SD / -Ura / -Trp dual-deficiency plates and incubated upside down at 30°C for 2-3 days. Single yeast colonies were picked, diluted with 10 μL of sterile water, and pipette-dropped onto X-Gal chromogenic plates (X-Gal can be added to the plate or added directly to the yeast colonies after they have grown).

[0071] 3.3 The Li-2.0 prepared in step 2 was used as a reporter vector to verify whether GBP binds to the Li-2.0 sequence and increases the expression level of downstream genes. Dual-luciferase activity assays showed that GBP significantly increased the expression level of downstream genes of the Mao1 gene. Figure 5 ).

[0072] The steps for the dual-luciferase activity assay are as follows:

[0073] (1) Mix 200 μL of extracted protoplasts with 4 μg of plasmid (divided into two groups, one group with 62sk empty vector + Li-1.7 and the other group with 62sk-GBP + Li-1.7) evenly, and add 220 μL of PEG-Ca 2+ Transfection solution.

[0074] (2) Repeat the above cell mixture by gently inverting it several times to mix it evenly, and place it in a dark place at room temperature for 10 minutes to complete the transformation.

[0075] (3) Add 1 mL of W5 solution to the transformed protoplasts to stop the reaction and centrifuge at 100 g for 3 min. It is worth noting that the centrifuge setting should be adjusted to 0.

[0076] (4) Use a pipette to remove as much of the supernatant of the centrifuged solution as possible.

[0077] (5) Resuspend the cells in 1 mL of W5 solution and incubate at room temperature in the dark for 16 h.

[0078] (6) After the cells have been cultured, place them in a centrifuge at 100g for 3 minutes and use a pipette to remove as much of the supernatant as possible. Add an appropriate amount of lysis buffer to the protoplasts and vortex to break the cells.

[0079] (7) The disrupted cells can be used for LUC activity assay. First, add 100 μL of Luciferase substrate to the disrupted cells, mix well, and measure the signal intensity of firefly luciferase. Then, add 100 μL of Stop&Glo TM The reagent was used to detect the fluorescence signal intensity of the internal reference Renal luciferase.

[0080] The above experimental results indicate that the RT255 sequence regulates the initiation of GBP transcription factors to promote the expression of the Mao1 gene.

[0081] 4. Primer design and result evaluation criteria

[0082] The above steps confirm that the Mao1 gene promoter region in tufted soybean contains the insertion of the Ty3 / Gypsy retrotransposon, which recruits GBP transcription factors to promote Mao1 expression, leading to the tufted phenotype. Conversely, the Mao1 gene promoter region in drooping soybean lacks the Ty3 / Gypsy retrotransposon insertion, resulting in lower Mao1 expression levels and thus the drooping phenotype. Therefore, based on the flanking sequences across the insertion site of the Mao1 promoter and the Ty3 / Gypsy retrotransposon, two primer pairs were developed to determine the presence of the Ty3 / Gypsy retrotransposon in the Mao1 promoter region. The primer sequences are shown in Table 2.

[0083] Table 2. Nucleotide sequences of the primer sets

[0084]

[0085] PCR amplification of genomic DNA templates using WUF and WUR primers should produce a band size of 266 bp if the Mao1 promoter region lacks the Ty3 / Gypsy retrotransposon; otherwise, no band should be observed. Similarly, PCR amplification of genomic DNA templates using YouF and YouR primers should produce a band size of 492 bp if the Mao1 promoter region contains the Ty3 / Gypsy retrotransposon; otherwise, no band should be observed.

[0086] Example 2: Application of molecular markers in identifying soybean epidermal hair morphology

[0087] 1. Extract genomic DNA from the sample

[0088] Using *Ji Dou 17* (with inverted hairs) and *Qi Huang 34* (with erect hairs) as samples, fully expanded trifoliate leaves were harvested and their epidermal hair morphology was identified. The CTAB method was used for extraction, and the steps are as follows:

[0089] (1) Take an appropriate amount of leaves, put them into a 2ml centrifuge tube and add a 6mm steel ball. After pre-cooling with liquid nitrogen for 3 minutes, grind them at 1300rpm for 2 minutes using a vibratory grinder.

[0090] (2) Add 1 ml of CTAB (containing 2% β-mercaptoethanol) to the ground sample tube, vortex to mix, and then place it in a 65℃ oven for pyrolysis for 30 min. During this period, manually and gently flip the tube up and down 8 times every 10 min.

[0091] (3) Remove the sample from the oven and cool it to room temperature. Then add 500 μL of Tris-saturated phenol and 500 μL of chloroform / isoamyl alcohol (24:1). Place the sample on a horizontal shaker and shake at 150 rpm for 10 min, then centrifuge at 12000 rpm for 10 min.

[0092] (4) After centrifugation, transfer 600 μL of the supernatant to a new 2 mL centrifuge tube and add 600 μL of chloroform / isoamyl alcohol (24:1). Place the sample on a horizontal shaker and shake at 150 rpm for 10 min, then centrifuge at 12000 rpm for 10 min.

[0093] (5) After centrifugation, transfer 400 μL of supernatant to a 1.5 mL centrifuge tube and add 50 μL of 3M sodium acetate and 800 μL of pre-cooled 100% ethanol. Mix well and let stand at -20°C for 1 h or overnight to precipitate.

[0094] (6) Centrifuge at 12000 rpm for 2 min, discard the supernatant and wash twice with 70% ethanol.

[0095] (7) Place the cleaned DNA in a fume hood to air dry for 1 hour. After the remaining ethanol has evaporated, add 50-100 μL of distilled water to dissolve the DNA and store it in a -40°C refrigerator.

[0096] 2. PCR amplification

[0097] The WU and YOU primer pairs in Table 2 were used to amplify the DNA from the two samples extracted in step 1. The PCR amplification reaction system was as follows: 2 μL of 300 ng / μL genomic DNA template, 1 μL each of the upstream and downstream primers, 10 μL of Taq PCR mix, and ddH2O added to a total volume of 20 μL. The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 58℃ annealing for 25 s, 72℃ extension for 8 s, for a total of 32 cycles; 72℃ extension for 5 min; and storage at 4℃.

[0098] 3. Gel electrophoresis analysis

[0099] The amplification products were recovered and analyzed by gel electrophoresis. For example... Figure 6 As shown, the leaves of Jidou 17 have downward-pointing hairs, and PCR amplification using WU primers yielded a 266bp band, while amplification using YOU primers yielded no band. The leaves of Qihuang 34 have upright hairs, and PCR amplification using YOU primers yielded a 492bp band, while amplification using WU primers yielded no band.

[0100] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A molecular marker for detecting the morphology of soybean epidermal hairs, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1.

2. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes upstream primer WUF, downstream primer WUR, upstream primer YOUF, and downstream primer YOUR, with nucleotide sequences shown in SEQ ID NO:2-5.

3. A reagent kit for detecting the morphology of soybean epidermal hairs, characterized in that, The kit comprises the primer set as described in claim 2.

4. The kit according to claim 3, characterized in that, The kit also includes gene extraction reagents and / or PCR amplification reagents.

5. The application of the molecular marker as described in claim 1, the primer set as described in claim 2, or the kit as described in claim 3 in detecting the morphology of soybean epidermal hairs.

6. A method for detecting the morphology of soybean epidermal hairs, characterized in that, Includes the following steps: (1) Extract genomic DNA from soybean samples; (2) Perform PCR amplification of the genomic DNA from step (1) using the primer set described in claim 2; (3) Perform gel electrophoresis analysis on the amplification products. If the product amplified using WUF and WUR primers has a band of 266bp and the product amplified using YOUF and YOUR primers has no band, then the soybean epidermal hair morphology is backward hair; if the product amplified using WUF and WUR primers has no band and the product amplified using YOUF and YOUR primers has a band of 492bp, then the soybean epidermal hair morphology is upright hair.

7. The method as described in claim 6, characterized in that, The PCR amplification reaction system comprises: 2 μL of 300 ng / μL genomic DNA template, 1 μL each of upstream and downstream primers, 10 μL of TaqPCRmix, and ddH2O added to a total volume of 20 μL.

8. The method as described in claim 6, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 58℃ annealing for 25 s, 72℃ extension for 8 s, for a total of 32 cycles; 72℃ extension for 5 min; and storage at 4℃.

Images