A Paenibacillus strain with high glucoamylase productivity and its uses

Abstract

The present invention belongs to the field of microbial technology, and specifically discloses a Paenibacillus strain with high glucoamylase productivity and its uses. This Paenibacillus strain is deposited in the China General Microbiological Culture Collection Center, with the deposit number of CGMCC No. 25236. For the Paenibacillus strain provided by the present invention, its glucoamylase can exhibit activity at 70 °C, and the enzyme activity can reach 2225 U / mL at this time.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically discloses a Paenibacillus strain with high saccharifying enzyme production and application thereof. Background Art

[0002] With the improvement of living standards, people's pursuit of the quality of liquor has become stronger, so the liquor industry is developing in the direction of health, elegance and nobility. There are many types of liquor, among which the brewing process of Luzhou-flavor liquor has been passed down and accumulated for hundreds of years. It is the crystallization of the wisdom and skills of generations of hard-working people. The brewing process of Luzhou-flavor liquor has very high requirements, and its process technology affects the output and quality of liquor. Therefore, in the production of Luzhou-flavor liquor, its brewing process is very important.

[0003] Luzhou-flavor liquor is made from high-quality grains and cereals as the initial raw materials through traditional brewing methods. It does not add any external aromatic substances, but relies on ethyl hexanoate as the main aroma. The main brewing process is: (1) processing of initial raw materials; (2) uncellaring; (3) batching and mixing; (4) steaming grains; (5) adding water and drying; (6) fermentation of mash; (7) cellaring and sealing. At present, various metabolites in the fermentation process of liquor are mainly derived from microorganisms. Therefore, if we can understand its microorganisms from many aspects, it will have important and far-reaching significance for improving the various flavor qualities of liquor. In the brewing process of Luzhou-flavor liquor, step (6) is the main process of saccharification by various microbial fermentation in liquor. The types, concentrations and mutual proportions of trace aroma components in liquor can make liquor present various characteristics. The research and application of adding enzyme preparations to the liquor brewing system to improve the quality of liquor, increase the yield and enhance the unique style of liquor in some aspects are becoming more and more extensive. Subsequently, researchers began to devote themselves to research in this area and discovered that one of the important enzymes, namely saccharifying enzyme, is also called glucoamylase, which is an important enzyme preparation for the saccharification of starch raw materials. Glucoamylase can hydrolyze the α-1,4 bonds of starch and release its α-1,6 glucoside bonds, releasing β-D-glucose from the non-reducing end of starch. It can completely degrade starch into glucose and increase the yield of wine.

[0004] Glucoamylase has been widely used in the fields of food, medicine, etc., and can be used to produce monosodium glutamate, organic acids, amino acids, etc. An important source of glucoamylase is microorganisms. Foreign researchers screened strains producing glucoamylase from Xiaoqu for Chinese liquor in 1982, but in China, there was news about the screening and cultivation of related strains only in the early 1930s. In addition to Chinese liquor samples, researchers also searched for more effective glucoamylase-producing strains from other samples. Some researchers isolated a glucoamylase-producing strain L-3 from samples such as soil and mildewed starchy materials, and it was identified as a Monascus purpureus. Some researchers used the sea mud in the Bohai Bay as a sample and isolated a strain producing low-temperature raw starch glucoamylase from it. It was identified as Aeromonas, and then the enzymatic properties of this bacterium were studied, and it was found that the optimal temperature for enzyme activity was 30 °C and the optimal pH was 5.4. Liu Yanbo et al. obtained a strain with high glucoamylase production for the production of fortified Daqu after screening, and this strain was identified as Bacillus. In addition, Huang Wenguang et al. isolated and screened a strain of Aspergillus niger with strong glucoamylase production ability from rotten sweet potatoes, and carried out ultraviolet mutagenesis. It was found that the enzyme activity before mutagenesis was 55.10 U / mL, and after mutagenesis, its enzyme activity increased by 36.70%. After further mutagenesis with nitrosoguanidine, the enzyme activity reached 116.84 U / mL. After that, others isolated a strain from rotten cassava, which was preliminarily identified as Aspergillus niger, and its enzyme activity was detected to be 495.04 U / mL. There were also researchers who isolated a strain with high glucoamylase production from the soil around a starch products factory, and it was identified as Cellulomonas. Its optimal enzyme production conditions were pH 7.0, and the enzyme activity reached 176.7 U / mL at 30 °C. However, the enzyme activity of the currently screened glucoamylase-producing strains is not very high. It is necessary to obtain glucoamylase-producing strains with higher enzyme activity, which is of great significance for improving the utilization rate of raw materials and improving the flavor of Chinese liquor. Summary of the Invention

[0005] In view of the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides a Paenibacillus strain with high glucoamylase production, which is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 25236.

[0007] Another object of the present invention is to provide the use of the Paenibacillus strain in the production of glucoamylase.

[0008] Another object of the present invention is to provide the use of the Paenibacillus strain in the fermentation of Chinese liquor.

[0009] Another object of the present invention is to provide a fermentation method of the Paenibacillus strain, including the following steps: inoculating the Paenibacillus strain into a fermentation liquid medium, culturing it on a shaker at 30 °C for 12-72 h to obtain the fermentation broth of the Paenibacillus strain.

[0010] Another object of the present invention is to provide a fermentation broth obtained according to the above method.

[0011] Another object of the present invention is to provide a microbial inoculum for producing glucoamylase, which comprises the said Paenibacillus and / or the said fermentation broth, and acceptable excipients or carriers.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0013] 1. The present invention provides a Paenibacillus strain with high glucoamylase production. The glucoamylase produced by this strain can exhibit activity at 70 °C, and the enzyme activity can reach 2225 U / mL at this time.

[0014] 2. The present invention performs whole-genome sequencing on the Paenibacillus strain with high glucoamylase production and finds that the number of genes related to transcription, translation, catalytic activity, etc. in this strain is significantly larger, indicating that the strain has good genetic characteristics; by comparing the nucleic acid sequence of the strain with various databases, it is found that the genes of various proteolytic enzymes, etc. are relatively enriched in it, further determining that the enzyme secretion ability of this bacterium is relatively strong and it can be used for industrial production of glucoamylase.

[0015] Description of biological preservation information:

[0016] Biological material: TS-5, taxonomic name: Paenibacillus, Latin name: Paenibacillus SP. This strain was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on July 6, 2022, with the deposit number: CGMCC No. 25236, and the deposit address: No. 1, Beichen West Road, Chaoyang District, Beijing. Description of the drawings

[0017] Figure 1 is the transparent circle of the glucoamylase-producing strain;

[0018] Figure 2 is the determination result of the glucoamylase activity of 9 strains;

[0019] Figure 3 is the influence of pH on the glucoamylase activity of strain TS-1;

[0020] Figure 4 is the influence of pH on the glucoamylase activity of strain TS-5;

[0021] Figure 5 is the influence of pH on the glucoamylase activity of strain TS-6;

[0022] Figure 6 is the influence of temperature on the glucoamylase activity of strain TS-1;

[0023] Figure 7 Effect of temperature on glucoamylase activity of TS-5 strain

[0024] Figure 8 Effect of temperature on glucoamylase activity of TS-6 strain

[0025] Figure 9 Colony PCR results of 16S rDNA of the strain

[0026] Figure 10 Phylogenetic tree of 16S rDNA of 9 glucoamylase-producing strains

[0027] Figure 11 Results of cellulose degradation by glucoamylase-producing strain TS-5; there are 6 parallels in the figure

[0028] Figure 12 Results of hemicellulose degradation by glucoamylase-producing strain TS-5

[0029] Figure 13 Growth of TS-5 with different monosaccharides as substrates; A: Growth of TS-5 with xylose as carbon source; B: Growth of TS-5 with arabinose as carbon source; C: Growth of TS-5 with glucose as carbon source

[0030] Figure 14 Example of clear zone of the strain after ARTP mutagenesis, the negative control is within the frame

[0031] Figure 15 Difference in starch-degrading activity of glucoamylase before and after mutagenesis

[0032] Figure 16 Comparison of glucoamylase activity between mutagenized and non-mutagenized strains

[0033] Figure 17 GO functional classification of gene function annotation of TS-5

[0034] Figure 18 CAZy functional classification of TS-5 strain and statistical count of corresponding gene numbers

[0035] Figure 19 Starch, cellulose and hemicellulose metabolic pathways of TS-5 strain Detailed implementation manners

[0036] The present invention is further illustrated in combination with examples and corresponding drawings. The following examples are only for illustrative purposes and do not limit the scope of the present invention.

[0037] Example 1

[0038] Screening of glucoamylase-producing strains in the pit mud of Luzhou-flavor liquor

[0039] 1. Experimental methods

[0040] 1.1 Preparation of culture media

[0041] 1) Primary screening solid / liquid culture media for glucoamylase-producing strains:

[0042] Soluble starch 20 - 30 g, sodium nitrate 2.0 g, dipotassium hydrogen phosphate 1.0 - 1.5 g, magnesium sulfate heptahydrate 0.5 g, potassium chloride 0.5 g, ferrous sulfate 0.01 g, agar 20.0 g, made up to 1000 mL with water (sterilized at 121 °C for 20 min).

[0043] 2) Liquid fermentation culture medium for glucoamylase-producing strains:

[0044] Soluble starch 20 g, sodium nitrate 2.0 g, dipotassium hydrogen phosphate 1.5 g, magnesium sulfate heptahydrate 0.5 g, potassium chloride 0.5 g, ferrous sulfate 0.01 g, agar 20.0 g, made up to 1 L with water (sterilized at 121 °C for 20 min).

[0045] 1.2 Preparation of glucose standard curve

[0046] Glucose standard solution (1 mg / mL): Weigh 0.05 g of glucose and dissolve it in distilled water (50 mL), mix well. Measure the absorbance of the glucose standard solution: Take appropriate test tubes, accurately calculate and then add the standard solution and reagents, keep in a boiling water bath for 5 min, and then add 4 mL of distilled water. Measure the OD values of the test tubes at 540 nm respectively (the control group is tube No. 0), set up three parallels, with OD 540 as the horizontal axis and glucose concentration as the vertical axis, draw its glucose standard curve, and find the regression equation.

[0047] 1.3 Screening of glucoamylase-producing strains

[0048] Take out the Luzhou-flavor liquor pit mud sample from the -80 °C refrigerator, weigh 10 g of pit mud into a 250 mL conical flask, add 90 mL of sterile water, shake well and incubate in a constant temperature shaker at 30 °C and 180 r / min for 1 hour, then perform gradient dilution (undiluted bacterial solution, 10 -1 、10 -2 、10 -3 、10 -4 、10 -5) Absorb 100 μL respectively, spread it evenly on the plate, and culture it at 30 °C for 2 - 3 days. Observe whether a transparent circle appears around the colony after starch degradation. The specific method for observing the transparent circle is as follows: Weigh 0.4 g of iodine particles and grind them into powder. On the sterile operating table, place the iodine particles evenly on the lid of the petri dish, then invert the petri dish on the lid of the petri dish. Wait for ten minutes, and transparent circles of different sizes will appear. The size of the transparent circles can be seen with the naked eye.

[0049] After observation, 9 strains with larger transparent circles were screened (labeled as: TS-1, TS-2, TS-3, TS-4, TS-5, TS-6, TS-7, TS-8, TS-9 respectively). The diameter ratios of the transparent circles are (cm): 1.35 / 0.65, 1.27 / 0.65, 1.35 / 0.65, 1.27 / 0.65, 1.35 / 0.65, 1.37 / 0.65, 1.35 / 0.65, 1.27 / 0.65, 1.36 / 0.65. As Figure 1 shown.

[0050] Purify the 9 obtained strains (in a 250 mL Erlenmeyer flask, the liquid loading is 25 mL), culture them at 30 °C for 48 h. After obtaining a single colony plate with a transparent circle, prepare 20 - 25% glycerol for bacteria preservation and store for later use.

[0051] 1.4 Determination of the enzyme activity of glucoamylase-producing strains

[0052] 1) Preparation of citric acid-sodium citrate buffer solution

[0053] Take 21.01 g of citric acid and 29.412 g of sodium citrate, and prepare a citric acid-sodium citrate buffer solution with a pH of 5.4.

[0054] 2) Preparation of crude enzyme solution of glucoamylase-producing strains

[0055] For the 9 purified glucoamylase-producing strains, use the three-zone streaking method on the primary screening and isolation medium in 1.1, and culture them in a constant temperature incubator at 30 °C for 2 - 3 days. After single colonies grow, pick the nine glucoamylase-producing strains and put them into the corresponding and well-labeled fermentation medium, and cultivate them in a constant temperature shaker at 30 °C for 7 days. Then centrifuge them respectively in a high-speed refrigerated centrifuge at 4000 g for 10 min. The supernatant is the crude enzyme solution.

[0056] 3) Adjustment of spectrophotometric instrument

[0057] Adjust the light intensity to 540 nm and preheat for 20 min in advance.

[0058] A. Enzyme activity calculation formula

[0059] The 3,5-dinitrosalicylic acid method (DNS method) was selected for the determination of glucoamylase enzyme activity. The principle is as follows: Starch is decomposed into reducing sugars such as glucose under certain conditions, which combines with 3,5-dinitrosalicylic acid to produce a certain color reaction. The absorbance value at 540 nm is measured to calculate the enzyme activity.

[0060] B. Definition of enzyme activity unit

[0061] Under the analysis conditions, the amount of enzyme required to release 1 μg of reducing sugar (calculated as glucose) per minute is defined as 1 enzyme activity unit.

[0062] As Figure 2 shown, in terms of enzyme activity, TS-1, TS-5, and TS-6 are strains with relatively high enzyme activity, and their enzyme activities are 1944.5 U / mL, 2208.9 U / mL, and 2815.6 U / mL respectively.

[0063] 1.5. Effect of different pH values on glucoamylase enzyme activity

[0064] Add 2 mL of the same starch suspension to a stoppered colorimetric tube, add 2 mL of 0.1 mol / L citric acid buffer solution with nine different pH values of 3.2, 3.8, 4.4, 5, 5.6, 6.2, 6.8, 7.4, and 8.0, preheat in a 30 °C water bath for 10 min, add 1 mL of enzyme solution, after incubating for 10 min, add 2 mL of 3,5-dinitrosalicylic acid, boil for 5 min, immediately cool after taking out, make up the volume, use a test tube without adding enzyme solution as a blank control, and measure its absorbance at 540 nm.

[0065] Through the detection of enzyme activity at different pH values, it was found that the optimal pH of strain TS-1 is 3.8, the optimal pH of TS-6 is 5.6, and the optimal pH of TS-5 is 8.0. The results are as Figures 3 - 5 shown.

[0066] 1.6. Effect of different temperatures on glucoamylase enzyme activity

[0067] With other conditions unchanged, the temperatures are set to five different temperatures of 30 °C, 40 °C, 50 °C, 60 °C, and 70 °C respectively. Preheat in a water bath at these five different temperatures for 10 min, then add 1 mL of enzyme solution, shake and react at the corresponding temperature (180 r / min) for 10 min, add 2 mL of 3,5-dinitrosalicylic acid, boil in boiling water for 5 min, cool, make up the volume to 20 mL, add a blank control, and record the absorbance.

[0068] The results showed that the enzyme activity of TS-5 was the highest at 70 °C, and the optimal temperatures of TS-1 and TS-6 were both 40 °C, as Figures 6 - 8 shown.

[0069] Example 2

[0070] Identification of nine strains: TS-1, TS-2, TS-3, TS-4, TS-5, TS-6, TS-7, TS-8, and TS-9

[0071] 1. Identification of glucoamylase-producing strains

[0072] 16S rDNA primers: Forward primer P1 (5′-AGAGTTTGATCCTGGCTCAG-3′) and reverse primer P2 (5′-AAGTCGTAACAAGGTAACC-3′) were used for PCR amplification. The PCR system (50 μL): Prepare 23 μL of sterile water, 5 μL of 10× easy-taq buff, 0.5 μL of easy-taq, 5 μL of dNTP, 2 μL of upstream primer 1492R (5-3TACGGYTACCTTGTTAYGACTT), 2 μL of downstream primer 27F (5-3AGAGTTTGATCCTGGCTCAG), and 12.5 μL of bacterial solution. Incubate at 94°C for 5 min - (94°C for 1 min, 55°C for 1 min, 72°C for 1.5 min) for 30 cycles - 72°C for 5 min. Weigh 0.2 g of agarose, add 20 mL of 1× TAE, heat until the liquid is clear, cool slightly until it can be touched, add 1 μL of nucleic acid dye, and slowly pour it into the gel running tank, preferably without air bubbles. After solidification, add 2.5 μL of 15000 bp Marker to the first gel well, and add a mixture of 3 μL of the sample and 1 μL of Loading buffer to each gel well. Turn on the gel running device, set the current to 120 A, click run, and start gel running. The result is as Figure 9 shown, about 1500 bp in length.

[0073] 16s rDNA sequence:

[0074]

[0075] 2. Construction of the phylogenetic tree of glucoamylase-producing strains

[0076] The PCR products were sent to Tsingke Biotechnology Service Co., Ltd. for sequencing to obtain the 16S rDNA nucleotide sequences of these strains. They were input into GenBank for BLAST alignment to obtain the strains with high similarity to the strain gene sequences. ClustalX was used for multiple sequence matching alignment, and MEGAX software was used to calculate the phylogenetic distance of the sequences. The neighbor-joining method was used to construct the phylogenetic tree, and the results are as Figure 10 shown.

[0077] Upon identification, strains TS-1, TS-3, TS-4, TS-5, TS-6, TS-7, and TS-8 all belong to Paenibacillus, with the Latin name Paenibacillus SP.; TS-2 and TS-9 both belong to Bacillus, with the Latin name Bacillus sp.

[0078] Considering that in the market, one of the requirements during the application of glucoamylase in the food industry is heat resistance. Based on the above experiments, TS-5 can still maintain a relatively high enzyme activity at 70°C. It is considered that this strain may have the potential of an industrial strain. Therefore, TS-5 was continued to be explored in the next step.

[0079] Example 3

[0080] 1. Testing the utilization of different monosaccharides by strain TS-5

[0081] Fermentation liquid media were prepared with xylose, arabinose, and glucose as the sole carbon sources respectively, sterilized and dispensed for later use; single colonies of strain TS-5 were picked and cultured in 5 mL of fermentation medium until the OD600 reached 0.6 - 0.8. According to the principle of 1% (V / V) inoculation amount, 1 mL was pipetted into a conical flask with 100 mL of fermentation broth, and the OD 600 value was measured under a spectrophotometer and recorded.

[0082] 2. Testing the ability of strain TS-5 to degrade cellulose

[0083] The prepared glucoamylase-producing strain TS-5 was picked with a single colony into a liquid medium, and then the bacterial solution was serially diluted and spread on CMC2 plates (selecting the bacterial suspension with an appropriate dilution factor, diluted to 10 -4 ~10 -5) Place the plate in a constant temperature incubator at 30 °C for 2 - 3 days. After single colonies appear, use a sterilized toothpick to pick up single colonies and dot them on the medium for staining and observation. Place the plate in a constant temperature incubator at 30 °C for 2 - 3 d. The specific method of Congo red staining is as follows: Wash the colonies with 70% alcohol, soak them in 0.1% Congo red for 30 min, decolorize with 1 M NaCl solution for 30 min, and observe whether there is a transparent circle formed around the single colonies after cellulose degradation.

[0084] 3. Test the ability of strain TS-5 to degrade hemicellulose

[0085] Pick a single colony of the glucoamylase-producing strain TS-5 into its liquid enrichment medium, dilute the bacterial solution, and spread it on a plate (it is appropriate to have uniform single colonies on the plate. In this experiment, dilute it to 10 -4 -10 -5 ). Place the plate in a constant temperature incubator at 30 °C for 2 - 3 days. Spread the glucoamylase-producing strain TS-5 on the plate and place it in a constant temperature incubator at 30 °C for 2 - 3 days. A transparent circle produced after hemicellulose degradation can be observed with the naked eye.

[0086] The results prove that the screened strain TS-5 can decompose cellulose and hemicellulose simultaneously, indicating that this strain has a rich hydrolase system. As Figures 11 - 12 shown.

[0087] Cultivate strain TS-5 in a medium with xylose, glucose, and arabinose as carbon sources, and it is found that this strain can utilize the above carbon sources. The results are as Figure 13 .

[0088] Example 4

[0089] Use ARTP technology to mutagenize strain TS-5 to improve the glucoamylase production ability

[0090] 1. Pretreatment before ARTP mutagenesis

[0091] Streak the glucoamylase-producing strain TS-5 on the selective medium for glucoamylase-producing strains, culture it at 30 °C for 2 - 3 days, pick a single colony into its liquid medium and culture it overnight until the OD600 reaches 0.8. Centrifuge at 6000 rpm for 5 min at 4 °C, discard the supernatant. Add 1 mL of sterile normal saline and vortex for 10 s, centrifuge, discard the supernatant, repeat twice, and finally add 1 mL of normal saline and vortex for 10 s to prepare a bacterial suspension.

[0092] 2. ARTP mutagenesis process

[0093] Take 10 μL of the bacterial solution and smear it evenly on a sterile metal gasket with a diameter of 6 mm. Then place it at the corresponding position of the ARTP mutagenesis instrument. After setting the mutagenesis conditions of the ARTP mutagenesis instrument, start directly. The mutagenesis conditions are as follows: The ARTP instrument is preheated for 30 min, the power is 120 W, the distance is 2 mm, the working gas flow rate is 10 SLM, helium is the working gas, and the mutagenesis time is 30 s. After the end, put the metal gasket into an EP tube containing 1 mL of 5% glycerol physiological saline, vortex for 60 s to resuspend the bacterial solution on the metal gasket, dilute the resuspended solution and spread it on the plate of the glucoamylase-producing strain, and place it in a constant temperature and humidity incubator at 30 °C for 3 days.

[0094] 3. Comparison of the clear zone size and enzyme activity of the strains before and after mutagenesis

[0095] The diluted TS-5 strain after ARTP mutagenesis was spread on the plate of the glucoamylase-producing strain medium and placed in a constant temperature and humidity incubator at 30 °C for 3 days. At the same time, the original strain (TS-5 strain before mutagenesis) was spread on the same selective medium under the same OD 600 under the same conditions. After 2-3 days, the above media were placed in a constant temperature incubator at 30 °C, and the generated clear zones were observed by iodine fumigation and compared with the original strain; at the same time, the optimal mutagenized strain was selected from the mutagenized strains and compared with the original strain in terms of enzyme activity and starch degradation activity.

[0096] It was found that both the clear zone size and enzyme activity of the mutagenized strains increased several-fold (the enzyme activity of the mutagenized strains was about 4800 U / mL). As Figures 14 - 16 shown.

[0097] Example 5

[0098] Whole-genome sequencing and analysis of strain TS-5 using third-generation sequencing technology

[0099] 1. Cultivation of strain TS-5

[0100] Take out the preserved TS-5 glucoamylase strain from the -80 °C freezer and streak it on the medium with starch as the sole carbon source using the three-zone streaking method, and culture it in an incubator at 30 °C for 2-3 days. After obtaining single colonies, pick one single colony and culture it in a liquid fermentation medium with starch as the sole carbon source, shake-culture it in a shaker at 30 °C for 72 h until the OD 600 is 0.6-0.8, centrifuge at 4000 rpm for 10 min in a high-speed refrigerated centrifuge, discard the upper-layer medium, and collect the lower-layer bacterial cells.

[0101] 2. Whole-genome sequencing

[0102] The cells of glucoamylase-producing strain TS-5 with quality meeting the sample submission standards were placed in an ultra-low temperature storage box at -80°C and sent to Novogene Bioinformatics Technology Co., Ltd., which extracted DNA and performed whole-genome sequencing on the glucoamylase-producing strain TS-5.

[0103] 3. Assembly

[0104] Use cloud tools of the China National Microbiology Data Center (version 2.04), sequence splicing software, paired-end sequencing short sequence assembly software, etc. for assembly, and finally use international information systems for merging.

[0105] 4. Genome sequence assembly

[0106] Use readfq (version 10) to filter the raw data of the glucoamylase-producing strain TS-5.

[0107] 5. Genome component analysis

[0108] 5.1. Coding gene prediction

[0109] Use multiple databases and software such as NCBI to predict the coding genes in the genome of the glucoamylase-producing strain TS-5.

[0110] 5.2. Repetitive sequence prediction

[0111] According to the distribution of repetitive sequences, they can be divided into interspersed repetitive sequences and tandem repetitive sequences; among them, they can also be divided into minisatellite DNA and microsatellite DNA. Use annotation (Version open-4.0.5) software and TRF (Tandem RepeaTS Finder, Version 4.07b) to predict interspersed repetitive sequences and tandem repetitive sequences in the glucoamylase-producing strain TS-5.

[0112] 5.3. Non-coding gene RNA prediction

[0113] Non-coding RNA (ncRNA) is the general term for genes that cannot be translated into proteins. Use tRNAscan-SE software to predict tRNA; use software (Version 1.2) for accurate prediction; finally use a program (Version 1.1rc4) to predict the sequence of the glucoamylase-producing strain and determine the final sRNA.

[0114] 5.4. Genomic islands

[0115] Genomic islands (GIs) can reflect the functions generated by microorganisms adapting to the environment. Use IslandPath-DIOMB software (Version 0.2) to predict the genomic islands of the glucoamylase-producing strain TS-5.

[0116] 6. Gene function annotation analysis

[0117] 6.1 GO annotation

[0118] The full name of GO is Gene Ontology, a classification system for systematically describing gene functions at the global level, which includes three aspects: 1) cellular component, 2) molecular function, and 3) biological process. The GO annotation prediction information of glucoamylase-producing strain TS-5 was obtained using Blast2GO.

[0119] 6.2 COG annotation

[0120] COG, the Chinese name is clusters of orthologous groups of proteins, a protein database created by NCBI (based on complete genomes of bacteria, eukaryotes, etc.). The function of a certain protein sequence can be predicted by a protein sequence that has been annotated to COG, and classification, etc. can be carried out.

[0121] 6.3 Nr annotation

[0122] The Nr (Non-Redundant Protein Database) database can clearly show the number of genes according to the species to which the genes are annotated. The amino acid information encoded by the genes of glucoamylase-producing strain TS-5 was compared with this database using blastp to obtain annotation information.

[0123] 6.4 KEGG annotation

[0124] KEGG (Kyoto Encyclopedia of Genes and Genomes) is a database that can systematically and comprehensively analyze the metabolic pathways and functions of gene products in cells. The information obtained from KEGG helps to systematically understand the functions of microorganisms. It includes metabolic pathways, gene sequences, genomes, etc. The KEGG database was compared with glucoamylase-producing strain TS-5 to obtain the annotation results corresponding to the genes of this strain.

[0125] 7. Other analyses

[0126] Further prediction and annotation of the genome sequence of glucoamylase-producing strain TS-5 include TCDB (Transporter Classification Database), Swiss-Prot database annotation, CAZy (Carbohydrate-Active enZYmes Database) annotation, prediction of secreted proteins, prediction of secreted system proteins and T3SS effector proteins, prediction and analysis of secondary metabolite gene clusters, etc.

[0127] 7.1, TCDB Database Annotation

[0128] TCDB, also known as the Transporter Classification Database in Chinese, which also includes a classification system (TC system) for ion channels.

[0129] 7.2, Pfam Database Annotation

[0130] Proteins composed of one or more functional regions are usually called domains. Different combinations of domains form different proteins. Therefore, the analysis of domains is the analysis of protein function. This database consists of two parts: Pfam-A and Pfam-B. The gene sequence of glucoamylase-producing strain TS-5 was compared with this database using Pfam.xfam (http: / / pfam.xfam.org / ) to obtain the annotation results.

[0131] 7.3, Swiss-Prot Database Annotation

[0132] Swiss-Prot is a database that can analyze the function of a protein, its domain structure, post-translational modifications, variations, etc., and can provide high-quality annotation results for selected protein sequences.

[0133] 7.4, Carbohydrate-Active enZYmes (CAZy) Database Annotation

[0134] CAZy (Carbohydrate-Active enZYmes Database) includes a database of enzymes related to the catalysis of carbohydrate degradation, modification, and biosynthesis. To ensure the accuracy of its annotation results, usually only one optimal annotation is retained. It mainly includes the following classifications: glycoside hydrolases, glycosyltransferases, polysaccharide lyases, carbohydrate esterases, and oxidoreductases. The gene sequence of glucoamylase-producing strain TS-5 was compared with this database using blastp to obtain the final results.

[0135] 7.5, Secreted Protein Prediction

[0136] Proteins secreted outside the cell to play a role are called secreted proteins; the SignalP (Version 4.1) tool was used to predict the glucoamylase-producing strain TS-5 to detect whether there are signal peptides and transmembrane structures.

[0137] 7.6, Secretion System Protein and T3SS Effector Protein Prediction

[0138] The type N secretion systems (TNSS, currently 7 types have been identified, types I - VII) in the secretion system can affect various important physiological activities in cells, such as immune responses and cell apoptosis; based on the annotation results of the protein sequence function database and extracting the relevant proteins of the TNSS system, the EffectiveT3 software (Version 1.0.1) was used to predict the T3SS effector proteins of the glucoamylase-producing strain TS-5.

[0139] 7.7. Secondary metabolite gene cluster analysis

[0140] The genes of the enzymes synthesized by microorganisms involved in the secondary metabolic pathway are on the chromosome. Usually, the antiSMASH program (version 2.0.2) is used to predict the genome of the glucoamylase-producing strain TS-5.

[0141] 7.8. Whole genome map

[0142] For the assembled genome sequence of the sequencing sample of the glucoamylase-producing strain TS-5, combined with the prediction results of each coding gene, the Circos software was used to display the sample genome.

[0143] 7.9. Metabolic pathway analysis of strain TS-5

[0144] Metabolism is an important requirement for the growth and development of microorganisms such as bacteria and fungi. A detailed understanding of the metabolic pathway can help us know the needs of microorganisms at different stages and their metabolic products. For TS-5, which has the potential to become an industrial strain, understanding its metabolic pathway and the products of each metabolic pathway helps in better application of TS-5. In this study, the metabolic pathways of TS-5 involved in starch, etc. were obtained from KEGG, and the genes of the relevant enzymes involved were analyzed and understood, which is of great significance for industrial production.

[0145] 8. Mining potential genes for TS-5 to degrade starch, cellulose and hemicellulose

[0146] During the degradation of starch and cellulose by glucoamylase, most glycosidase genes play important roles. Based on the existing gene sequencing and annotation of gene functions, relevant genes reported for starch degradation were consulted, and potential genes were mined through nucleic acid sequence comparison and other analyses, and these genes were sorted and analyzed. As shown in Table 1.

[0147] Table 1 Basic information of genes in strain TS-5 for degrading starch, cellulose and hemicellulose

[0148]

[0149]

[0150]

[0151] The whole genome of the Paenibacillus sp. strain TS-5 producing glucoamylase was sequenced. Through various gene predictions and functional annotations in various databases, it was found that the number of genes related to transcription, translation, catalytic activity, etc. in this strain was significantly larger, and it could be determined that the strain had good expression in terms of genetic characteristics. The results are as Figure 17 .

[0152] By comparing the nucleic acid sequence of strain TS-5 with various databases, it was found that the genes of various proteolytic enzymes, etc. were relatively enriched as Figure 18 shown, and it was further determined that the ability of this bacterium in enzyme secretion was relatively strong, and it might be used for industrial production of glucoamylase.

[0153] After comparative analysis in NCBI, it was found that there were many genes of related enzymes that participated in the degradation of starch, cellulose, hemicellulose, etc. in strain TS-5, and their metabolic processes were interrelated with each other. Details are as Figure 19 shown.

[0154] Unless otherwise specified, the experimental methods used in the examples are all conventional methods. The materials, reagents, etc. used in the examples can all be obtained from commercial channels unless otherwise specified.

[0155] It should be understood that those of ordinary skill in the art can make improvements or transformations according to the above description, and all such improvements and transformations should fall within the protection scope of the appended claims of the present invention.

Claims

1. A Paenibacillus sp. with high glucoamylase yield ( Paenibacillus SP. ), characterized in that It is preserved in the China General Microbiological Culture Collection Center with the preservation number of CGMCC No. 25236.

2. Use of the Paenibacillus as described in claim 1 in the production of glucoamylase.

3. The fermentation method of Bacillus sphaericus according to claim 1, characterized in that, It includes the following steps: Inoculate the Paenibacillus into a fermentation liquid medium and culture it on a shaker at 30 °C for 12 - 72 h to obtain the fermentation broth of the Paenibacillus.

4. A fermentation broth obtained by the method as described in claim 3.

5. A microbial inoculum for producing glucoamylase, characterized in that, It includes the Paenibacillus as described in claim 1 and / or the fermentation broth as described in claim 4, as well as acceptable excipients or carriers.

Images