Mutant, protein, expression vector of rice root elongation control gene OsCYP22 and its application

Abstract

The present invention discloses mutants, proteins, expression vectors of the rice root elongation control gene OsCYP22 and their applications, and the application of the gene OsCYP22 in controlling rice root elongation. By deleting bases in its DNA sequence, the elongation of rice roots is regulated. The nucleotide sequence of the gene OsCYP22 is shown in SEQ ID NO: 1. The present invention regulates the elongation of rice roots by deleting bases in the DNA sequence of the gene OsCYP22, resulting in the phenomenon of short roots in rice, which can create conditions for the improvement of rice roots and the development of cross-breeding or transgenic plants.

Description

Technical Field

[0001] The present invention relates to rice growth and development, and particularly to a mutant, protein, expression vector of a rice root elongation control gene OsCYP22 and their applications. Background Art

[0002] The rice root system is an important part of rice. It is not only the physical support of the above-ground part, but also an important organ for rice to absorb nutrients and water from the underground. The rice root system architecture is fibrous root system, which can continuously generate adventitious roots from the meristematic cells of the stem node closest to the vascular bundle of the stele, and finally its root system structure is composed of a large number of adventitious roots and their lateral roots. The root type is determined by several parameters such as length, number and spatial range. Research has found that root length determines the genetic performance of other root traits and is the most important trait among all root traits. Seven above-ground agronomic traits such as per-plant yield are significantly positively correlated with root length. One of the main cytological bases for root elongation is the cell division of the root tip meristem. Defects in the function or structure of the root tip meristem will lead to the occurrence of short roots. Another main cytological basis for root elongation is the elongation of cells in the root tip elongation zone, which is related to cell wall formation, cellulose synthesis and microtubule organization formation. Although root length plays an important role in plant yield and resistance, due to the growth of roots in the soil, it increases the difficulty of research, so little is known about the genetic background and molecular mechanism of root elongation, and the factor of root length has not been fully utilized in rice breeding and cultivation. Therefore, it is necessary to focus on mining genes that control rice root length, and isolate and clone a series of genes that control root length to facilitate the directional improvement of rice root traits. Summary of the Invention

[0003] The object of the present invention is to provide a gene OsCYP22, which regulates the elongation of rice roots through the deletion of bases in its DNA sequence, resulting in the phenomenon of short root systems in rice, and can create conditions for the improvement of rice roots and the development of cross-breeding or transgenic plants.

[0004] To solve the above problems, one object of the present invention is to provide the application of the gene OsCYP22 in controlling rice root elongation. The application is to regulate the elongation of rice roots through the deletion of bases in its DNA sequence, and the nucleotide sequence of the gene OsCYP22 is shown as SEQ ID NO: 1.

[0005] Another object of the present invention is to provide a mutant of the rice root elongation control gene OsCYP22. The nucleotide sequence of the mutant of the rice root elongation control gene OsCYP22 is that the last base of the third exon and the start splicing site of the third intron are both deleted on the basis of that shown in SEQ ID NO: 1.

[0006] Preferably, the nucleotide sequence of the mutant of the rice root elongation control gene OsCYP22 is based on that shown in SEQ ID NO: 1, where the last base of the third exon, thymine (T) at position 1036, the start splicing site of the third intron is mutated with the deletion of guanine (G) at position 1037 and thymine (T) at position 1038, resulting in the failure to splice out the third intron in the CDS, and the CDS has an additional 159 bp (the full length of the third intron is 162 bp).

[0007] The third object of the present invention is to provide the application of the mutant of the rice root elongation control gene OsCYP22 in controlling rice root elongation. The mutant of the rice root elongation control gene OsCYP22 can create conditions for the root improvement of rice and the development of cross-breeding or transgenic plants.

[0008] The fourth object of the present invention is to provide a protein encoded by the mutant of the rice root elongation control gene OsCYP22. Based on the amino acid sequence shown in SEQ ID NO: 2, a TAG is generated at the 167th position, and the translation is terminated prematurely, resulting in short roots in rice roots. This protein is a cyclophilin, and in the case of amino acid substitution or deletion, it can inhibit the elongation of rice roots, causing the phenomenon of short roots in rice. Thus, this protein inhibits the elongation of roots, specifically manifested as shorter above-ground parts, main roots, adventitious roots, and lateral roots in the plant.

[0009] The fifth object of the present invention is to provide an expression vector containing the rice root elongation control gene OsCYP22.

[0010] The sixth object of the present invention is to provide the application of the expression vector containing the rice root elongation control gene OsCYP22 in controlling rice root elongation.

[0011] Compared with the prior art, the advantages of the present invention are that it provides a mutant, protein, expression vector and application thereof of the rice root elongation control gene OsCYP22. The last base of the third exon in the base sequence shown in SEQ ID NO: 1 in the sequence listing of the encoding gene of this protein, such as thymine (T) at position 1036, and the start splicing site mutation of the third intron, such as the deletion of guanine (G) at position 1037 and thymine (T) at position 1038, result in the third intron in the CDS not being spliced out, and the CDS has 159 bp more (the full length of the third intron is 162 bp). The amino acid sequence of this protein is shown in SEQ ID NO: 2 in the sequence listing. It is a cyclophilin protein and is related to root elongation. A TAG is generated at position 167 of the encoded amino acid sequence, and the translation process is terminated prematurely. In this way, this protein inhibits root elongation. Specifically, in the plant, the above-ground part, main root, adventitious root and lateral root all become shorter. The application of this protein and its encoding gene can create conditions for the root improvement of rice and the development of cross-breeding or transgenic plants. Brief Description of the Drawings

[0012] Figure 1 It is a comparison of the phenotypes of the wild type (WT) and the Oscyp22 mutant in normal hydroponics for 8 days in Example 4; wherein a is a whole-plant photograph of the wild type (WT) and the Oscyp22 mutant at 8-day seedling age, bar = 2 cm; b, c, d and e are the observation results of the main root and lateral roots of the WT and Oscyp22 under a stereomicroscope, bars = 0.5 mm;

[0013] Figure 2 It is a comparison diagram of resin sections of the main root tips of the wild type (WT) and the Oscyp22 mutant in normal hydroponics for 5 days in Example 4;

[0014] Figure 3 It is the map-based cloning and gene structure of the OsCYP22 gene in Example 5; wherein a is the fine mapping result of the OsCYP22 gene, RM3376 and RM477 are SSR markers used for mapping, STS1, STS2, STS3 and STS4 are newly developed polymorphic markers, P0439B07 represents a BAC clone, and Rec represents a recombinant; b is the gene structure and mutation site of the OsCYP22 gene. The untranslated region and intron are represented by solid lines, the exon is represented by a solid box, and the arrow indicates the mutation site;

[0015] Figure 4 It is a phenotype diagram of the wild type (WT), the Oscyp22 mutant and two T2-generation transgenic rescue lines (OVER1 and OVER2) in Example 7;

[0016] Figure 5 It is a schematic structural diagram of the overexpression transformation vector pCAMBIA1300 modified in Example 7. Detailed implementation manners

[0017] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of specific embodiments of the present invention will be given with reference to the accompanying drawings.

[0018] Embodiment 1

[0019] This embodiment provides the application of gene OsCYP22 in controlling the elongation of rice roots. The application is to regulate the elongation of rice roots by deleting bases in its DNA sequence. The nucleotide sequence of the gene OsCYP22 is shown as SEQ ID NO: 1.

[0020] Embodiment 2

[0021] This embodiment provides a mutant and a protein of the rice root elongation control gene OsCYP22. The nucleotide sequence of the mutant of the rice root elongation control gene OsCYP22 is that the last base of the third exon and the starting splicing site of the third intron are both deleted on the basis of that shown in SEQ ID NO: 1.

[0022] Further, the nucleotide sequence of the mutant of the rice root elongation control gene OsCYP22 is that thymine (T), guanine (G), and thymine (T) at positions 1036 - 1038 are all deleted on the basis of that shown in SEQ ID NO: 1.

[0023] The amino acid sequence of the protein has a TAG generated at position 167 on the basis of that shown in SEQ ID NO: 2, and the translation terminates prematurely. The rice roots are expressed as short roots. This protein is a cyclophilin. In the case of amino acid substitution or deletion, etc., it can inhibit the elongation of rice roots, resulting in the phenomenon of short roots in rice. In this way, this protein inhibits the elongation of roots, and specifically, the above-ground part, main root, adventitious root, and lateral root of the plant all become shorter.

[0024] This embodiment also provides the application of the mutant of the rice root elongation control gene OsCYP22 in controlling the elongation of rice roots. The mutant of the rice root elongation control gene OsCYP22 can create conditions for the root improvement and cross-breeding of rice or the development of transgenic plants.

[0025] Embodiment 3

[0026] This embodiment provides an expression vector and its application, which contains the rice root elongation control gene OsCYP22 described in Embodiment 1, and the application of the expression vector in controlling the elongation of rice roots.

[0027] Embodiment 4: Phenotype and genetic analysis of the mutant

[0028] A rice short root mutant, Oscyp22, was screened from a mutant library of the indica rice (Oryza Sativa L. ssp indica) variety Kasalath mutagenized with ethyl methanesulfonate. The root elongation of the Oscyp22 mutant at 8 days old was severely inhibited, and the primary roots, adventitious roots and lateral roots all became shorter ( Figure 1 ). By longitudinal sectioning of semi-thin resin sections, it was found that the inhibition of cell elongation in the mutant Oscyp22 led to a significantly shorter primary root length compared to the wild type ( Figure 2 ). Therefore, the OsCYP22 gene can regulate the growth and development of rice roots by controlling the length of root cells. Using the mutant Oscyp22 as the male parent and crossing it with the wild type Kasalath, the first filial generation F 1 plants were completely identical to the wild type Kasalath, indicating that Oscyp22 is a recessive mutation. The F 1 obtained by self-pollination of the F 2 generation, the segregation ratio of normal plants to short-root plants was 168 / 60 = 2.8, and the chi-square test result was 0.21 < χ 2 0.05,1 = 3.84. The ratio of normal plants to short-root plants conforms to the 3:1 segregation ratio controlled by a single gene, indicating that this mutant is a recessive single-gene mutant.

[0029] Example 5: Mapping of the OsCYP22 gene

[0030] Short-root mutant individuals were isolated from the progeny F 2 of the cross between the mutant Oscyp22 and Nipponbare, and the mutant gene was mapped using the map-based cloning method. For the initial mapping (30 F 2 mutant individuals), the mutant gene was mapped between the SSR marker RM3376 and the STS marker STS4 on chromosome 8. Subsequently, the mapping population was expanded, and 3 new polymorphic STS molecular markers were developed within this interval, named STS1, STS2 and STS3 respectively. The STS molecular marker sequences used for the OsCYP22 gene are as follows:

[0031] STS1U - 5’TGCAGCGAACTATGTGAAGGA 3’

[0032] STS1L - 5’ACAACACAAGCAAGCTATGGC 3’

[0033] STS2U - 5’GCAGTTGCTGTTCGATCTTCA 3’

[0034] STS2L - 5’TTAATGTACGGCAACGGGTTT 3’

[0035] STS3U - 5’TTCTCCCTCTTCCTTGCTTGG 3’

[0036] STS3L - 5’ACCCGTCATGGTGAAAAAAGA 3’

[0037] STS4U - 5’TTGCTGTTTGCATATTGCCTA 3’

[0038] STS4L - 5’GCAAGTAAGAACAGGAGTTGTG 3’

[0039] Finally, the gene was locked between STS markers STS1 and STS2 (the specific physical positions on chromosome 8 were 27887192 bp and 27988604 bp respectively). The recombinants were all 1 / 2145, and the recombinant numbers were different. This interval was 101 kb in size ( Figure 3 ).

[0040] Example 6: Gene Prediction and Sequence Analysis

[0041] According to the results of fine mapping, the OsCYP22 gene was located on BAC clone P0439B07 ( Figure 3 ). According to the rice gene annotation information of TIGR (http: / / www.tigr.org / tdb / e2k1 / osa1 / ), gene prediction and analysis were carried out on the genes within the mapped chromosomal segment. There were a total of 13 predicted genes in this interval. The 13 candidate genes were amplified using the DNA templates of Kasalath wild type and Oscyp22 mutant, and the amplification products were sequenced respectively. By comparing and analyzing the sequencing results, it was found that the thymine (T) at position 1036, the last base of the third exon of the DNA sequence of the gene LOC_Os08g44330 (Cyclophilin), and the guanine (G) at position 1037 and thymine (T) at position 1038 at the start splicing site of the third intron were deleted, resulting in the failure to splice the third intron in the CDS. The CDS had 159 bp more (the full length of the third intron was 162 bp), and a TAG was generated at position 167 of the encoded amino acid sequence, causing the translation process to terminate prematurely. This gene was named OsCYP22.

[0042] Example 7: Functional Complementation Experiment of OsCYP22

[0043] According to the CDS sequence information of the OsCYP22 gene, primers for amplifying the complete CDS were designed, and the primer sequences were as follows (the underlined parts are restriction enzyme sites):

[0044] OsCYP22-OVU: 5’AAAGAGCTCATGCAGAGCCTCCTCCTCCCCA 3’

[0045] OsCYP22-OVL: 5’AAATCTAGAGTAACGTTGCCGGCTGTC 3’;

[0046] Total RNA of rice kasalash leaves was extracted using the RNA extraction kit (SK1321) from Sangon Biotech (Shanghai). Using Oligo(dt)-18 as the primer and the extracted total RNA as the template, the first-strand cDNA was synthesized by reverse transcription. Using this cDNA as the template, the full-length ORF was amplified using PrimeSTAR HS DNA Polymerase. PCR conditions: pre-denaturation at 98°C for 10 s, then enter the cycling reaction (98°C for 10 s, 58°C for 10 s, 72°C for 1 min), the number of cycles was 30, and finally extend for 10 min to end. The PCR product was recovered by cutting the gel through agarose electrophoresis, purified by adding A-tail and ligated to the pMD19-T vector. The ligation product was heat-shocked to transform competent Escherichia coli DH5α cells. After culturing at 37°C for 16 h, positive monoclonal colonies were picked for sequencing. After the sequencing identified that the sequence was correct, it was double-digested with SacI and XbaI overnight at 37°C and ligated into the pCAMBIA1300 modified (35S) vector that had been double-digested in the same way ( Figure 5 ), named 35S-OsCYP22OVER. The ligation product was heat-shocked to transform competent Escherichia coli DH5α cells in the same way, spread on an LB plate containing kanamycin resistance and cultured for 16 h, then monoclonal colonies were picked, the bacteria were shaken to extract the plasmid, double-digested and detected correctly by agarose gel, and then electro-transformed into Agrobacterium tumefaciens EHA105.

[0047] The plasmid with correct enzyme digestion detection was introduced into the mutant Oscyp22 through the rice genetic transformation system mediated by Agrobacterium strain EHA105. After infection, co-culture, screening for hygromycin-resistant calli, differentiation, rooting, hardening off and transplanting, transgenic plants were obtained. The rice genetic transformation system mediated by Agrobacterium (EHA105) was mainly optimized based on the method reported by Hiei et al. (1994). The root length of the Oscyp22 mutant isolated from this transgenic plant was restored to the wild type ( Figure 4 ), indicating that the phenotype of Oscyp22 was indeed caused by the mutation of OsCYP22.

[0048] Although the present disclosure is disclosed as above, the protection scope of the present disclosure is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present disclosure, and these changes and modifications will all fall within the protection scope of the present invention.

Claims

1. Use of gene OsCYP22 in controlling the elongation of rice roots, characterized in that, the use is to achieve the shortening of rice roots by deleting thymine, guanine, and thymine at positions 1036 - 1038 based on the nucleotide sequence shown in SEQ ID NO.

1.

2. A mutant of gene OsCYP22, characterized in that, the mutant of gene OsCYP22 is obtained by deleting thymine, guanine, and thymine at positions 1036 - 1038 based on the nucleotide sequence shown in SEQ ID NO.

1.

3. A protein, characterized in that, the protein is encoded by the mutant of gene OsCYP22 described in claim 2.

4. The protein according to claim 3, characterized in that, the amino acid sequence of the protein has a TAG generated at position 167 based on SEQ ID NO.2, resulting in premature termination of translation.

5. An expression vector, characterized in that, it contains the mutant of gene OsCYP22 described in claim 2.

6. Use of the expression vector according to claim 5 in shortening rice roots.

Images