A method for improving the growth defect of a human-derived n-glycosylation engineering strain

Abstract

The application discloses a method for improving the growth defect of a human N-glycosylation engineering strain, and the N-glycosylation pathway of yeast is reformed to be humanized, so that the cell wall integrity of the engineering strain is damaged, and the growth rate is significantly reduced. The cell wall protein gene PpSPI1 is overexpressed in the engineering strain, so that the cell wall defect of the engineering strain is effectively improved, and the growth rate is improved, thereby laying a foundation for subsequent industrial application of the human N-glycosylation yeast engineering strain.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a method for improving the growth defect of a human N-glycosylation engineering strain. BACKGROUND

[0002] As an important component of yeast cells, the cell wall is an organic barrier between the yeast cells and the outside world, which plays a crucial role in maintaining cell shape and toughness, maintaining normal osmotic pressure of cells, and controlling cell permeability. The cell wall of yeast is generally composed of polysaccharides and glycoproteins. Polysaccharides mainly include β-1, 3 and β-1, 6 glucan, chitin and mannan; glycoproteins are connected to the cell wall by covalent and non-covalent methods, and are usually modified with N-glycosyl or O-glycosyl of the mannose structure. Mannan and glycoprotein together constitute a dense mannoprotein layer on the outer surface of the cell wall, which plays an important protective role for the cell wall.

[0003] N-glycosylation modification has an important influence on the structure, stability and function of proteins. In eukaryotic cells, the N-glycosylation modification process of proteins occurs in the endoplasmic reticulum and Golgi body in turn. The N-glycosylation modification process in the endoplasmic reticulum is highly conserved in eukaryotic cells, but the N-glycosylation modification in the Golgi body shows significant species difference (Altmann F, et al. 2010; 87: 1617-1631). Mammalian cells mainly have complex N-glycosylation modification, and yeast cells mainly have high mannose type N-glycosylation modification. The high mannose type N-glycosylation of yeast can cause an immune response in the human body and lead to rapid clearance of therapeutic glycoproteins from the blood, reducing the efficacy (Altmann F, et al. 2010; 87: 1617-1631). In order to realize the expression and production of human N-glycoprotein in yeast cells, it is necessary to humanize the N-glycosylation modification process of yeast. At present, great breakthroughs have been made in the humanization of N-glycosylation in Saccharomyces cerevisiae and Pichia pastoris cells. Literature reports that knocking out the mannosyltransferase gene (OCH1) in S. cerevisiae or P. pastoris and expressing the exogenous mannosidase I gene (MNS1) (Altmann F, et al. 2010; 87: 1617-1631) can produce Man5-GlcNAc2 type N-oligosaccharide chains. On this basis, the genes encoding N-acetylglucosamine transferase I (GnT-I), mannosidase II (MnsII), N-acetylglucosamine transferase II (GnT-II) and galactosyltransferase (GalT) are introduced into the exogenous, and finally the N-oligosaccharide chain of the human-like Gal2-GlcNAc2-Man3-GlcNAc2 type is generated; further introducing the enzyme genes related to the sialic acid synthesis pathway can also produce human-like N-oligosaccharide chains with terminal sialic acid modification (Altmann F, et al. 2010; 87: 1617-1631). Appl. Microbiol. Biotechnol. Crit. Rev. Biotechnol . 2021; 41:2, 300-315). In order to realize the expression and production of human N-glycoprotein in yeast cells, it is necessary to humanize the N-glycosylation modification process of yeast. At present, great breakthroughs have been made in the humanization of N-glycosylation in Saccharomyces cerevisiae and Pichia pastoris cells. Literature reports that knocking out the mannosyltransferase gene (OCH1) in S. cerevisiae or P. pastoris and expressing the exogenous mannosidase I gene (MNS1) (Altmann F, et al. 2010; 87: 1617-1631) can produce Man5-GlcNAc2 type N-oligosaccharide chains. On this basis, the genes encoding N-acetylglucosamine transferase I (GnT-I), mannosidase II (MnsII), N-acetylglucosamine transferase II (GnT-II) and galactosyltransferase (GalT) are introduced into the exogenous, and finally the N-oligosaccharide chain of the human-like Gal2-GlcNAc2-Man3-GlcNAc2 type is generated; further introducing the enzyme genes related to the sialic acid synthesis pathway can also produce human-like N-oligosaccharide chains with terminal sialic acid modification (Altmann F, et al. 2010; 87: 1617-1631). OCH1 MNSI ,​​Nat. Rev. Microbiol . 2005;3:119–128). However, studies have found that human N-glycosylation modification leads to problems such as growth retardation and cell wall damage in yeast strains (Wu et al. Front. Microbiol. 2022; 13: 930658). Due to the lack of effective methods to improve these problems, the large-scale application of such engineering strains is limited. Therefore, it is of great theoretical significance and application value to find a method to improve the growth defects of human N-glycosylation engineering strains. SUMMARY

[0004] The purpose of the embodiments of the present application is to overcome the shortcomings of the prior art, and to provide a method for improving the growth defects of human N-glycosylation engineering strains. The method is achieved by overexpressing Pp SPI1 gene in human N-glycosylation engineering strains.

[0005] The technical solution of the present application is: a method for improving the growth defects of human N-glycosylation engineering strains, overexpressing cell wall protein PpSpi1 in the target human N-glycosylation engineering strain to obtain the improved human N-glycosylation engineering strain.

[0006] Further, the Pp SPI1 gene sequence encoding PpSpi1 is connected with an expression regulatory element to obtain an expression vector; the expression vector is transformed into the target human N-glycosylation engineering strain to overexpress the Pp SPI1 gene in the target strain.

[0007] Further, the expression vector includes a promoter, a 5' non-coding region, a PpSpi1 protein coding gene, and a 3' non-coding region, wherein the promoter is an inducible promoter or a constitutive promoter.

[0008] Further, the expression vector further includes a selectable marker gene for transforming strain screening, and the marker gene includes a resistance gene encoding antibiotic tolerance and an auxotrophic gene.

[0009] Further, the transformation scheme of the expression vector varies according to the type of strain used for transformation, and the transformation mode of the expression vector includes electroporation and chemical transformation.

[0010] Further, the N-glycosylation engineering strain is a strain capable of producing a Gal2-GlcNAc2-Man3-GlcNAc2 configuration N-oligosaccharide chain, including a yeast strain and a eukaryotic glycosylation engineering strain.

[0011] Further, the strain includes Pichia pastoris Pichia pastoris , Saccharomyces cerevisiae Saccharomyces cerevisiae , HansenulaHansenula polymorpha Kluyveromyces lactis Kluyveromyces lactis human N-glycosylation engineering strain.

[0012] Further, the cell wall protein comprises PpSpi1 from Pichia pastoris, and the amino acid sequence of PpSpi1 is shown in SEQ ID NO. 1.

[0013] Further, the cell wall protein comprises a conservative amino acid motif "VVXXXTTYCPXXTTXXXXXXTYTVTXXTTLTITDCPCTXXK", wherein X is any amino acid.

[0014] The technical scheme provided by the embodiment of the application can include the following beneficial effects:

[0015] As can be seen from the above embodiment, the application overexpresses Pp SPI1 in the human N-glycosylation engineering strain of yeast, which improves the growth rate of the strain, improves the thickness and density of the cell wall mannose protein layer, and enhances the ability of the engineering strain to resist external environmental pressure. The method for improving the growth defect of the human N-glycosylation engineering strain lays a foundation for the subsequent industrial scale application of the engineering strain.

[0016] It should be understood that the above general description and the following detailed description are only exemplary and explanatory, and cannot limit the application. BRIEF DESCRIPTION OF DRAWINGS

[0017] The accompanying drawings, which are incorporated into the specification and constitute a part of the specification, illustrate embodiments consistent with the application and, together with the specification, serve to explain the principles of the application.

[0018] Figure 1 The schematic diagram of the constructed vector pGGA-ΔPp spi1 map is shown.

[0019] Figure 2 The schematic diagram of the constructed vector pΔPp spi1 sgRNA Cas9 map is shown.

[0020] Figure 3 The growth curves of Pichia pastoris GS115 WT strain, GS115 ΔPp spi1 strain and GS115 ΔPp spi1 ::Pp SPI1 strain in 50 mL YPD medium are shown.

[0021] Figure 4 The growth curves of Pichia pastoris GS115 WT strain, GS115 ΔPp spi1Strains and GS115 ΔPp spi1 ::Pp SPI1 Electron microscopy images of the strains, where A is a cell scanning electron microscopy image and B is a transmission electron microscopy image;

[0022] Figure 5 Vector pZQC-Pp SPI1 Schematic diagram of the -Kan map;

[0023] Figure 6 Schematic diagram of the vector pΔPNSIV-9 sgRNA Cas9

[0024] Figure 7 Growth curve comparison of the GS115 WT strain and the Glyco4 strain in 50 mL YPD medium;

[0025] Figure 8 Electron microscopy images of the GS115 WT strain and the Glyco4 strain, where A is a cell scanning electron microscopy image and B is a transmission electron microscopy image;

[0026] Figure 9 Vector pZQC-Pp SPI1- Schematic diagram of the HygR map;

[0027] Figure 10 Schematic diagram of the commercial vector pTA2 purchased from TOYOBO;

[0028] Figure 11 Schematic diagram of the vector pDWW-HygR constructed;

[0029] Figure 12 Schematic diagram of the pZ-panARS-hCas9-blank plasmid constructed;

[0030] Figure 13 Growth curve comparison of the Glyco4 strain and the Glyco5 strain in 50 mL YPD medium;

[0031] Figure 14 Electron microscopy images of the human N-glycosylation engineering strain Glyco5, where A is a cell transmission electron microscopy and scanning electron microscopy image of the Glyco4 strain and B is a cell transmission electron microscopy and scanning electron microscopy image of the Glyco5 strain. DETAILED DESCRIPTION

[0032] The exemplary embodiments will be described in detail herein with reference to the attached drawings. In the following description, like reference numerals refer to like elements unless the context clearly dictates otherwise. The implementations described in the following exemplary embodiments are not meant to represent all implementations consistent with the present application.

[0033] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0034] The present application finds that the deletion of the cell wall protein gene PpSpi1 in Pichia pastoris GS115 strain results in growth retardation and cell wall defect problems. In the PpSpi1 deletion strain, the growth rate and cell wall morphology are basically restored to the level of the wild type (WT) GS115 strain, indicating that PpSpi1 plays an important protective role in the cell wall. SPI1 SPI1 The present application finds that the deletion of the cell wall protein gene PpSpi1 in Pichia pastoris GS115 strain results in growth retardation and cell wall defect problems. In the PpSpi1 deletion strain, the growth rate and cell wall morphology are basically restored to the level of the wild type (WT) GS115 strain, indicating that PpSpi1 plays an important protective role in the cell wall. SPI1 The present application finds that the deletion of the cell wall protein gene PpSpi1 in Pichia pastoris GS115 strain results in growth retardation and cell wall defect problems. In the PpSpi1 deletion strain, the growth rate and cell wall morphology are basically restored to the level of the wild type (WT) GS115 strain, indicating that PpSpi1 plays an important protective role in the cell wall.

[0035] The present application finds that the deletion of the cell wall protein gene PpSpi1 in Pichia pastoris GS115 strain results in growth retardation and cell wall defect problems. In the PpSpi1 deletion strain, the growth rate and cell wall morphology are basically restored to the level of the wild type (WT) GS115 strain, indicating that PpSpi1 plays an important protective role in the cell wall. SPI1 The present application finds that the deletion of the cell wall protein gene PpSpi1 in Pichia pastoris GS115 strain results in growth retardation and cell wall defect problems. In the PpSpi1 deletion strain, the growth rate and cell wall morphology are basically restored to the level of the wild type (WT) GS115 strain, indicating that PpSpi1 plays an important protective role in the cell wall.

[0036] Therefore, the present application provides a method for improving the growth defect of a human N-glycosylation engineering strain, which overexpresses the cell wall protein PpSpi1 in the target human N-glycosylation engineering strain to obtain an improved human N-glycosylation engineering strain.

[0037] Specifically, the PpSpi1 gene sequence encoding PpSpi1 is connected with an expression regulatory element to obtain an expression vector; the expression vector is transformed into the target human N-glycosylation engineering strain to overexpress the PpSpi1 gene in the target strain. The PpSpi1 gene is located on chromosome 1 of Pichia pastoris GS115 strain, and the gene number is SPI1 SPI1 SPI1 PAS_chr1-4_ 0586 ​​​​, the amino acid sequence of the PpSpi1 protein is shown as SEQ ID NO. 1. The DNA sequence of the PpSpi1 protein coding gene can be changed according to the codon bias of different target strains.

[0038] Specifically, the expression vector comprises a promoter, a 5' non-coding region, a PpSpi1 protein coding gene Pp SPI1 and a 3' non-coding region, wherein the promoter can be an inducible promoter or a constitutive promoter, and can be an exogenous promoter or an endogenous promoter.

[0039] Specifically, the expression vector further comprises a selectable marker gene for transformation strain screening, and the marker gene comprises a resistance gene encoding antibiotic tolerance and an auxotrophic gene.

[0040] Specifically, the transformation scheme of the expression vector varies according to the type of the strain used for transformation, and the transformation mode of the expression vector includes electroporation and chemical transformation.

[0041] Specifically, the N-glycosylation engineering strain is a strain capable of producing a Gal2-GlcNAc2-Man3-GlcNAc2 configuration N-oligosaccharide chain, including a yeast strain and a eukaryotic glycosylation engineering strain.

[0042] Specifically, the strain includes a Pichia pastoris Pichia pastoris , Saccharomyces cerevisiae Saccharomyces cerevisiae , Hansenula polymorpha Hansenula polymorpha , and Kluyveromyces lactis Kluyveromyces lactis human-derived N-glycosylation engineering strain. The integration position of the PpSpi1 protein coding gene sequence in the yeast chromosome can be determined according to the specific target strain.

[0043] Specifically, the cell wall protein comprises PpSpi1 derived from Pichia pastoris, and the amino acid sequence of PpSpi1 is shown as SEQ ID NO. 1.

[0044] Specifically, the cell wall protein contains a conserved amino acid motif "VVXXXTTYCPXXTTXXXXXXTYTVTXXTTLTITDCPCTXXK", wherein X is any amino acid, and the remaining letters in the sequence are abbreviations of existing amino acids.

[0045] The following examples illustrate the process. Unless otherwise specified, all reagents and consumables used in these examples were purchased from conventional reagent manufacturers in the field. Unless otherwise specified, the experimental methods and techniques used are conventional methods and techniques in the field. For details on plasmid extraction, RNA acquisition, DNA fragment recovery, ligation, and other operations, please refer to the instructions for the corresponding kits. For details on culture medium preparation and yeast cell culture, please refer to the Invitrogen™ user manual "User Guide: Pichia Expression Kit" (source: https: / / www.thermofisher.cn / order / catalog / product / K171001# / K171001). The Pichia pastoris GS115 WT strain was purchased from Invitrogen™.

[0046] Example 1: Pichia pastoris GS115 ΔPp spi1 strain (Pp missing) spi1 Construction of the GS115 mutant strain of the gene and observation of its phenotype

[0047] Will be used to knock out Pp spi1 The gene vector pGGA-ΔPp spi1 ( Figure 1 ) and carrier pΔPp spi1 sgRNACas9 ( Figure 2 The enzyme was co-transformed into Pichia pastoris GS115 WT strain. Target clones were screened using YPD (Yeast Extract–Peptone–Dextrose) plates containing bleomycin and verified by PCR. Robust GS115 ΔPp clones were selected. spi1 Single clones were cultured overnight in 5 mL of YPD liquid medium. A suitable amount of the above culture solution was then transferred to 50 mL of YPD liquid medium to allow initial OD values ​​to rise. 600 =0.1, continuously cultured at 30℃ and 220 rpm for 72 hours, and samples were taken at certain time intervals to plot the growth curve. Figure 3 The message indicates that Pp has been knocked out. SpI1 After gene injection, the growth rate of the GS115 mutant strain was significantly slowed down.

[0048] Scanning electron microscopy observation of yeast cells:

[0049] (1) Centrifuge at 5000 rpm for 5 minutes and collect the total OD. 600 =20 logarithmic growth phase yeast cells (about the size of a soybean).

[0050] (2) The above yeast cells were washed in 1 mL deionized water in a 1.5 mL EP (Eppendorf) tube, and after centrifugation at 5000 rpm for 5 minutes, the supernatant was removed; 1 mL glutaraldehyde solution was added to the bacteria for resuspension, and the bacteria were fixed at 4°C overnight;

[0051] (3) The overnight sample was centrifuged at 3000 rpm for 3 minutes to remove glutaraldehyde, and the sample was then rinsed with phosphate buffer (0.1 M, pH 7.4) three times, each time for 15 minutes;

[0052] (4) The sample was fixed with 1% osmic acid solution for 1.5 hours; the fixing solution was discarded, and the sample was rinsed with phosphate buffer (0.1 M, pH 7.4) three times, each time for 15 minutes;

[0053] (5) The sample was dehydrated with gradient concentration (50%, 70%, 90%) ethanol solution, each concentration for 30 minutes, and finally transitioned to pure ethanol treatment twice, each time for 30 minutes;

[0054] (6) The sample was critical point dried and coated;

[0055] (7) The cell surface morphology of the yeast sample was observed under an electron microscope.

[0056] Transmission electron microscope observation of yeast cell wall:

[0057] Steps (1)-(4) are the same as those for scanning electron microscope observation of yeast cell wall;

[0058] (5) Then, the sample was treated with ethanol:acetone (volume ratio 1:1) for 30 minutes, and finally transitioned to pure acetone treatment twice, each time for 30 minutes;

[0059] (6) The sample was treated with embedding agent and acetone mixture (volume ratio 1:1) for 2 hours; then the sample was treated with embedding agent and acetone mixture (volume ratio 3:1) overnight;

[0060] (7) After pure embedding agent treatment for more than 8 hours, the sample was embedded after permeation treatment, and polymerized at 65°C for 24-48 hours to obtain the embedded sample;

[0061] (8) After ultrathin sectioning of the sample, the sample was observed under a cold field transmission electron microscope.

[0062] Figure 4 Figure A in the figure shows that the GS115 ΔPp spi1 Compared with the GS115 WT strain, many cells with uneven morphology and wrinkles appeared. At 10000x, it can be seen more clearly that the GS115 ΔPp spi1The cell surface of the strain is rougher, the cell shape is not plump, and the bud scars on some cell surfaces are broken (indicated by white arrows). Figure 4 The B in the image shows GS115ΔPp spi1 The cell wall mannose protein layer of the strain (indicated by the gray arrow) is noticeably sparse and has an indistinct outline.

[0063] Example 2: Pichia pastoris GS115 ΔPp spi1 ::Pp SPI1 strain (in GS115 ΔPp) spi1 Pp reinjection in strain spi1 Construction of the strain containing the gene and observation of its phenotypic characteristics

[0064] The carrier pZQC-Pp SPI1 -Kan ( Figure 5 ) and vector pΔPNSIV-9 sgRNA Cas9 ( Figure 6 Co-transformed into Pichia pastoris GS115ΔPp spi1 In this strain, target clones were screened using YPD plates containing geneticin (G418) and verified by PCR, yielding Pichia pastoris GS115 ΔPp. spi1 ::Pp SPI1 strains.

[0065] Based on the method described above, the ΔPp of Pichia pastoris GS115 was analyzed. spi1 ::Pp SPI1 The growth curves of the strains were determined, and cell morphology and cell wall structure were observed by transmission electron microscopy and scanning electron microscopy. Figure 3 and Figure 4 Showing the return Pp SPI1 After gene generation, GS115 ΔPp spi1 ::Pp SPI1 The growth rate, cell morphology, and cell wall structure of the strain were restored to the GS115 WT level.

[0066] Example 3: Phenotypic observation of N-glycosylated engineered strain Glyco4

[0067] Refer to the literature reporting methods ( Nat. Protoc. (2009; 4: 58-70), using Pichia pastoris GS115 WT as the starting strain, a human N-glycosylated engineered strain, Glyco4, was constructed, and its growth curve was determined, and it was observed by transmission electron microscopy and scanning electron microscopy. Figure 7 As shown, the growth rate of the human N-glycosylated engineered strain Glyco4 was significantly reduced compared to the GS115 WT strain. Figure 8 The results showed that the Glyco4 strain also exhibited bud scar damage. Figure 8The white arrow in Fig. 1A indicates) and the cell wall mannoprotein layer is sparse Figure 8 The gray arrow in Fig. 1B indicates) the phenomenon.

[0068] Example 4: Pp SPI1 Overexpression of the gene in human N-glycosylation engineering strain Glyco4

[0069] Overexpression vector pZQC-Pp in Pichia pastoris human N-glycosylation engineering strain SPI1- HygR( Figure 9 ) The construction process is as follows:

[0070] 1. Extract the Pichia pastoris GS115 WT strain genome

[0071] (1) Use a sterilized toothpick to pick up a single colony of appropriate size from the plate and inoculate it into 5 mL YPD test tube, cultivate at 220 rpm and 30°C for 48 hours;

[0072] (2) Take 1.5 mL of bacterial solution, centrifuge at 12000 rpm for 1 minute, discard the supernatant, collect the bacterial cells, and then resuspend and wash with 1 mL of deionized water. Centrifuge at 12000 rpm for 1 minute, and then remove the supernatant;

[0073] (3) Add 5 mg of acid-washed glass sand to the collected bacterial cells, then add 200 μL of yeast lysis solution and 200 μL of phenol:chloroform:isopropyl alcohol (25:24:1) mixture, and vortex for 2 minutes on a vortex instrument. Then add 200 μL of 1×TE (Tris-EDTA) buffer and invert several times;

[0074] (4) Place the mixture in a centrifuge and centrifuge at 12000 rpm for 10 minutes. After layering, the supernatant is removed and transferred to a new EP tube. Add 2.5 times the volume of pre-cooled anhydrous ethanol and 0.1 times the volume of sodium acetate solution (pH 5.2), and mix well.

[0075] (5) Place the mixed product in a -20°C refrigerator and allow it to settle naturally for 1 hour;

[0076] (6) Take out the settled product and centrifuge at 12000 rpm for 10 minutes. Discard the supernatant, then add 1 mL of 70% ethanol and vortex for 10 seconds;

[0077] (7) Repeat step 6 to remove the supernatant and dry the precipitate at room temperature until it becomes translucent;

[0078] (8) Add 200 μL of 1×TE buffer to dissolve the genomic DNA. Measure the DNA concentration and store it in a -20°C refrigerator.

[0079] 2. Obtain Pp SPI1 Gene sequence and DNA fragments of the neutral site PNSIV-9 5' and 3' homologous arms

[0080] Using the genome of GS115 WT strain as a template, the neutral site PNSIV-9 was amplified. Nucleic Acids Res. The 5' homologous arm sequence (PNSIV-9 homologous arm, SEQ ID NO.2), the 3' homologous arm sequence (PNSIV-9 3' homologous arm, SEQ ID NO.3), and Pp sequence of 2021;13:7791–7805) were found. SPI1 The gene sequence and its upstream and downstream 484 bp promoter sequences and 155 bp terminator sequences (SEQ ID NO.4, promoter and terminator sequences are indicated by lowercase letters). The above fragments were separated by 1% (w / v) agarose gel electrophoresis and purified using a gel DNA mini-recovery kit (Novizan).

[0081] 3. Obtain the autonomous replication sequence of E. coli plasmid, hygromycin, and ampicillin resistance DNA fragments.

[0082] Plasmid pTA2 was extracted using a plasmid extraction kit (Novizan). Figure 10 ), pDWW-HygR ( Figure 11 Using pDWW-HygR plasmid as a template, the hygromycin resistance gene (HygR) expression cassette sequence was amplified using the high-fidelity enzyme Hieff Canace. Using pTA2 plasmid as a template, the E. coli replicon sequence PUC ori and the ampicillin resistance gene (AmpR) expression cassette sequence were amplified. The above fragments were separated by 1% (w / v) agarose gel electrophoresis and purified using a gel DNA mini-recovery kit (Novizan).

[0083] 4. Assemble pZQC-Pp SPI1 -HygR vector

[0084] The above fragments (SEQ ID NO.2 - SEQ ID NO.4) were assembled using a seamless cloning kit (AllGold), and then ligated to form the vector pZQC-Pp. SPI1- HygR.

[0085] Design of sgRNA sequence targeting the neutral site in PNSIV-9: first log in CHOPCHOP website (https: / / chopchop.cbu.uib.no / ), input the DNA sequence of the neutral site in PNSIV-9 in FASTA format into the target box, select Pichia pastoris, then screen the gene knockout sgRNA sequence, and the highest ranked sequence (ATTATCGTTTGGGATACGAG) is selected as the target sgRNA sequence. The corresponding upstream and downstream primers are designed (upstream primer: ACGCATTATCGTTTGGGATACGAG, downstream primer: AAACCTCGTATCCCAAACGATAAT).

[0086] Construction of pΔPNSIV-9 sgRNA-Cas9 vector: Figure 6 Take 5 μL of 10 μM sgRNA upstream and downstream primers, mix well, 95°C, 10-15 minutes; after the end, place on ice for 5 minutes; dilute the reaction product with deionized water by 100 times; prepare the Golden Gate reaction system according to the following ingredients: 50 fmol plasmid pZ-panARS-hCas9-blank Figure 12 ), 150 fmol sgRNA fragment, 1 μL T4 ligase buffer, 0.5 μL T4 ligase, 0.5 μL Bsa I, and finally add ddH2O to 10 μL.

[0087] Prepare the system according to the following program: (1) pre-cut 37°C, 5 minutes; (2) cutting: 37°C, 5 minutes; (3) ligation: 20°C, 20 minutes, 10 cycles; (4) reaction cutting: 37°C, 30 minutes; (5) inactivation: 75°C, 6 minutes. Finally, the pΔPNSIV-9 sgRNA-Cas9 vector is obtained.

[0088] Transform the above constructed vector into Pichia pastoris human N-glycosylation engineering strain Glyco4:

[0089] (1) Pick fresh and healthy yeast monoclonal from the plate and inoculate into 50 mL YPD liquid medium, 220 rpm, 30°C overnight culture;

[0090] (2) When the culture reaches OD 600 1~2, transfer the bacterial solution to a sterile 50 mL centrifuge tube, centrifuge at 5000 rpm for 5 minutes, discard the supernatant, and collect the bacterial cells;

[0091] (3) Add 30 mL of lithium acetate sorbitol Tris mixed solution (LST buffer) to the collected bacteria to resuspend, and stand at 30°C for 30 minutes; centrifuge the bacteria at 5000 rpm for 5 minutes after standing, and remove the supernatant;

[0092] (4) Resuspend the precipitated bacteria with 10 mL of pre-cooled sorbitol solution, centrifuge at 5000 rpm for 5 minutes, and discard the supernatant; repeat step (4) twice;

[0093] (5) Add about 400 μL of pre-cooled sorbitol solution to the last collected bacteria, resuspend carefully, complete the Pichia pastoris competence preparation, and distribute 80 μL / tube into sterilized pre-cooled EP tubes for standby (freshly made and used);

[0094] (6) Add 5 μg of linearized plasmid (total volume not more than 20 μl) to 80 μL of Pichia pastoris competence, gently blow with a gun to mix evenly, and incubate on ice for 5 minutes;

[0095] (7) Add the mixed plasmid competent cells to the pre-cooled electrode cup (spacing 0.1 cm);

[0096] Set the voltage of the electroporator to 780 V, place the electrode cup in the electroporator, and prepare 1 mL of pre-cooled sorbitol solution in advance;

[0097] (8) Click the start key of the electroporator, and record the voltage and shock time;

[0098] (9) Take out the electrode cup, add 1 mL of pre-cooled sorbitol solution prepared in advance, and mix evenly by blowing;

[0099] (10) Place the mixed bacteria solution in a 30°C incubator for 1.5 hours;

[0100] Plate the above bacteria solution according to different gradients on plates containing corresponding antibiotics, and incubate in a 30°C incubator for 2-3 days. After single colonies grow, genotype verification is performed, and finally the Pichia pastoris N-glycosylation engineering strain Glyco5 overexpressing Pp SPI1 is obtained.

[0101] The human N-glycosylation engineering strain Glyco5 was subjected to growth curve determination, cell scanning electron microscopy and transmission electron microscopy observation according to the method described in Example 3.

[0102] As shown in Figure 13 , compared with the Glyco4 strain, the growth rate of the Glyco5 strain was significantly improved.

[0103] As shown in Figure 14As shown in panel A, the Glyco5 strain has a more rounded and regular cell morphology compared to the Glyco4 strain.

[0104] As shown in panel B, the Glyco5 strain has a thicker and more compact cell wall mannoprotein layer compared to the Glyco4 strain (gray arrow indicates). Figure 14

[0105] Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. It is intended that the application embrace any and all variations of the present application that fall within the scope of the general inventive concept as defined by the appended claims and their equivalents.

[0106] It is to be understood that the application is not limited to the precise details of design or construction shown above and illustrated in the drawings and that various modifications and changes can be made by those skilled in the art without departing from the scope of the application.​

Claims

1. A method for improving the growth defect of a human N-glycosylation engineering strain, characterized in that, The cell wall protein PpSpi1 is overexpressed in a target human N-glycosylation engineering strain to improve the growth rate of the strain, improve the thickness and density of the cell wall mannose protein layer, and obtain an improved human N-glycosylation engineering strain; The human N-glycosylation engineering strain is Pichia pastoris capable of producing a Gal2-GlcNAc2-Man3-GlcNAc2 configuration N-oligosaccharide chain, and the amino acid sequence of PpSpi1 is shown in SEQ ID NO.

1.

2. The method of claim 1, wherein, The PpSpi1-encoding Pp SPI1 gene sequence is linked to an expression regulatory element to obtain an expression vector; the expression vector is transformed into the target human-derived N-glycosylation engineering strain, so that the Pp SPI1 gene is overexpressed in the target strain.

3. The method of claim 2, wherein, The expression vector comprises a promoter, a 5' non-coding region, a PpSpi1 protein coding gene, and a 3' non-coding region, wherein the promoter is an inducible promoter or a constitutive promoter.

4. The method of claim 3, wherein, The expression vector further comprises a selective marker gene for transformation strain screening, and the marker gene comprises a resistance gene encoding antibiotic tolerance and an auxotrophic gene.

5. The method of claim 2, wherein, The transformation scheme of the expression vector varies according to the type of strain used for transformation, and the transformation mode of the expression vector includes electroporation and chemical transformation.

Images