Application of ferromanganese silicate nanoscale enzyme in preparation of product for detecting nucleic acid

By using iron-manganese silicate nanozymes to catalyze a colorimetric reaction and utilizing pyrophosphate inhibition, the problems of high cost and insufficient sensitivity in existing nucleic acid detection methods have been solved, achieving highly sensitive and economical nucleic acid detection.

CN116083644BActive Publication Date: 2025-11-25BEIJING UNIV OF CHEM TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211225887.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-09
Publication Date
2025-11-25
Estimated Expiration
2042-10-09

AI Technical Summary

Technical Problem

Existing nucleic acid detection methods, such as real-time fluorescent RT-PCR, are costly and rely on fluorescent probes. The sensitivity of signal reading methods is insufficient, and the specificity needs to be improved.

Method used

Using iron-manganese silicate nanozyme (IMSN) as a catalyst, its peroxidase activity is utilized to catalyze the colorimetric reaction, and the colorimetric reaction is inhibited by pyrophosphate (PPi) to achieve nucleic acid detection.

Benefits of technology

It enables reliable and economical nucleic acid detection without relying on fluorescent probes and fluorescent instruments, with a detection limit of up to 240 copies/mL, meeting the requirements for high sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116083644B_ABST
    Figure CN116083644B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and specifically discloses application of an iron-manganese silicate nano-enzyme (IMSN) in preparation of a product for detecting target nucleic acid. The IMSN has peroxidase activity, can catalyze oxidation of TMB into blue oxTMB, and its enzyme activity can be effectively inhibited by PPi, thereby inhibiting the color development reaction. By detecting PPi generated in the nucleic acid amplification process through the IMSN, the effect of detecting the amplification target can be achieved. Since a large amount of PPi is generated in the nucleic acid amplification process, the SARS-CoV-2 nucleic acid can be detected through the color development reaction visible to the naked eye, and the detection limit can reach 240 copies / mL. The application does not depend on a fluorescent probe and a fluorescent detection instrument.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of an iron-manganese silicate nanoscale enzyme in preparation of a product for detecting nucleic acid. BACKGROUND

[0002] Currently, the mainstream method for detecting viral nucleic acid is Reverse Transcription-Polymerase Chain Reaction (real-time fluorescent RT-PCR method), which can detect a small amount of RNA molecules in one reaction and has high specificity and high sensitivity, but it cannot be separated from fluorescent probes and precise fluorescent instruments, and the detection cost is high. At present, some nucleic acid detection methods that do not depend on fluorescent probes have also been developed, for example, in LAMP diagnostic testing, the color change of an acid-base indicator is used to mark the pH change of the reaction solution caused by the replication of target DNA, but the sensitivity of this signal reading method is insufficient, and the specificity needs to be improved. SUMMARY

[0003] The technical problem to be solved by the present application is how to provide a reliable, practical and economical nucleic acid detection method based on an iron-manganese silicate nanoscale enzyme.

[0004] To solve the above technical problems, the present application provides application of an iron-manganese silicate nanoscale enzyme (IMSN) in preparation of a product for detecting target nucleic acid.

[0005] The iron-manganese silicate nanoscale enzyme (IMSN) is a nanoscale enzyme with peroxidase-like activity obtained by adding iron ions and manganese ions to mesoporous silica nanoparticles under hydrothermal conditions.

[0006] In the above application, the target nucleic acid can be from any one of humans, non-human animals, plants, microorganisms, fungi, bacteria and viruses.

[0007] In the above application, the iron-manganese silicate nanoscale enzyme is prepared by the following method:

[0008] The mesoporous silica nanoparticles are dissolved in water, and an aqueous solution containing metal salts containing iron and manganese elements and NH4Cl and ammonia water with a concentration of 25-28wt% are added, wherein the molar ratio of the mesoporous silica nanoparticles, the metal salts containing iron and manganese elements, NH4Cl, the ammonia water with a concentration of 25-28wt%, water is 1:0.2-1.5:3-54:7-30:2000-7000; after mixing, 120-160℃ reaction for 8-24h, centrifugal washing and drying obtain the iron-manganese silicate nanoscale enzyme.

[0009] In the application, the product is composed of reagents and instruments, the reagents include RT-PCR reaction reagents for target nucleic acid detection and iron-manganese silicate nanoscale enzyme catalytic color developing reagents.

[0010] In the application, the PCR reaction reagents for target nucleic acid detection include a primer pair for amplifying target nucleic acid.

[0011] In the application, the PCR reaction reagents for target nucleic acid detection can further include a primer pair for amplifying reference nucleic acid.

[0012] In the application, the product for detecting target nucleic acid can be a product for detecting novel coronavirus nucleic acid, the PCR reaction reagents for target nucleic acid detection in the product for detecting novel coronavirus nucleic acid are RT-PCR reaction reagents; the RT-PCR reaction reagents can include a primer pair for amplifying ORF1ab gene of SARS-CoV-2 and / or a primer pair for amplifying N gene of SARS-CoV-2. The RT-PCR reaction reagents can further include a primer pair for amplifying RNase P gene as a reference.

[0013] In the application, the primer pair for amplifying ORF1ab gene of SARS-CoV-2 is composed of a DNA single strand with nucleotide sequence as shown in Sequence 1 and a DNA single strand with nucleotide sequence as shown in Sequence 2:

[0014] ORF-F: 5'-CCCTGTGGGTTTTACACTTAA-3' (as shown in Sequence 1 of the Sequence Listing);

[0015] ORF-R: 5'-ACGATTGTGCATCAGCTGA-3' (as shown in Sequence 2 of the Sequence Listing).

[0016] In the application, the primer pair for amplifying N gene of SARS-CoV-2 is composed of a DNA single strand with nucleotide sequence as shown in Sequence 3 and a DNA single strand with nucleotide sequence as shown in Sequence 4:

[0017] N-F: 5'-GGGGAACTTCTCCTGCTAGAAT-3' (as shown in Sequence 3 of the Sequence Listing);

[0018] N-R: 5'-CAGACATTTTGCTCTCAAGCTG-3' (as shown in Sequence 4 of the Sequence Listing).

[0019] In the application, the primer pair for amplifying RNase P gene as a reference is composed of a DNA single strand with nucleotide sequence as shown in Sequence 5 and a DNA single strand with nucleotide sequence as shown in Sequence 6:

[0020] RNase P-F: 5'-AGATTTGGACCTGCGAGC-3' (as shown in sequence 5 of the sequence listing);

[0021] RNase P-R: 5'-GAGCGGCTGTCTCCACAAGT-3' (as shown in sequence 6 of the sequence listing).

[0022] In the above application, the iron-manganese silicate nanoscale enzyme catalytic color reagent comprises a manganese silicate, TMB and H2O2.

[0023] The application also provides a reagent for detecting a novel coronavirus nucleic acid, which comprises an RT-PCR reaction reagent for detecting a novel coronavirus nucleic acid and an iron-manganese silicate nanoscale enzyme catalytic color reagent, and the RT-PCR reaction reagent and the iron-manganese silicate nanoscale enzyme catalytic color reagent are separately packaged.

[0024] In the above reagent, the RT-PCR reaction reagent can comprise a primer pair for amplifying an ORF1ab gene of SARS-CoV-2 and / or a primer pair for amplifying an N gene of SARS-CoV-2 and / or a primer pair for amplifying an RNase P gene as an internal reference.

[0025] In the above reagent, the RT-PCR reaction reagent can further comprise a primer pair for amplifying an RNase P gene as an internal reference.

[0026] In the above reagent, the primer pair for amplifying an ORF1ab gene of SARS-CoV-2 consists of a DNA single strand with a nucleotide sequence as shown in sequence 1 and a DNA single strand with a nucleotide sequence as shown in sequence 2.

[0027] In the above reagent, the primer pair for amplifying an N gene of SARS-CoV-2 consists of a DNA single strand with a nucleotide sequence as shown in sequence 3 and a DNA single strand with a nucleotide sequence as shown in sequence 4.

[0028] In the above reagent, the primer pair for amplifying an RNase P gene of SARS-CoV-2 consists of a DNA single strand with a nucleotide sequence as shown in sequence 5 and a DNA single strand with a nucleotide sequence as shown in sequence 6.

[0029] In the above reagent, the iron-manganese silicate nanoscale enzyme catalytic color reagent comprises an iron-manganese silicate nanoscale enzyme, TMB and H2O2.

[0030] The application also provides an application of an iron-manganese silicate nanoscale enzyme in preparing a pyrophosphate detection reagent.

[0031] In the present application, the inventors applied the iron-manganese silicate nanoszyme (IMSN) to the nucleic acid detection of SARS-CoV-2. IMSN has peroxidase activity and can catalyze the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) to blue oxTMB. Its enzyme activity can be effectively inhibited by pyrophosphate (PPi), thereby inhibiting the color development reaction. Based on this property, the inventors can use IMSN to detect the PPi produced in the nucleic acid amplification process, thereby achieving the effect of detecting the amplified target. Since a large amount of PPi is produced in the amplification process, the color development reaction visible to the naked eye can be used to diagnose SARS-CoV-2 nucleic acid, and the detection limit can reach 240 copies / mL. In one embodiment of the present application, all 6 groups of viral clinical samples were correctly detected. This new concept of nucleic acid detection mode does not rely on fluorescent probes and fluorescent instruments, effectively saving costs. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 Figure 1 is an electron micrograph of the iron-manganese silicate nanoszyme of Example 1 of the present application, wherein the scale length is 100 nm.

[0033] Figure 2 Figure 2 is a schematic diagram of the detection principle of IMSN of the present application.

[0034] Figure 3 Figure 3 is a data graph of the PPi inhibition of IMSN catalyzed TMB color development in Example 2 of the present application.

[0035] Figure 4 Figure 4 is a result graph of using IMSN to detect PCR amplification products in Example 2 of the present application. The data shown in the figure are mean ± standard deviation, and the significance difference of each group was analyzed by One-way ANOVA, **** represents the significance analysis result P<0.0001.

[0036] Figure 5 Figure 5 is a sensitivity test result graph of using IMSN to detect PCR amplification products in Example 2 of the present application. The significance difference of each group was analyzed by One-way ANOVA, **** represents the significance analysis result P<0.0001.

[0037] Figure 6 Figure 6 is a flow chart of nucleic acid detection based on IMSN.

[0038] Figure 7 Figure 7 is a detection result of using IMSN to detect clinical samples in Example 3 of the present application. DETAILED DESCRIPTION

[0039] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0040] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0041] The equipment used in the following examples is shown in Table 1:

[0042] Equipment used in Table 1

[0043]

[0044] The reagents used in the following examples are shown in Table 2:

[0045] Reagents used in Table 2

[0046]

[0047] Experimental Example 1

[0048] Mesoporous silica nanoparticles are dissolved in water, and an aqueous solution containing metal salts of iron and manganese elements and NH4Cl and ammonia water with a concentration of 25-28 wt% are added, wherein the molar ratio of mesoporous silica nanoparticles, metal salts containing iron and manganese elements, NH4Cl, ammonia water with a concentration of 25-28 wt%, water is 1:0.2-1.5:3-54:7-30:2000-7000; the above solution is stirred for 3-10 min and then transferred to a hydrothermal reactor, and hydrothermal reaction is carried out at 120-160°C for 8-24 h, followed by centrifugation, washing and drying, to obtain the iron-manganese silicate nanoscale enzyme. The iron-manganese silicate nanoscale enzyme has peroxidase activity.

[0049] The iron manganese silicate nanoscale enzyme used in this embodiment is obtained by the above method. Specifically, 30 mg of mesoporous silica nanoparticles (prepared according to the method described in patent application CN106517216A) is uniformly dispersed in 15 mL of ultrapure water and placed on a magnetic stirrer for gentle stirring. 0.15 mmol of MnCl2, 18 mmol of NH4Cl, and 0.3 mmol of FeSO4·7H2O are sequentially weighed and dispersed in 15 mL of ultrapure water, and rapidly stirred on a magnetic stirrer while adding 700 μL of ammonia water (25 wt%). After uniform stirring, it is immediately poured into the silica nanoparticle aqueous solution, stirred for 5 min, and then transferred to a 50 mL hydrothermal reactor. Hydrothermal reaction is carried out at 140℃ for 12 h. After the reaction is completed, centrifugal washing is performed, and water and ethanol are used for alternating washing for 5 times. After drying in a constant temperature drying oven at 60℃, the iron manganese silicate nanoscale enzyme is obtained. The diameter of the obtained iron manganese silicate nanoscale enzyme is about 100 nm, and the electron microscope image is shown in FIG. 1. Figure 1 .

[0050] Example 2

[0051] The nucleic acid detection method developed by the present application is based on the peroxidase activity of the iron manganese silicate nanoscale enzyme. In the presence of H2O2, it can catalyze the oxidation of TMB to blue oxTMB. This color development reaction will be inhibited by the pyrophosphate generated in the DNA amplification process.

[0052] The schematic diagram of the IMSN detection principle is shown in FIG. 2. Figure 2 : The IMSN exhibits good POD-like enzyme activity and can catalyze the decomposition of H2O2 to produce hydroxyl radicals. The hydroxyl radicals produced by the decomposition of H2O2 can oxidize colorless TMB to blue oxTMB. PPi can inhibit the generation of hydroxyl radicals and inhibit the color development of TMB, so this color development reaction can be used for colorimetric detection of pyrophosphate (PPi).

[0053] 1. PPi inhibits IMSN catalyzed TMB color development

[0054] In an acidic environment, the color development reaction of the iron manganese silicate nanoscale enzyme catalyzing the oxidation of H2O2 and the color development substrate is used to rapidly detect PPi by inhibiting the activity of the nanoscale enzyme.

[0055] The iron manganese silicate nanoscale enzyme used is the iron manganese silicate nanoscale enzyme prepared in Example 1.

[0056] Two groups of treatments are set up:

[0057] 1.1 TMB+H2O2+IMSN: The water solution of iron-manganese silicate nanoscale enzyme (100 pg / mL) without pyrophosphate (PPi) was used as the test sample 1, and the test sample 1 was added to the 0.1 mmol / L acetate buffer (pH 4.5) containing TMB (1664 pmol / L) and H2O2 (0.1 mmol / L). The test sample 1 did not contain PPi, and in the presence of H2O2, the iron-manganese silicate nanoscale enzyme with peroxidase-like activity catalyzed the oxidation of TMB to develop color, and the solution turned blue. After 15 minutes of reaction, the absorbance of the sample was measured by UV-vis-NIR spectrophotometer.

[0058] 1.2 TMB+H2O2+IMSN+PPi: The test sample 2 was obtained by mixing the pyrophosphate (PPi) solution and the iron-manganese silicate nanoscale enzyme solution, and the concentration of pyrophosphate (PPi) in the test sample 2 was (20 pmol / L), and the concentration of iron-manganese silicate nanoscale enzyme was 100 pg / mL. Then the test sample 2 was added to the 0.1 mmol / L acetate buffer (pH 4.5) containing TMB (1664 pmol / L) and H2O2 (0.1 mmol / L). The test sample 2 contained PPi, which would complex with iron in the iron-manganese silicate nanoscale enzyme to inhibit the peroxidase-like activity of the iron-manganese silicate nanoscale enzyme, and the color development of TMB was inhibited. After 15 minutes of reaction, the absorbance of the sample was measured by UV-vis-NIR spectrophotometer.

[0059] Each group of treatments was set up in triplicate, and after 15 minutes of reaction, the OD value was detected by UV-vis-NIR spectrophotometer at 550-750 nm, and the results are shown in Figure 3 , which shows that the OD values of TMB+H2O2+IMSN and TMB+H2O2+IMSN+PPi are the most different at 652 nm, and the detection wavelength of the colorimetric method for detecting PPi is set to 652 nm.

[0060] 2. Detection of PCR products by color development reaction of IMSN

[0061] Generally, a normal PCR reaction can convert mM level of dNTP to PPi, and even after dilution by 4 times, the PPi produced in the amplification process is enough to inhibit the color development of TMB catalyzed by IMSN.

[0062] The inventors characterized two groups of samples by electrophoresis, one group of samples was subjected to PCR reaction without adding ORF1ab gene target, and the other group of samples was subjected to PCR reaction with adding ORF1ab gene target, and then the products of PCR reaction were detected by IMSN, and the specific settings are as follows:

[0063] 1) Control (samples without the addition of ORF1ab gene targets, marked as -): No ORF1ab gene targets were added in the PCR reaction system.

[0064] 2) Treatment (samples with the addition of ORF1ab gene targets, marked as +): ORF1ab gene targets with a concentration of 1 nM were added in the PCR reaction system, and the sequence of the ORF1ab gene targets was as follows:

[0065] 5'-CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT-3'.

[0066] The PCR reaction system used is shown in Table 3:

[0067] Table 3 PCR system (50 μL)

[0068]

[0069]

[0070] The upstream primer for amplifying the ORF1ab gene is ORF-F, and the downstream primer is ORF-R:

[0071] REF-F: 5'-AGATTTGGACCTGCGAGC-3';

[0072] REF-R: 5'-GAGCGGCTGTCTCCACAAGT-3'.

[0073] The components in Table 3 were added to the PCR tube, mixed thoroughly, and then transferred to the PCR instrument. The PCR program was as follows: 98℃ for 30s; cycle stage 99℃ for 10s, 50℃ for 30s, 72℃ for 30s, cycle 28 times; 72℃ for 3min.

[0074] Three groups of parallel controls were set for each treatment group, and the bands of the PCR products of the two treatment groups were characterized by electrophoresis, and the amplification products were detected by IMSN. The IMSN color developing system is shown in Table 4:

[0075] Table 4 IMSN color developing system (250 μL)

[0076] Component Amount Final concentration IMSN (2 mg / mL) 2 μL 100 μg / ml PCR product 50 μL PPi: 7-16 uM, dNTP: 1-9 uM TMB 2.5 μL 1664 uM H2O2 2.5 μL 0.1 mM NaAc buffer (PH 4.5) 182.5 μL

[0077] The color difference can be observed by naked eye after 15 min of reaction at room temperature. At this time, 100 μL of reaction solution of each gene amplification product was taken from three parallel samples and added to a 96-well plate, and the absorbance at 652 nm was measured by an enzyme-labeled instrument.

[0078] The results are shown in Figure 4 As expected, the color development of the reaction solution in which the target was amplified was obviously inhibited, proving that it is feasible to detect target nucleic acids by detecting PPi generated in the PCR process.

[0079] 3. Sensitivity of IMSN color development reaction for detecting PCR products

[0080] The method in the above 2 was used to detect PCR products by IMSN color development reaction. The DNA template concentration in the PCR system was only adjusted in a gradient. DNA templates with concentrations of 24000, 2400, 240, 24, and 0 copies / mL were amplified, respectively. Except for the DNA template concentration, other components of the PCR system, PCR program, and IMSN color development system remained unchanged. The results are shown in Figure 6 , which indicates that when the DNA template concentration is 240 copies / mL, the PCR product can still inhibit the TMB color development catalyzed by IMSN, and therefore the detection limit can reach 240 copies / mL.

[0081] Even if the target concentration is very low, the number of PPi will increase exponentially with the progress of amplification, so IMSN has high sensitivity for detecting PCR amplification products, and the minimum detection limit can reach 240 copies / mL, reaching the requirement of the National Health Commission of the People's Republic of China for high-sensitivity nucleic acid detection reagents (500 copies / mL).

[0082] Example 3

[0083] According to the results of Example 2, the inventors developed an IMSN-based nucleic acid detection method, and the flowchart is shown in Figure 6 The inventors used this detection system to detect clinical samples (throat swabs) of novel coronavirus infected persons and healthy controls. The experiment was completed in the P3 laboratory of Huada Gene.

[0084] A total of 6 throat swabs of novel coronavirus infected persons and 6 throat swabs of healthy controls were collected as detection sample queues. Each sample was detected for the ORF1ab gene, N gene of SARS-CoV-2, and RNase P gene as an internal reference by the IMSN-based nucleic acid detection method of the present application, which specifically includes the following steps:

[0085] (1) Throat swab collection: The swab was quickly wiped against the tonsils and the posterior wall of the pharynx, and then the swab was put into a preservation solution (from the PureLink RNA Mini Kit kit, item number: 12183020), and the swab rod was broken to make it completely placed in the tube.

[0086] (2) Extraction and purification of RNA: After adding the lysis solution to the tube of step (1), it was transferred to an extraction column, centrifuged, and then elution solution I and elution solution II were sequentially added and centrifuged, respectively. Finally, 50 μL of RNase water was added and centrifuged to collect the RNA. This process was carried out on ice. The lysis solution, elution solution I and elution solution II were all from the PureLink RNA Mini Kit kit (item number: 12183020).

[0087] (3) RT-PCR amplification of target genes: The RT-PCR used a one-step RT-PCR kit (QIAGEN OneStep RT-PCR Kit, item number 210212). The components of the RT-PCR system (50 μL) in Table 5 were added to the EP tubes, respectively, and mixed well, and then the EP tubes were placed in a PCR instrument to amplify the ORF1ab gene, N gene and RNase P gene, respectively.

[0088] Table 5 RT-PCR system (50 μL)

[0089]

[0090]

[0091] Among them, the upstream primer for amplifying the ORF1ab gene is ORF-F, and the downstream primer is ORF-R; the upstream primer for amplifying the N gene is N-F, and the downstream primer is N-R; the upstream primer for amplifying the RNase P gene is RNase P-F, and the downstream primer is RNase P-R. The specific primer sequences are shown in Table 6.

[0092] Table 6 Primer sequences

[0093] ORF-F 5'-CCCTGTGGGTTTTACACTTAA-3' ORF-R 5'-ACGATTGTGCATCAGCTGA-3' N-F 5'-GGGGAACTTCTCCTGCTAGAAT-3' N-R 5'-CAGACATTTTGCTCTCAAGCTG-3' RNase P-F 5'-AGATTTGGACCTGCGAGC-3' RNase P-R 5'-GAGCGGCTGTCTCCACAAGT-3'

[0094] The PCR program is: 50°C for 30 min; 95°C for 15 min; cycle stage 94°C for 45 s, 51°C for 45 s, 72°C for 1 min, cycle 30 times, 72°C for 10 min; 4°C holding.

[0095] Each gene was made in triplicate.

[0096] (4) Detection of amplification products by IMSN: The components of the IMSN color developing system (250 μL) in Table 7 were added to the centrifuge tubes, respectively:

[0097] Table 7 IMSN color developing system (250 μL)

[0098] Component Amount Final concentration. IMSN (2 mg / ml) 12.5 μL 100 μg / ml RT-PCR product 50 μL PPi: 7-16 uM, dNTP: 1-9 uM TMB 2.5 μL 1664 uM H2O2 2.5 μL 0.1 mM NaAc buffer (PH 4) 182.5 μL

[0099] The color difference can be observed by naked eyes after 15 min of reaction at room temperature. At this time, 100 μL of reaction solution of each gene amplification product was taken from three parallel samples and added to a 96-well plate, and the absorbance at 652 nm was measured by an enzyme-labeled instrument.

[0100] The results are shown in Table 8. Figure 7 The ORF1ab gene, N gene and RNase P gene in the throat swab sample of the novel coronavirus infected person all produced a large amount of PPi in the amplification process, thus obviously inhibiting the color developing reaction of the IMSN detection system. Only the amplification product of the RNase P gene in the healthy sample obviously inhibited the color developing reaction. Finally, the nucleic acid detection results of the novel coronavirus infected person sample and the healthy control sample can be obviously distinguished by naked eyes. The ORF1lab and N tubes of the negative sample both normally developed color, while the RNase P tube did not develop color. The three tubes of the positive sample all did not develop color. The results of the color developing reaction depend on the accuracy of RT-PCR, especially the RT-PCR product can be obviously distinguished after 15 min of color developing. In general, the use of IMSN colorimetric detection of nucleic acid can complete the accurate diagnosis of the novel coronavirus infected person.

[0101] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, the present application is intended to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. The application of iron-manganese silicate nanozymes in the preparation of products for nucleic acid detection, characterized by: The iron-manganese silicate nanozyme is a nanozyme with peroxidase-like activity obtained by incorporating iron and manganese ions into mesoporous silica nanoparticles under hydrothermal conditions. The nucleic acid is derived from any one of humans, non-human animals, plants, microorganisms, fungi, bacteria, and viruses. The iron-manganese silicate nanozyme was prepared by the following method: Mesoporous silica nanoparticles were dissolved in water, and an aqueous solution containing iron and manganese metal salts and NH4Cl, as well as ammonia solution with a concentration of 25-28 wt%, were added. The molar ratio of mesoporous silica nanoparticles, iron and manganese metal salts, NH4Cl, ammonia solution with a concentration of 25-28 wt%, and water was 1 : 0.2~1.5 : 3~54 : 7~30 : 2000~7000. After mixing, the mixture was reacted at 120~160℃ for 8~24 h, centrifuged, washed, and dried to obtain the iron-manganese silicate nanoenzyme. The nucleic acid is detected by PCR.

2. The application according to claim 1, characterized in that: The product of claim 1 contains reagents; the reagents include PCR reaction reagents for target nucleic acid detection and iron-manganese silicate nanozyme catalytic colorimetric reagents; the PCR reaction reagents for target nucleic acid detection contain primer pairs for amplifying target nucleic acids.

3. The application according to claim 2, characterized in that: The PCR reaction reagent for target nucleic acid detection also includes primer pairs for amplifying internal reference nucleic acid.

4. The application according to claim 1, characterized in that: The product mentioned is for detecting nucleic acid of the novel coronavirus.

5. The application according to claim 4, characterized in that: The PCR reaction reagent used for target nucleic acid detection in the product for detecting novel coronavirus nucleic acid is an RT-PCR reaction reagent.

6. The application according to claim 5, characterized in that: The RT-PCR reaction reagent contains primer pairs for amplifying the ORF1ab gene of SARS-CoV-2 and / or primer pairs for amplifying the N gene of SARS-CoV-2; the primer pairs for amplifying the ORF1ab gene of SARS-CoV-2 consist of single-stranded DNA with nucleotide sequences as shown in Sequence 1 and single-stranded DNA with nucleotide sequences as shown in Sequence 2; the primer pairs for amplifying the N gene of SARS-CoV-2 consist of single-stranded DNA with nucleotide sequences as shown in Sequence 3 and single-stranded DNA with nucleotide sequences as shown in Sequence 4.

7. The application according to any one of claims 2-6, characterized in that: The iron-manganese silicate nanozyme catalytic colorimetric reagent contains iron-manganese silicate nanozyme, TMB, and H2O2.

8. A reagent for detecting nucleic acid of the novel coronavirus, characterized in that: The reagents include RT-PCR reaction reagents for novel coronavirus nucleic acid detection and iron-manganese silicate nanozyme catalytic colorimetric reagents; the iron-manganese silicate nanozyme catalytic colorimetric reagents contain iron-manganese silicate nanozymes, which are prepared by the following method: Mesoporous silica nanoparticles were dissolved in water, and an aqueous solution containing iron and manganese metal salts and NH4Cl, as well as ammonia solution with a concentration of 25-28 wt%, were added. The molar ratio of the mesoporous silica nanoparticles, the iron and manganese metal salts, NH4Cl, ammonia solution with a concentration of 25-28 wt%, and water was 1 : 0.2~1.5 : 3~54 : 7~30 : 2000~7000. After mixing, the mixture was reacted at 120~160℃ for 8~24 h. After centrifugation, washing, and drying, the iron-manganese silicate nanozyme was obtained.

9. The reagent according to claim 8, characterized in that: The RT-PCR reaction reagent contains primer pairs for amplifying the ORF1ab gene of SARS-CoV-2 and / or primer pairs for amplifying the N gene of SARS-CoV-2, and the iron-manganese silicate nanozyme catalytic colorimetric reagent contains iron-manganese silicate nanozyme, TMB and H2O2.

Citation Information

Patent Citations

  • Biodegradable mesoporous carbon and silicon nano-sphere and method for preparing same

    CN106517216A