A bhcr immuno-crossover reaction detection reagent and method

Abstract

The present application relates to the technical field of biology, and especially to a BHCR immunological cross-linking reaction detection reagent and method. The detection reagent provided by the present application can be combined with three FBs at least for each FA, and the prepared reagent has high stability, high sensitivity and high accuracy, and is more suitable for clinical instant detection of biomarkers.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a BHCR immune cross-linking reaction detection reagent and method. Background Technology

[0002] Point-of-care testing (POCT) is testing performed at the patient's bedside, primarily used in health check-up centers, emergency rooms, intensive care units, and outpatient clinics. Major tests include tumor marker detection, cardiac marker detection, inflammatory marker detection, kidney marker detection, and blood glucose marker detection. Detection methods mainly include radioimmunoassay (RIA), colloidal gold, enzyme-linked immunosorbent assay (ELISA), time-resolved fluorescence immunoassay (TRFIA), and chemiluminescence immunoassay (CLIA). The core steps of these methods involve two main parts: first, recognizing the analyte through an immune reaction; and second, generating and reporting signals from the immune reaction products. Therefore, the detection and reporting of signals generated by the immune reaction have a crucial impact on the accuracy and sensitivity of the test results.

[0003] Nonlinear hybridization chain reaction (BHCR) can easily achieve secondary or exponential amplification. BHCR is a hairpin-free nonlinear HCR system. The system mainly consists of double-stranded substrate-A and substrate-B labeled with fluorophores and quenchers, and corresponding auxiliary agents A and B. The branching growth of fluorescent DNA dendritic macromolecules is controlled by substrate kinetics under quenching, achieving secondary or exponential amplification. It is characterized by mild conditions, no enzyme requirement, simple protocol, and excellent amplification efficiency. Therefore, BHCR can be combined with various detection methods to establish biosensors for ultrasensitive detection of various low-concentration analytes. However, the nonlinear hybridization chain reaction time and detection efficiency of existing BHCR reagents need improvement. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a BHCR reaction reagent with improved detection efficiency and its application.

[0005] The BHCR reaction reagent provided by this invention includes: a trigger probe, an FA probe, a QA probe, an auxiliary A, an FB probe, a QB probe, and an auxiliary B;

[0006] The trigger probe sequence consists of an isolation region and a trigger recognition region; the trigger recognition region consists of sequentially connected fragments a, b, and c.

[0007] The sequence of the FA probe consists of n repeating units and one inverse complementary sequence of the trigger recognition region; each repeating unit consists of sequentially connected segments x, y, and z.

[0008] The sequence of A consists of the reverse complementary sequences of n segments y and 1 segment c;

[0009] The sequence of the QA probe consists of the reverse complementary sequences of fragment b, fragment c, and n fragments y;

[0010] Where n≥3;

[0011] The sequence of the FB probe consists of an inverse complementary sequence of a repeating unit and the trigger recognition region sequence;

[0012] The sequence of the auxiliary B is the reverse complementary sequence of the 5' end of the QB probe, which is 18-20 bp.

[0013] The sequence of the QB probe consists of an inverse complementary sequence of the trigger recognition region missing 7 bp at the 5' end, and a repeating unit sequence missing 5 bp at the 3' end.

[0014] In this invention, the isolation region sequence of the trigger probe is polyA; the nucleic acid sequence of the trigger recognition region is TGACGAACTAGTTGATGAAGCTG, wherein fragment a is TGACG, fragment b is AACTAGTTGATG, and fragment c is AAGCTG. In some embodiments, the isolation region is AAAAA.

[0015] In this invention, the sequence of the repeating unit is GGTGCCTATTATGTCTCCTCCT, wherein segment x is GT, segment y is GTGCCTATTATGTC, and segment z is TCCTCCT.

[0016] In some embodiments, n is 3 or 4.

[0017] In this invention, the sequence of the auxiliary B is the inverse complementary sequence of the 20 bp end of the QB probe 5'. Alternatively, the sequence of the auxiliary B is the inverse complementary sequence of the 18 bp end of the QB probe 5'.

[0018] In some embodiments, the 5' end of the trigger probe is labeled with biotin, the 5' end of the FA and QB is labeled with a fluorescent group, and the 3' end of the FB and QA is labeled with a quencher group. In some embodiments, the fluorescent group is 6-FAM, and the quencher group is BHQ1.

[0019] In this invention, the BHCR reaction reagent is used in the preparation of point-of-care testing reagents.

[0020] The present invention also provides a reagent for point-of-care testing, comprising the BHCR reaction reagent, magnetic beads coated with capture antibody, and avidin-labeled detection antibody.

[0021] In some embodiments, the capture antibody is selected from tumor marker antibodies, cardiac marker antibodies, inflammatory marker antibodies, kidney marker antibodies, or blood glucose marker antibodies.

[0022] The detection antibody is an anti-antibody. In a specific embodiment, the detection antibody is an anti-human antibody. For example, rabbit anti-human antibody, mouse anti-human antibody, or sheep anti-human antibody.

[0023] In some specific embodiments, the tumor marker antibodies include AFP, PSA, carcinoembryonic antigen (CEA), cancer antigen 242 (CA242), neuronal heterologous enolase (NSE), serum ferritin (SF), progastrin-releasing peptide (PROGRP), or squamous cell carcinoma antigen (SCC).

[0024] The present invention also provides a real-time detection method, which uses the reagents provided by the present invention to detect the analyte.

[0025] In some embodiments, the detection method includes:

[0026] After forming double strands of the FA and QA probes, they are mixed with reagent A, denoted as reagent A. After forming double strands of the FB and QB probes, they are mixed with reagent B, denoted as reagent B. The carrier of the capture antibody is incubated with the analyte, and then reacted with the avidin-labeled detection antibody to obtain product I. The trigger probe, reagent A, and reagent B are co-incubated to obtain product II. After co-incubating products I and II, the signal is detected.

[0027] In other embodiments, the detection method includes:

[0028] After forming double strands of the FA and QA probes, they are mixed with reagent A, denoted as reagent A. After forming double strands of the FB and QB probes, they are mixed with reagent B, denoted as reagent B. The trigger probe is reacted with avidin and the detection antibody to obtain product i; the carrier of the capture antibody is incubated with the analyte and then reacted with product i to obtain product ii; reagent A and reagent B are co-incubated to obtain product iii; product ii is reacted with product iii to detect the signal.

[0029] In some embodiments, the analyte is a sample from blood, tissue, excrement, or secretions. In this embodiment of the invention, the sample is a blood sample.

[0030] In the detection reagent provided by this invention, each FA can bind to at least three FBs, resulting in a reagent with strong stability, high sensitivity, and high accuracy, making it more suitable for clinical point-of-care testing of biomarkers. Attached Figure Description

[0031] Figure 1 The reaction principle of the reagent of the present invention is shown. Detailed Implementation

[0032] This invention provides BHCR reaction reagents and their applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0033] The BHCR reaction reagent provided by this invention includes: a trigger probe, an FA probe, a QA probe, an A-assistant probe, an FB probe, a QB probe, and an B-assistant probe.

[0034] All probes in the reaction reagents described in this invention are DNA, more preferably single-stranded DNA. Their sequences are not strictly limited; as long as the conditions described in this invention are met, detection can be achieved.

[0035] The BHCR reaction reagent provided by this invention is used to detect the products after antigen-antibody reaction, thereby amplifying the detection signal. In the antigen-antibody reaction, the capture antibody coated on the matrix can capture the antigen in the analyte, and the detection antibody with a biomarker recognizes the antigen, thereby linking the biomarker to the antigen through the detection antibody.

[0036] In this invention, the trigger probe sequence consists of an isolation region and a trigger recognition region, and it is also modified with biotin or avidin. When detecting antibody-labeled biotin, the trigger probe is labeled with avidin. Conversely, when detecting antibody-labeled avidin, the trigger probe is labeled with biotin. In this invention, the label of the trigger probe is located at its 5' end. In some embodiments, the structure of the trigger probe is biotin-isolation region-trigger recognition region. In some specific embodiments, the sequence of the isolation region is polyA, and the sequence of the trigger recognition region is not limited, as long as it is inversely complementary to a portion of FA. The length of the trigger recognition region is 25-30 bp; in this invention, its length is 28 bp. In some specific embodiments, the structure of the trigger probe is: biotin-AAAAATGACGAACTAGTTGATGAAGCTG. To facilitate the description of the relationship between the structures of other probes in the reagent and the trigger probe, the trigger recognition region is divided into three segments. Therefore, the trigger recognition area consists of sequentially connected segments a, b, and c, where segment a is TGACG, segment b is AACTAGTTGATG, and segment c is AAGCGTG.

[0037] In this invention, the FA probe sequence consists of n repeating units and one inverse complementary sequence of the trigger recognition region. To facilitate the description of the relationship between the structure of other probes in the reagent and the FA probe, each repeating unit is divided into three segments, and each repeating unit consists of sequentially connected segments x, y, and z. The structure of the FA probe of this invention can be represented as: (segment x - segment y - segment z)n - inverse complementary segment of the trigger recognition region.

[0038] In the detection process, the reaction reagent provided by this invention allows each repeating unit in the FA probe to bind to one FB probe. Since each FA contains more than three repeating units, each FA in the reaction reagent provided by this invention can bind to at least three FBs, thereby improving detection efficiency and sensitivity. This invention designs reactions of FA binding to two FBs, three FBs, and four FBs, each lasting 5 minutes. The results show that the fluorescence intensity obtained within the same time period increases with the increase in the number of repeating units. However, although theoretically the fluorescence intensity increases continuously with the increase in the number of repeating units, for the sake of improving reaction stability, the length of the FA is not greater than 300 bp.

[0039] In some embodiments of the present invention, the sequence of the repeating units is GGTGCCTATTATGTCTCCTCCT, where fragment x is GT, fragment y is GTGCCTATTATGTC, and fragment z is TCCTCCT. In some embodiments, the number of repeating units is 3 or 4. Compared to FA probes with two repeating units, probes with three or more repeating units in the present invention achieve higher sensitivity and require a shorter detection cycle.

[0040] In this invention, the 5' end of the FA probe is modified with a fluorescent group. The fluorescent group is selected from Alexa350, Alexa488, Alexa 532, Alexa 549, Alexa 647, Alexa 680, CF350, CF488, CF532, CF594, CF647, CF680, 6-FAM, FITC, TRITC, 6-TET HEX, VIC, ROX, Cal610, Texas Red, CY5, Quasar670, or Quasar705;

[0041] In some specific embodiments, n=3, and the structure of the FA probe is as follows:

[0042] 6-FAM-GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTTCGTCA;

[0043] In other specific embodiments, n=4, and the structure of the FA probe is as follows:

[0044] 6-FAM-GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTTCGTCA.

[0045] In this invention, the QA probe sequence consists of fragments b and c from the trigger probe, and n inverse complementary sequences of fragment y. Its structure can be represented as: fragment b - fragment c - (inverse complementary fragments of fragment y)n. In QA, the value of n is equal to the value of n in FA. The sequence of the inverse complementary fragments of fragment y is GACCATAATAGGCAC AC.

[0046] The 3' end of the QA probe is modified with a quenching group. The quenching group on the QA probe can quench the fluorescent group on the FA probe. The quenching group is selected from BHQ-0, BHQ-1, BHQ-2, BHQ-3, MGB, DabCyl, or Eclip selam.

[0047] In some embodiments, n=3, and the structure of the QA is as follows:

[0048] AACTAGTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC / GACATAATAGGCACAC-BHQ1

[0049] In other embodiments, n = 4, and the structure of the QA is as follows:

[0050] AACTAGTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC / GACATAATAGGCACACGACATAATAGGCACAC-BHQ1

[0051] The sequence of the auxiliary A described in this invention consists of the inverse complementary sequences of n fragments y and one fragment c; its structure can be represented as (fragment y)n - the inverse complementary sequence of fragment c. The value of n is equal to the value of n in FA. The inverse complementary sequence of fragment c is CAGCTT. The auxiliary A is not modified with fluorescent or quenching groups.

[0052] In some embodiments, n = 3, and the structure of the auxiliary A is as follows:

[0053] GTGCCTATTATGTCGTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT

[0054] In other embodiments, n = 4, and the structure of A is as follows:

[0055] GTGCCTATTATGTCGTGCCTATTATGTCGTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT

[0056] The preparation of reagent A according to the present invention includes: cooling FA probe and QA probe from 90 to 95°C to 55°C at a rate of 1 min / °C, then allowing them to cool naturally to room temperature, and then adding auxiliary agent A to obtain reagent A.

[0057] In the preparation of reagent A according to this invention, FA and QA are denatured at 95°C for 5 min, and then slowly cooled to room temperature over 30 min. According to the base pairing principle, the FA and QA chains form complementary double strands. Fragment z, not being complementary to the fragment on QA, forms a stem-loop structure. In the double strands formed by FA and QA, the fluorescent group and the quenching group are very close together, causing the fluorescence on the FA probe to exhibit a "quenched" state.

[0058] The FB probe sequence of this invention consists of an inverse complementary sequence of one repeating unit and a trigger recognition region sequence identical to that of the trigger probe. That is, the structure of the FB probe can be represented as: inverse complementary sequence of repeating unit - trigger recognition region sequence. The number of inverse complementary sequences of the repeating unit on the FB probe is only one, and does not change due to variations in the number of repeating units in the FA. Specifically, the inverse complementary sequence of the repeating unit is AGGAGGAGACATAATAGGCACAC.

[0059] The 3' end of the FB probe is modified with a quenching group, which is selected from BHQ-0, BHQ-1, BHQ-2, BHQ-3, MGB, DabCyl, or Eclip selam.

[0060] In some specific embodiments, the structure of the FB probe is as follows:

[0061] AGGAGGAGACATAATAGGCACACTGACGAACTAGTTGATGAAGCTG-FAM.

[0062] The QB probe sequence of this invention consists of an inverse complementary sequence of a 7bp deletion of the 5' end trigger recognition region and a repeating unit sequence of a 5bp deletion of the 3' end. That is, the structure of the QB probe can be represented as: inverse complementary (5' end of trigger recognition region - 7bp) - (3' end of repeating unit - 5bp). Wherein, the 5' end of the trigger recognition region - 7bp is CTAGTTGATGAAGCTG, and its inverse complementary sequence is CAGCTTCATCAACTAG. The 3' end of the repeating unit - 5bp is GTGTGCCTATTATGTCTC. In this invention, the 5' end of the QB probe is modified with a fluorescent group. The quenching group modified on the FB probe can quench the fluorescent group on the QB probe. The quenching groups modified on the QB probe are Alexa350, Alexa488, Alexa 532, Alexa549, Alexa 647, Alexa 680, CF350, CF488, CF532, CF594, CF647, CF680, 6-FAM, FITC, TRITC, 6-TET HEX, VIC, ROX, Cal610, Texas Red, CY5, Quasar670, or Quasar705.

[0063] The auxiliary B sequence described in this invention is inversely complementary to the QB probe sequence. Specifically, the auxiliary B sequence is inversely complementary to the 18-20 bp 5' end of the QB probe. The 20 bp 5' end sequence of the QB probe is: CAGCTTCATCAACTAGGTGTGC, and the auxiliary B sequence is GCACACCTAGTTGATGAAGC, or CACACCTAGTTGATG AAGC, or ACACCTAGTTGATG AAGC. This invention explored different auxiliary B lengths, and the results showed that an 18 bp auxiliary B length is more beneficial for reducing the decomposition rate, thereby improving reaction stability. Therefore, when the auxiliary B length is 18 bp, its effect is better than that of 19 bp or 20 bp lengths, and the fluorescence signal obtained by detecting with an 18 bp auxiliary B is more significant within 35 minutes.

[0064] The preparation of reagent B according to the present invention includes: cooling FB probe and QB probe from 90 to 95°C to 55°C at a rate of 1 min / °C, then allowing them to cool naturally to room temperature, and then adding auxiliary agent B to obtain reagent B.

[0065] In the preparation process of reagent B described in this invention, FB and QB are denatured at 95°C for 5 min, and then slowly cooled to room temperature over 30 min. According to the base complementary pairing principle, the FB chain and QB chain form a complementary double strand. In the double strand formed by FB and QB, the fluorescent group and the quenching group are very close to each other, resulting in the fluorescence on the FB probe exhibiting a "quenched" state.

[0066] The biotin-labeled trigger probe in the reaction reagent of this invention can recognize the streptomycin-labeled product after the antigen-antibody reaction. Furthermore, when reagents A and B are added to the system, the trigger hybridizes and docks with the exposed anchor point on the FA probe, causing a branching migration reaction that displaces part of the Q chain from the F chain and opens the first loop. Then, the auxiliary A displaces the Q chain by docking with the newly exposed anchor point, generating byproducts. Fluorescence in the F chain is restored by dissociating the Q chain with the quenching group from the F chain. The F chain in substrate A exposes two tandemly linked identical sequences, which can be simultaneously hybridized with the anchor points of two substrate chains B. With the help of auxiliary chain Ass B or Ass B-2nt, the Q chain is displaced, generating byproduct B, releasing more fluorescent reporter groups; and two single-stranded regions composed of the same sequence as the trigger chain DNA are exposed, thus entering a new round of reaction. Through cyclical reactions, a dendritic nanocomplex is ultimately formed, generating more byproducts A and B. Figure 1 ).

[0067] The application of the BHCR reaction reagent provided by this invention in the preparation of point-of-care testing reagents.

[0068] This invention also provides a reagent for point-of-care testing, comprising the BHCR reaction reagent described herein, magnetic beads coated with capture antibodies, and avidin-labeled detection antibodies. In the prior art, it is generally believed that probes or enzymes cannot be stored together, as this will lead to a decrease in detection efficiency. However, this invention has experimentally discovered that storing some reagents together or in a complex form can not only shorten the clinical testing time but also achieve good detection stability.

[0069] For example, the reagents for point-of-care testing provided by this invention include:

[0070] Reagent A: FA probe + QA probe + auxiliary A. Auxiliary A is added after FA and QA form a double strand. Reagent A is stored at 4℃.

[0071] Reagent B: FB probe + QB probe + auxiliary B. Auxiliary B is added after FB and QB form a double strand. Reagent B is stored at 4℃.

[0072] Reagent C: Magnetic beads + antibody. It is prepared by coating magnetic beads with antibody. The connection between the magnetic beads and the antibody is covalent coupling. The magnetic beads are surface-modified with carboxyl, amino, or thiol groups. Their particle size is 100 nm to 5 μm. The preferred particle size is 1 μm to 3 μm. Store at 4 °C.

[0073] Reagent D: Detection antibody and streptavidin; among them, the streptavidin-labeled detection antibody plays a crucial role in connecting the two. The detection antibody can be either a monoclonal antibody or a polyclonal antibody, and it is linked to streptavidin.

[0074] Reagent E: trigger probe.

[0075] Experiments have verified that reagents A, B, and D remain stable for up to 3 months, and still achieve good detection results after being stored at 4°C for 3 months. Reagent C can be stored at 4°C for 2 years, and reagent E can be stored at 4°C for 12 months without affecting the detection results.

[0076] Alternatively, the reagents for instant detection provided by this invention include:

[0077] Reagent A: FA probe + QA probe + auxiliary A. Auxiliary A is added after FA and QA form a double strand. Reagent A is stored at 4℃.

[0078] Reagent B: FB probe + QB probe + auxiliary B. Auxiliary B is added after FB and QB form a double strand. Reagent B is stored at 4℃.

[0079] Reagent C: Magnetic beads + antibody. It is prepared by coating magnetic beads with antibody. The connection between the magnetic beads and the antibody is covalent coupling. The magnetic beads are surface-modified with carboxyl, amino, or thiol groups. Their particle size is 100 nm to 5 μm. The preferred particle size is 1 μm to 3 μm. Store at 4 °C.

[0080] Reagent D: Detection antibody, streptavidin, and trigger probe; among them, the streptavidin-labeled detection antibody plays a crucial role in the process. The detection antibody can be either a monoclonal or polyclonal antibody, and the labeling primarily involves linking it to streptavidin. The streptavidin-modified detection antibody and trigger probe are incubated at 30–37°C for 0–0.1 h to form complex A. Based on the structural characteristics of streptavidin and the trigger probe, streptavidin can link to four trigger DNA molecules. Store at 4°C.

[0081] Experiments have verified that reagents A, B, and D remain stable for up to 3 months, and still achieve good detection results after being stored at 4°C for 3 months. Reagent C can be stored at 4°C for 2 years without affecting the detection results.

[0082] The capture antibody in the detection reagent of this invention can be either a polyclonal antibody or a monoclonal antibody. Monoclonal antibodies are preferred. If the antibody contains other amino or thiol impurities, these impurities must be removed by dialysis, G-25, or other methods to avoid competitive reactions with the antibody (e.g., Tris, glycine, BSA, etc.). The preparation method of the antibody-coated magnetic beads mainly includes: placing the magnetic beads in a coupling reaction flask, adding buffer solution, and then adding antibody (magnetic bead amount mg: antibody amount mg ​​= 20:1). The coupling reaction flask is then tightened and placed in a constant temperature shaker at 25°C for 1-6 hours to ensure thorough mixing. The coupling reaction flask is then washed with buffer solution (using magnetic separation and removing the supernatant) to block unreacted active groups (3%-5% BSA), and stored at 4°C.

[0083] The present invention also provides a method for point detection, comprising: incubating a carrier of a capture antibody with an analyte, and then reacting it with an avidin-labeled detection antibody to obtain product I; co-incubating a trigger probe, reagent A and reagent B to obtain product II; and detecting a signal after co-incubating product I and product II.

[0084] Alternatively, the instant detection method may include: reacting a trigger probe with avidin and a detection antibody to obtain product i; incubating a carrier of the capture antibody with the analyte and then reacting it with product i to obtain product ii; co-incubating reagent A and reagent B to obtain product iii; and reacting product ii with product iii to detect the signal.

[0085] In the method of the present invention, since a portion of the test reagent has already reacted to form a complex before clinical testing, it is not necessary to prepare it fresh for clinical use, thereby significantly shortening the testing time without affecting the accuracy of the test.

[0086] In this invention, the analyte is a sample from blood, tissue, excrement, or secretions. In this embodiment, the sample is a blood sample. Specifically, the blood sample is serum or plasma.

[0087] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:

[0088] Example 1

[0089] The effectiveness of different probes was verified by testing the target with PSA standards at specific concentrations. The experiment was divided into the following groups:

[0090] The probe sequence in reagent group 1 is as follows:

[0091]

[0092] The probe sequences in the reagents of group 2 are as follows:

[0093]

[0094]

[0095] The probe sequences in group 3 reagents are as follows:

[0096]

[0097] The BHCR reaction solution above includes reagent A, reagent B, and buffer solution.

[0098] 1.1 Reagent A is prepared as follows: F-strand of substrate-A (FA) and Q-strand of substrate-A (QA) are placed in a PCR instrument at 90-95°C and cooled to 55°C at a rate of 1 min / °C. Then, the mixture is removed and allowed to cool to room temperature before adding auxiliary agent A to obtain reagent A. FA and QA first form double strands; taking the probe design of group 1 as an example, double strands are formed. It can be stored at 4°C for up to 3 months.

[0099] 1.2 Reagent B is prepared as follows: F-strand of substrate-B (FB) and Q-strand of substrate-B (QB) are placed in a PCR instrument at 90-95℃, cooled to 55℃ at 1 min / ℃, then removed and cooled to room temperature before adding reagent B to obtain reagent B. FB and QB form a double strand; taking the probe design of group 1 as an example, double strands are formed. It can be stored at 4℃ for 3 months.

[0100] 1.3. Reagent C is prepared from magnetic beads and PSA antibody.

[0101] Reagent C was prepared by surface activation of superparamagnetic carboxyl magnetic beads, conjugation with PSA antibody, and blocking. The buffer for Reagent C was PBS, pH 7.4, with the addition of 0.09% sodium azide and 0.01% Tween 20. The density of the magnetic beads was 50 mg / ml. It can be stored at 4°C for 2 years.

[0102] 1.4: Reagent D is prepared from detection antibody + streptavidin + trigger DNA:

[0103] First, a streptavidin-labeled detection antibody was prepared, then a trigger probe was added, and the reaction was carried out at 30–37°C for 1 hour to obtain reagent D. Reagent D was prepared using 0.5% PBS as the buffer. It can be stored at 4°C for up to 12 months.

[0104] 2. The PSA standard (concentration 4 ng / ml) was tested using the above reagents. The steps included:

[0105] 2.1 Mix reagent C with the standard and incubate at 25°C for 30 minutes, then collect the magnetic beads;

[0106] 2.2. The magnetic beads collected in step 2.1 are mixed with reagent D and reacted at 25°C for 40 minutes;

[0107] 2.3. Mix reagent A and reagent B and react at 37°C for 20 minutes;

[0108] 2.4. Invert the solution from step 2.3 into the solution from step 2.2 and react at 37°C for 15-30 minutes;

[0109] 2.5. Remove the supernatant from step 2.4 using magnetic separation. Wash the magnetic beads once with PBST or PBS solution. Ultra-high sensitivity multicolor flow cytometer for fluorescence intensity detection

[0110] The results showed that after five replicates of groups 1-3, the average fluorescence values ​​were as follows: group 1: 11000, group 2: 12000, and group 3: 13800. It is evident that the fluorescence intensity detected within a given reaction time increases with the number of replicate units, and the fluorescence intensities of groups 2 and 3 are significantly stronger than that of group 1. However, further increasing the number of replicate units leads to reaction instability; therefore, a replicate unit count of 3-4 is preferred.

[0111] Example 2

[0112] 1. Design the following primer sets: The trigger, FA, QA, FB, and QB sequences remain unchanged in each set, and are as follows:

[0113]

[0114]

[0115] 2. The preparation methods of reagents A to D are the same as in Example 1. Each group of reagents was used to detect the PSA standard (concentration 4 ng / ml). The steps included:

[0116] 2.1 Mix reagent C with the standard and incubate at 25°C for 30 minutes, then collect the magnetic beads;

[0117] 2.2. The magnetic beads collected in step 2.1 are mixed with reagent D and reacted at 25°C for 40 minutes;

[0118] 2.3. Mix reagent A and reagent B and react at 37°C for 20 minutes;

[0119] 2.4. Invert the solution from step 2.3 into the solution from step 2.2 and react at 37°C for 15-30 minutes;

[0120] 2.5. Remove the supernatant from step 2.4 using magnetic separation. Wash the magnetic beads once with PBST or PBS solution. Ultra-high sensitivity multicolor flow cytometer for fluorescence intensity detection

[0121] The results showed that after five replicates in groups 1-3, the average fluorescence values ​​were as follows: group 1: 11000, group 2: 11600, and group 3: 12800. This indicates that reducing the length of the auxiliary B layer can make the structure less prone to spontaneous opening, thereby reducing background noise. Specifically, when the auxiliary B layer length was 18 bp, the fluorescence value was higher, the fluorescence-time growth curve showed better linearity, and the background was lower.

[0122] Example 3

[0123] To shorten clinical testing time, an attempt was made to react reagents to form a complex before testing, in order to avoid "preparing reagents on demand" in clinical testing.

[0124] The experiment included the following steps: Each component was stored separately and prepared before detection. Within 12 hours, a PSA standard (concentration 4 ng / mL) was used as the test substance, and the fluorescence intensity was recorded. Then, after storing each reagent for a period of time (1 month, 2 months, 3 months, 6 months, 12 months, 18 months, and 24 months), detection was performed again, and the difference in detection results compared to reagents without storage was analyzed. A difference within 3% was considered to have no impact on the reaction results.

[0125] 1. Cool the FA probe and QA probe from 90–95℃ to 55℃ at a rate of 1 min / ℃, then allow them to cool naturally to room temperature. Add reagent A to obtain reagent A. This reagent can be stored at 4℃ for 3 months without affecting the detection effect, although the detection effect will decrease thereafter.

[0126] 2. Cool the FB probe and QB probe from 90–95℃ to 55℃ at a rate of 1 min / ℃, then allow them to cool naturally to room temperature. Add reagent B to obtain reagent B. This reagent can be stored at 4℃ for 3 months without affecting the detection effect, although the detection effect will decrease thereafter.

[0127] 3. The preparation method of antibody-modified magnetic beads includes placing the magnetic beads in a coupling reaction flask, adding buffer solution, and then adding antibody (magnetic bead amount mg: antibody amount mg ​​= 20:1). The coupling reaction flask is then tightened and placed in a constant temperature shaker at 25°C for 1-6 hours to ensure thorough mixing. The coupling reaction flask is then washed with buffer solution (using magnetic separation and removing the supernatant) to block unreacted active groups (3%-5% BSA). The flask is stored at 4°C and remains stable for 2 years.

[0128] 4. Using streptavidin-labeled detection antibodies, PSA standards at concentrations of 0.003 ng / ml, 0.1 ng / ml, 4 ng / ml, and 10 ng / ml were tested. The fluorescence values ​​were 1100, 6800, 12100, and 42500, respectively, showing a good linear relationship between the fluorescence value and the standard concentration. The limit of detection reached 1×10⁻⁶. -12 The ng / ml result indicates that the reagent has good accuracy.

[0129] 5. Trigger probes, stored separately at 4°C, will not affect test results within 12 months.

[0130] 6. The detection antibody, streptavidin, and trigger probe are reacted to form a complex. The preparation method includes directly mixing 0.5% BSA with PBS in a certain proportion at pH 7.4-8. It can be stored at 4°C for 3 months without affecting the detection results. After that, the detection effect will decrease.

[0131] Example 4

[0132] 1. Using PSA standard as the test object, the following probes are used for detection:

[0133]

[0134] The preparation methods of reagents A, B, C, and D are the same as those of group 1 in Example 1.

[0135] The PSA standard (concentration 4 ng / ml) was tested using the above reagents. The steps included:

[0136] 2.1 Mix reagent C with the standard and incubate at 25°C for 30 minutes, then collect the magnetic beads;

[0137] 2.2. The magnetic beads collected in step 2.1 are mixed with reagent D and reacted at 25°C for 40 minutes;

[0138] 2.3. Mix reagent A and reagent B and react at 37°C for 20 minutes;

[0139] 2.4. Invert the solution from step 2.3 into the solution from step 2.2 and react at 37°C for 15-30 minutes;

[0140] 2.5. Remove the supernatant from step 2.4 using magnetic separation. Wash the magnetic beads once with PBST or PBS solution. Ultra-high sensitivity multicolor flow cytometer for detecting fluorescence intensity.

[0141] The results showed that after five repeated detections, the average fluorescence value was 12910, and the RSD was 2.3%, indicating that the reagent has good repeatability. Its limit of detection is as low as 1×10⁻⁶. -12The ng / ml result indicates that the reagent has good accuracy.

[0142] Example 5

[0143] 1. Using PSA as the target substance and serum as the sample, the following probes are used for detection:

[0144]

[0145] The preparation methods of reagents A, B, and C are the same as those of group 1 in Example 1.

[0146] Reagent D: Preparation of streptavidin-labeled detection antibody.

[0147] Reagent E: trigger probe.

[0148] 2. The PSA standard is tested using the above reagents. The steps include:

[0149] 2.1 Mix reagent C with the standard and incubate at 25°C for 30 minutes, then collect the magnetic beads;

[0150] 2.2. The magnetic beads collected in step 2.1 are mixed with reagent D and reacted at 25°C for 40 minutes;

[0151] 2.3. Mix reagents A, B, and E and react at 37°C for 20 minutes;

[0152] 2.4. Invert the solution from step 2.3 into the solution from step 2.2 and react at 37°C for 15-30 minutes;

[0153] 2.5. Remove the supernatant from step 2.4 using magnetic separation. Wash the magnetic beads once with PBST or PBS solution. Ultra-high sensitivity multicolor flow cytometer for detecting fluorescence intensity.

[0154] The results showed that after three repeated detections, the average fluorescence value was 12900, with an RSD of 1.6%, indicating that the reagent has good repeatability. Its limit of detection is as low as 1×10⁻⁶. -12 The ng / ml result indicates that the reagent has good accuracy.

[0155] Example 6

[0156] 1. Using PSA as the target substance and serum as the sample, the following probes are used for detection:

[0157]

[0158] The preparation methods of reagents A, B, and C are the same as those of group 1 in Example 1.

[0159] Reagent D: Preparation of streptavidin-labeled detection antibody.

[0160] Reagent E: trigger probe.

[0161] 2. The PSA standard is tested using the above reagents. The steps include:

[0162] 2.1 Mix reagent C with the standard and incubate at 25°C for 30 minutes, then collect the magnetic beads;

[0163] 2.2. The magnetic beads collected in step 2.1 are mixed with reagent D and reacted at 25°C for 40 minutes;

[0164] 2.3. Mix reagents A, B, and E and react at 37°C for 20 minutes;

[0165] 2.4. Invert the solution from step 2.3 into the solution from step 2.2 and react at 37°C for 15-30 minutes;

[0166] 2.5. Remove the supernatant from step 2.4 using magnetic separation. Wash the magnetic beads once with PBST or PBS solution. Ultra-high sensitivity multicolor flow cytometer for detecting fluorescence intensity.

[0167] The results showed that with three repeated detections, the average fluorescence value was 12000, and the RSD was 1.5%, indicating that the reagent has good repeatability. Its limit of detection can reach 1×10⁻⁶. -12 The ng / ml result indicates that the reagent has good accuracy.

[0168] Example 7

[0169] Using PSA standards of different concentrations as the detection targets, the following probes were employed for detection:

[0170]

[0171] 2. The PSA standard is tested using the above reagents. The steps include:

[0172] 2.1 Mix reagent C with the standard and incubate at 25°C for 30 minutes, then collect the magnetic beads;

[0173] 2.2. The magnetic beads collected in step 2.1 are mixed with reagent D and reacted at 25°C for 40 minutes;

[0174] 2.3. Mix reagents A, B, and E and react at 37°C for 20 minutes;

[0175] 2.4. Invert the solution from step 2.3 into the solution from step 2.2 and react at 37°C for 15-30 minutes;

[0176] 2.5. Remove the supernatant from step 2.4 using magnetic separation. Wash the magnetic beads once with PBST or PBS solution. Ultra-high sensitivity multicolor flow cytometer for detecting fluorescence intensity.

[0177] The results showed ， PSA standards at concentrations of 0.003 ng / ml, 0.1 ng / ml, 4 ng / ml, and 10 ng / ml were tested, and the fluorescence values ​​were 1100, 6800, 12100, and 42500, respectively. A good linear relationship was observed between the fluorescence value and the standard concentration, indicating that the reagent has good repeatability. Its limit of detection is 1 × 10⁻⁶. -12 The ng / ml result indicates that the reagent has good accuracy.

[0178] Example 8

[0179] Serum sample detection: Under the experimental conditions of Example 7, the AFP concentration in the serum of a liver cancer patient obtained from a certain hospital was detected using this immune BHCR detection platform. The AFP concentration values ​​were close to those measured by the hospital. Furthermore, the measured values ​​for each sample showed very little fluctuation. The detection results are as follows:

[0180] sample Example 7 Reagent Detection Data (ng / mL) 1 43.70±0.56 2 17.34±0.73 3 72.80±3.35

[0181] Specificity assessment: Under the conditions of Example 7, the immunobHCR detection platform was used to detect 1 ng / mL AFP antigen and 100 ng / mL non-target antigens (CEA, PSA, IgG). The results showed that the fluorescence intensity of AFP was significantly stronger than that of the non-target antigens. This indicates that the method has good specificity.

[0182] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Hunan Morning Nanorobot Co., Ltd. <120> A BHCR Immunocrosslinking Reaction Detection Reagent and Method <130> MP21026373 <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <400> 1 tgacgaacta gttgatgaag ctg 23 <210> 2 <211> 5 <212> DNA <213> Artificial Sequence <400> 2 tgacg 5 <210> 3 <211> 12 <212> DNA <213> Artificial Sequence <400> 3 aactagttga tg 12 <210> 4 <211> 6 <212> DNA <213> Artificial Sequence <400> 4 aagctg 6 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 gtgtgcctat tatgtctcct cct 23 <210> 6 <211> 14 <212> DNA <213> Artificial Sequence <400> 6 gtgcctatta tgtc 14 <210> 7 <211> 7 <212> DNA <213> Artificial Sequence <400> 7 tcctcct 7

Claims

1. A BHCR reaction reagent characterized in that, include: Trigger probe, FA probe, QA probe, Auxiliary A, FB probe, QB probe and Auxiliary B; The sequence of the trigger probe consists of an isolation region and a trigger recognition region; the trigger recognition region consists of sequentially connected fragments a, b, and c, wherein the isolation region sequence is polyA; fragment a is TGACG, fragment b is AACTAGTTGATG, fragment c is AAGCTG, and the nucleic acid sequence of the trigger recognition region of the trigger is TGACGAACTAGTTGATGAAGCTG; The sequence of the FA probe consists of n repeating units and one inverse complementary sequence of the trigger recognition region; each repeating unit consists of sequentially connected segments x, y, and z, where segment x is GT, segment y is GTGCCTATTATGTC, segment z is TCCTCCT, and the sequence of the repeating unit is GGTGCCTATTATGTCTCCTCCT. The sequence of A consists of the reverse complementary sequences of n segments y and 1 segment c; The sequence of the QA probe consists of the reverse complementary sequences of fragment b, fragment c, and n fragments y; Where n = 3 or 4; The sequence of the FB probe consists of an inverse complementary sequence of a repeating unit and the trigger recognition region sequence; The sequence of the auxiliary B is the reverse complementary sequence of the 5' end of the QB probe, which is 18 bp. The sequence of the QB probe consists of an inverse complementary sequence of the trigger recognition region missing 7 bp at the 5' end, and a repeating unit sequence missing 5 bp at the 3' end. The 5' end of the trigger probe is labeled with biotin, the 5' end of the FA and QB is labeled with a fluorescent group, and the 3' end of the FB and QA is labeled with a quenching group.

2. The BHCR reaction reagent according to claim 1, wherein, The fluorescent group is 6-FAM, and the quenching group is BHQ1.

3. The use of the BHCR reaction reagent according to claim 1 or 2 in the preparation of point-of-care testing reagents.

4. A reagent for point-of-care testing comprising the BHCR reaction reagent as described in claim 1 or 2, magnetic beads coated with capture antibody, and avidin-labeled detection antibody.

5. The reagent according to claim 4, characterized in that, The capture antibody is selected from tumor marker antibodies, cardiac marker antibodies, inflammatory marker antibodies, kidney marker antibodies, or blood glucose marker antibodies. The antibody being detected is an anti-antibody.

Images