A method for amplifying and ligating peach aphid nudivirus and its application
By developing the peach aphid nucleus virus MpDV2 and its amplification method, the problems of chemical pesticide resistance to peach aphids and environmental pollution have been solved, providing a green biological pesticide that significantly affects the growth, development and population growth of peach aphids and reduces costs.
Patent Information
- Application Number
- CN202211478870.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-22
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2042-11-22
AI Technical Summary
Existing chemical insecticides pose a serious problem of resistance to peach aphids, leading to environmental pollution. There is an urgent need to develop green and safe new insecticides.
Develop Myzus persicaedensovirus 2 (MpDV2) for peach aphids and provide its amplification and adapter methods, including the complete terminal sequence structure, for the preparation of biopesticides to control peach aphids.
MpDV2 exhibits high host specificity for peach aphids, enabling horizontal and vertical transmission within peach aphid populations. This significantly impacts their growth, development, and population growth, reducing the frequency of pesticide application and lowering costs. Simultaneously, it provides genetic information for the development of highly pathogenic viral insecticides.
Smart Images

Figure CN116103246B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a peach aphid nucleovirus, whole genome amplification and adapter method and its application. Background Technology
[0002] Currently, the peach aphid (Myzus persicae (Sulzer)) belongs to the order Hemiptera, family Aphididae, and is a global pest, distributed throughout all provinces of my country and every continent in the world. Worldwide, over 400 species of plants belonging to 50 families are recorded as host plants for the peach aphid, with over 170 species recorded in my country. The peach aphid is one of the most damaging and widely fed insect species. Adults and nymphs directly damage host plants by sucking their sap, causing leaves to curl and thin, severely inhibiting plant growth, and increasing susceptibility to fungal diseases. Furthermore, the peach aphid can transmit various important plant viruses, causing plant disease epidemics and resulting in serious damage and huge economic losses globally.
[0003] Currently, the most effective way to control peach aphid populations is through chemically synthesized insecticides. However, long-term excessive use of chemical insecticides has led to resistance to various chemical pesticides in peach aphid populations in multiple regions. Furthermore, the environmental pollution caused by chemical control is becoming increasingly serious, making the demand for green and safe pest control methods more urgent. In recent years, biological control methods have gained increasing popularity; among these, the use of natural enemies, parasitic insects, and pathogenic microorganisms falls under the category of biological control. Insect pathogenic viruses, as a type of pathogenic microorganism, are lethal to their hosts and exhibit host specificity, while remaining safe for non-target organisms. These biological characteristics can provide theoretical guidance for the development of novel insecticides. Currently, several countries have begun research on the application of insect pathogenic viruses, and nearly 20 insect virus insecticides have entered the market globally.
[0004] Densovirinae, belonging to the subfamily Densovirinae within the family Parvoviridae, infect only invertebrates, including insects, shrimp, crabs, and starfish. Densoviral particles exhibit icosahedral symmetry (T=1), are approximately 25 nm in diameter, lack an envelope, and contain a single-stranded, linear genomic DNA, approximately 3.9–6.3 kb in size. Due to the difficulty in obtaining the hairpin structure sequence at the ends, the precise size of the genome of some densovirals remains unknown. Studies have shown that most densovirals possess high virulence and a limited host range, failing to infect vertebrates or cells. Therefore, these viruses have potential applications in agricultural, forestry, and public health pest control. In 2000, my country registered the densovirinae virus of the black-breasted cockroach (PfDV) as a microbial insecticide for controlling the public health pest, cockroach. Prior to this, the Soviet Union had commercially produced Aedes aegypti densovirus (AaeDV) to control mosquito larvae.
[0005] In 2003, van Munster et al. isolated a concentrated nucleovirus (MpDV1) from a peach aphid population in the Netherlands. The virus particles were approximately 20 nm in diameter. Genome sequence analysis showed that the virus fragment was 5.5 kb in size and lacked terminal repeats or hairpin structures. Early studies indicated that MpDV1 inoculation resulted in decreased body weight, prolonged developmental period, and significantly reduced reproductive capacity in peach aphids.
[0006] The biosafety, host specificity, and pathogenicity of the peach aphid nucleovirus make it a potential application for the control of peach aphids.
[0007] Based on the above analysis, the existing technologies have the following problems and shortcomings: The long-term excessive use of chemical pesticides in current methods for controlling peach aphid populations has led to resistance to multiple types of chemical pesticides in peach aphid populations in various regions, and the environmental pollution caused by chemical control is becoming increasingly serious. There is an urgent need to develop new methods for controlling peach aphids, or to develop new green, safe, and environmentally friendly pesticides specifically for peach aphids. Summary of the Invention
[0008] To address the problems existing in the prior art, this invention provides a peach aphid nucleus virus, amplification and adapter method, and its application, particularly relating to a nucleus virus that infects the peach aphid Myzus persicae (Sulzer).
[0009] This invention is achieved as follows: a peach aphid nucleovirus, named Myzus persicaedensovirus 2, abbreviated as MpDV2, is deposited at the China Center for Type Culture Collection, with accession number V202281.
[0010] Furthermore, the nucleotide sequence of the peach aphid nucleovirus MpDV2 is SEQ ID NO: 1, and the sequence length of the peach aphid nucleovirus MpDV2 is 5727bp.
[0011] Furthermore, the nucleic acid sequence of the peach aphid nucleovirus MpDV2 includes a complete terminal inverted repeat sequence of ~236nt and an imperfect palindromic sequence of ~88nt, forming an "I"-shaped hairpin structure.
[0012] Furthermore, the complete terminal inverted repeat sequence of the peach aphid nucleovirus is located at the 1-236nt and 5493-5727nt regions at both ends of the genome, respectively, while the imperfect palindromic sequence at the ~88nt end is located at the 1-88nt and 5641-5727nt regions at both ends of the genome, respectively.
[0013] Another object of the present invention is to provide a method for inoculating the peach aphid cryptid virus, the method comprising the following steps:
[0014] Step 1: Collect the infected aphids into a 1.5mL centrifuge tube, add a small amount of ultrapure water at a ratio of 3μL per aphid, and grind them thoroughly on ice using a grinding rod.
[0015] Step 2: After thorough grinding, centrifuge at 13000 rpm for 3 minutes, collect the supernatant, and obtain the virus inoculation solution;
[0016] Step 3: Spread 10 μL of supernatant evenly over a 1 cm area. 2 Apply 5×10 to the plant leaves 10 A virus with one genome copy was inoculated onto leaves that had been dried, and then inoculated with five healthy first-instar peach aphid nymphs and fed for seven days.
[0017] Furthermore, in step three, after 7 days of rearing, all aphids were successfully infected, with an infection rate of 100%.
[0018] Another object of the present invention is to provide a method for amplifying the terminal sequence and adapter sequence of the peach aphid nucleovirus, wherein the method for amplifying the terminal sequence and adapter sequence of the peach aphid nucleovirus includes:
[0019] (1) The phosphorylated adapter sequence Oligo-Aptor was added to the end of the viral genome using T4 RNA ligase;
[0020] (2) Use the reverse primer Rev-Aptor with the adapter sequence and the specific primer DenF or DenR inside the genome to perform PCR amplification to obtain the terminal sequence;
[0021] (3) The PCR amplified terminal sequence fragment was cloned into the pMD18-T vector, transformed into Stbl3 competent cells, and the complete sequence was obtained after sequencing.
[0022] Furthermore, in step (1), the ligation system is 40 μL, including: 5.6 μL DNA, 4 μL 10×RNA ligase1 buffer, 20 μL 50% PEG8000, 0.4 μL 100 mM hexaamminecobalt trichloride, 2 μL T4 RNA Ligase 1, 4 μL 100 mM Oligo-Aptor, and 4 μL 10 mM ATP.
[0023] Another objective of this invention is to provide the application of the aforementioned peach aphid nucleus virus in the preparation of reagents and drugs for the prevention and control of peach aphids.
[0024] Another objective of this invention is to provide an application of the aforementioned peach aphid nucleus virus in the construction of expression vectors and viral infectious cloning vectors.
[0025] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:
[0026] First, addressing the technical problems existing in the prior art and the difficulty in solving them, this paper closely analyzes, in conjunction with the technical solution to be protected by this invention and the results and data obtained during the research and development process, how the technical solution of this invention solves the technical problems, and the inventive technical effects brought about by solving these problems. The specific description is as follows:
[0027] The present invention has the following advantages and effects:
[0028] (1) The peach aphid nucleus virus MpDV2 provided by the present invention has a significant impact on the growth, development and population growth of peach aphids, and has important application value for the prevention and control of peach aphids.
[0029] (2) The concentrated nucleovirus has high host specificity and cannot infect other beneficial insects, birds, fish and mammals including humans. It is safe for humans and animals, leaves no residue, does not pollute the environment, and is also conducive to maintaining ecological balance.
[0030] (3) This peach aphid nucleus virus can spread horizontally and vertically within the peach aphid population and is infectious. Moreover, the virus can replicate and amplify in peach aphids. Each infected aphid is a virus synthesis factory, which can continuously produce the virus, achieving the effect of long-term pest control. At the same time, it reduces the number of pesticide applications and lowers the cost of pesticides and labor.
[0031] (4) This invention provides the genome sequence of the peach aphid core virus for the first time, including the complete terminal sequence structure, which provides important information for the construction of virus expression vectors, virus modification, and recombinant virus synthesis. Using this as a template, more pathogenic viral insecticides or gene expression vectors based on virus sequences can be developed.
[0032] (5) For a long time, the main method for effectively controlling peach aphid populations has been chemical control. However, the excessive use or abuse of highly toxic chemical agents has caused enormous environmental pressure and aphid resistance. The development of new peach aphid control methods is particularly important, and the peach aphid nucleus virus in this invention has the potential to be developed into a green and safe biological insecticide.
[0033] Second, considering the technical solution as a whole or from a product perspective, the technical effects and advantages of the technical solution to be protected by this invention are specifically described as follows:
[0034] The peach aphid nucleovirus MpDV2 provided by this invention is a previously unisolated and unidentified viral strain that is pathogenic to peach aphids. The full-length genome sequence of peach aphid nucleovirus 2 (including complete terminal inverted repeat sequences) and the effects of this virus infection on the growth, development and population dynamics / growth of peach aphids are disclosed for the first time.
[0035] The peach aphid concentrated nucleus virus (MpDV2) infection provided by this invention significantly reduced the intrinsic growth rate (r), net reproductive rate (R0), and periodic growth rate (λ) of the peach aphid population, and prolonged the average generation time (T). Furthermore, the development time and onset of aphid production at each instar of peach aphid nymphs were significantly delayed after MpDV2 infection, and the aphid-producing period (Ovi-days) was significantly shortened. These results indicate that MpDV2 infection provided by this invention has a significant impact on the growth, development, and population growth of the peach aphid.
[0036] Third, as supporting evidence of the inventiveness of this invention, it is also reflected in the following important aspects:
[0037] (1) The expected benefits and commercial value of the technical solution of this invention after transformation are as follows:
[0038] In the current process of advocating ecological civilization and implementing the rural revitalization strategy, it is necessary to reduce the use of chemical pesticides, scientifically use microbial pesticides, and transform pest and disease control methods. Research and development of microbial pesticides has also been listed as a key national scientific and technological project, and my country is increasingly emphasizing the development of new varieties with independent intellectual property rights. my country's annual crop pest control area is large (440 million hectares), but biological pesticide control accounts for less than 10%, far lower than the 40% in developed countries. Insect virus insecticides are a type of microbial pesticide with broad market demand and application prospects. From a biological control perspective, the peach aphid nucleus virus MpDV2 provided by this invention can be used to control aphids, possessing significant social benefits and commercial value.
[0039] (2) The technical solution of this invention fills a technical gap in the industry both domestically and internationally:
[0040] This invention provides the first complete genome sequence of the peach aphid nucleovirus, including its terminal sequence structure, filling a technological gap in aphid nucleovirus research both domestically and internationally. Currently, molecular genetic manipulation of aphids is difficult, and commonly used RNA interference techniques are ineffective, severely limiting research applications in aphid molecular biology and functional genomics. The complete sequence of the peach aphid nucleovirus lays a solid foundation for virus research and the construction of aphid RNA interference systems using viruses as vectors, offering new possibilities for overcoming the low efficiency and difficulty of molecular genetic manipulation in aphid RNA interference. Attached Figure Description
[0041] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0042] Figure 1 This is a flowchart of the peach aphid concentrating core virus inoculation method provided in an embodiment of the present invention;
[0043] Figure 2 This is a schematic diagram of the identification results of the peach aphid concentrated core virus MpDV2 provided in Embodiment 1 of the present invention;
[0044] Figure 3 This is a schematic diagram of the amplification of the peach aphid congestion virus MpDV2 genome provided in Embodiment 2 of the present invention;
[0045] Figure 4 This is a schematic diagram of the terminal sequence and whole genome structure of the peach aphid congestion virus MpDV2 provided in Embodiment 3 of the present invention;
[0046] Figure 5This is a schematic diagram illustrating the proliferation of peach aphid nucleus virus MpDV2 in pepper and cabbage reared peach aphids, as provided in Example 5 of this invention. Detailed Implementation
[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0048] To address the problems existing in the prior art, this invention provides a method for the aphid nucleus virus, amplification, and adapter formation, as well as its applications. The invention will be described in detail below with reference to the accompanying drawings.
[0049] I. Explanation and Description of Embodiments. To enable those skilled in the art to fully understand how the present invention is specifically implemented, this section provides an explanation and description of the embodiments that elaborate on the technical solutions.
[0050] The peach aphid densovirus provided in this embodiment of the invention is named Myzuspersicae densovirus 2, abbreviated as MpDV2, and is deposited at the China Center for Type Culture Collection with accession number V202281.
[0051] The nucleotide sequence of the peach aphid nucleovirus MpDV2 provided in this embodiment of the invention is SEQ ID NO: 1.
[0052] The sequence length of the peach aphid nucleovirus MpDV2 provided in this embodiment of the invention is 5727 bp. The nucleic acid sequence of peach aphid nucleovirus MpDV2 includes a complete terminal inverted repeat sequence of ~236 nt (located in the 1-236 nt and 5493-5727 nt regions at both ends of the genome, respectively), and an imperfect palindromic sequence of ~88 nt (located in the 1-88 nt and 5641-5727 nt regions at both ends of the genome, respectively), which can form an "I"-shaped hairpin structure, such as... Figure 4 As shown.
[0053] like Figure 1 As shown, the method for inoculating with peach aphid concentrating core virus provided in this embodiment of the invention includes the following steps:
[0054] S101. Collect the infected aphids into a 1.5 mL centrifuge tube, add a small amount of ultrapure water at a ratio of 3 μL per aphid, and grind them thoroughly on ice with a grinding rod.
[0055] S102, after thorough grinding, centrifuge at 13000 rpm for 3 min, collect the supernatant to obtain the virus inoculation solution;
[0056] S103, spread 10μL of supernatant evenly over a 1cm layer. 2Apply 5×10 to the plant leaves 10 A virus with one genome copy was inoculated onto leaves that had been dried, and then inoculated with five healthy first-instar peach aphid nymphs and fed for seven days.
[0057] The amplification method for peach aphid concentrated core virus provided in this invention mainly involves rearing peach aphids for propagation. The virus can replicate within the peach aphid, and the virus content increases continuously with age, starting from the first instar nymph (e.g., ...). Figure 5 (As shown).
[0058] The virus inoculation method provided in this embodiment of the invention mainly includes: 1) mixing non-toxic peach aphids and toxic peach aphids for inoculation; 2) using leaves that have previously been used to raise toxic peach aphids to raise non-toxic peach aphids for inoculation; 3) using leaves coated with virus suspension for inoculation.
[0059] This invention evaluated the effects of MpDV2 on the growth, development, and population growth of the peach aphid using a life table method. The life table inoculation method employed a smear inoculation technique, specifically including the following steps:
[0060] Step 1: Collect the infected aphids into a 1.5 mL centrifuge tube, add a small amount of ultrapure water at a rate of 5 μL per aphid, and grind them thoroughly with a grinding rod. The entire grinding process should be carried out on ice.
[0061] Step 2: After grinding thoroughly, centrifuge at 13000 rpm for 3 minutes, and take the supernatant, which is the virus inoculation solution;
[0062] Step 3: Extract total DNA (including aphid and viral genomic DNA), and quantify the virus using real-time quantitative PCR. The result is approximately 3.2 × 10⁻⁶. 9 copies / μL;
[0063] Step 4: Spread 10 μL of viral supernatant evenly over a 1 cm area. 2 Apply approximately 3×10 mm of the solution to the plant leaves. 10 The viral load of the copies was such that after the liquid on the leaves dried, one healthy first-instar nymph was introduced, and the infection rate was 100%.
[0064] The method for amplifying the terminal sequence and adapter sequence Oligo-Aptor (5'p-ATCAACTACAACTCTCCTCCTC-3'ddC) of the peach aphid concentrated nucleovirus provided in this invention includes:
[0065] (1) The phosphorylated adapter sequence Oligo-Aptor was added to the end of the viral genome using T4 RNA ligase (NEB); the ligation system (40 μL) was: 5.6 μL DNA, 4 μL 10×RNA ligase 1 buffer, 20 μL 50% PEG8000, 0.4 μL 100 mM hexaamminecobalt trichloride, 2 μL T4 RNA Ligase 1, 4 μL 100 mM Oligo-Aptor, and 4 μL 10 mM ATP.
[0066] (2) Use the reverse primer Rev-Aptor with the adapter sequence and the specific primer DenF or DenR inside the genome to perform PCR amplification to obtain the terminal sequence.
[0067] (3) The PCR amplified terminal sequence fragment was cloned into the pMD18-T vector, transformed into Stbl3 competent cells, and the complete sequence was obtained after sequencing.
[0068] The MpDV2 infection of the peach aphid, as provided in this embodiment of the invention, significantly reduced the intrinsic growth rate (r), net reproductive rate (R0), and cyclical growth rate (λ) of the peach aphid population, and prolonged the average generation time (T). Furthermore, the development time and onset of aphid production at each instar of peach aphid nymphs were significantly delayed after MpDV2 infection, and the aphid-producing period (Ovi-days) was significantly shortened. These results indicate that the MpDV2 infection provided in this embodiment of the invention has a significant impact on the growth, development, and population growth of the peach aphid.
[0069] II. Application Examples. To demonstrate the inventiveness and technical value of the present invention, this section provides application examples of the technical solution on specific products or related technologies.
[0070] (1) The peach aphid nucleus virus MpDV2 provided in this embodiment of the invention has a significant impact on the growth, development, and population growth of peach aphids, and can be developed into a green and safe biological insecticide for the control of peach aphids. At the same time, it provides methods for the detection, inoculation, and amplification of peach aphid nucleus virus MpDV2, which can be directly applied or improved and applied to the commercial production process of peach aphid nucleus virus insecticides, providing strong technical support for insecticide production.
[0071] (2) This invention provides for the first time the genome sequence of the peach aphid nucleus virus MpDV2, including the complete terminal sequence structure, which provides important information for the construction of viral expression vectors, viral modification, and recombinant viral synthesis. Using this as a template, more pathogenic viral insecticides or gene expression vectors based on viral sequences can be developed.
[0072] (3) The present invention provides the genome sequence of the peach aphid nucleovirus MpDV2, which can be used as a vector to construct an aphid RNA interference system, thus solving the problems of low efficiency of aphid RNA interference and difficulty in molecular genetic manipulation.
[0073] III. Evidence of the Relevant Effects of the Embodiments. The embodiments of the present invention have achieved some positive effects during research and development or use, and indeed possess significant advantages compared to existing technologies. The following description, in conjunction with data, charts, and other materials from the experimental process, illustrates these advantages.
[0074] Example 1: Detection of Peach Aphid Sperm Virus
[0075] Based on the reported genome sequence of the Dutch strain of peach aphid nucleovirus (MpDV1) (GenBank accession No. AY148187), a pair of specific primers, MpDVF and MpDVR (see Table 1), were designed to amplify the conserved region (632 bp) of its NS1 gene. Total DNA from peach aphids collected in the field was used as a template for PCR detection. The PCR reaction system (25 μL) consisted of: 12.5 μL 2×Mastermix (Kangwei Century Company), 2.5 μL each of MpDVF (5 μM) and MpDVR (5 μM), 5 μL DNA template, and 2.5 μL pure water. The sample was pre-denatured at 94℃ for 3 min, and then PCR amplification was performed under the following conditions: denaturation at 94℃ for 30 s, annealing at 52℃ for 1 min, extension at 72℃ for 1 min, 30 cycles followed by a final extension at 72℃ for 10 min. PCR products were analyzed by 1% agarose gel electrophoresis, and the amplified fragments were ligated into the pMD18-T vector and then sequenced for verification. Figure 2 As shown, this invention amplified a specific product in the total DNA of peach aphids collected in the field. Sequencing confirmed that this PCR product was a fragment of the peach aphid NS1 nucleovirus gene. Furthermore, the positive rate for NS1 nucleovirus detection in the collected peach aphids was approximately 75%. Figure 2 ).
[0076] Table 1 Primer sequences for amplification of the genome of the peach aphid nucleovirus 2
[0077]
[0078]
[0079] Example 2: Amplification of the genome of Peach Aphid Dense Nucleovirus 2
[0080] Since a partial sequence of peach aphid nucleovirus was detected in peach aphids in the Yangling area, this invention designs a series of overlapping PCR primers (see Table 1) based on the known genome sequence of the Dutch strain of peach aphid nucleovirus (MpDV1). Figure 3A) Amplification of the genome of the peach aphid concentrated nucleovirus from Yangling region. The specific method was as follows: using the extracted total DNA from the peach aphid as a template, PCR amplification was performed using the primer combinations in Table 1. The PCR reaction system (50 μL) consisted of: 0.25 μL ExTaq DNA Polymerase (Takara), 5 μL 10×ExTaq buffer (Takara), 4 μL each of primer 1 (5 μM) and primer 2 (5 μM), 4 μL dNTP (10 mM), 5 μL DNA template, and 27.75 μL pure water. The PCR reaction conditions were the same as above. After separation of the PCR products by 1% agarose gel electrophoresis, the target fragment of the expected size was recovered, and the target fragment was cloned into the pMD18-T vector and then sequenced. Figure 3 As shown in B, PCR using each primer combination yielded the target fragment of the expected size. Sequencing results showed that each target fragment had high nucleotide sequence homology with the reported MpDV1 sequence. Through sequence assembly, this invention obtained a viral genome (MpDV2) of 5483 base pairs (see [link to original text]). Figure 3 C) The genome size is similar to that of the previously reported MpDV1 (5499 bases).
[0081] Example 3: Terminal sequence amplification
[0082] To obtain the full-length genome sequence of the virus, the phosphorylated adapter sequence Oligo-Aptor (5'p-ATCAACTACAACTCTCCTCCTC-3'ddC) was first added to the end of the viral genome using T4 RNA ligase. The ligation system (40 μL) consisted of: 5.6 μL DNA, 4 μL 10×RNA ligase 1 buffer, 20 μL 50% PEG8000, 0.4 μL 100 mM hexaamminecobalt trichloride, 2 μL T4 RNA Ligase 1, 4 μL 100 mM Oligo-Aptor, and 4 μL 10 mM ATP. The terminal sequences were then amplified by PCR using the reverse primer Rev-Aptor (adapter sequence) and the specific primers DenF or DenR (internal to the genome) to obtain the terminal sequences (primers are shown in Table 1). The PCR reaction system (50 μL) consisted of: 0.5 μL KOD FX (TOYOBO), 12.5 μL 2x PCR buffer for KOD FX, 5 μL 2 mM dNTPs, 1.5 μL Rev-Aptor (5 μM), 1.5 μL DenF or DenR (5 μM), 2.8 μL DNA template, and 1.2 μL purified water. The amplified fragment was cloned into the pMD18-T vector and transformed into Stbl3 competent cells. The complete sequence was obtained after sequencing. Specific primers for both ends of the hairpin structure were designed to verify the terminal sequence. The final complete sequence of MpDV2 is as follows:
[0083]
[0084] The genome is 5727 nt in length, with complete inverted repeat sequences (ITRs) at both ends. The ITRs at both ends are approximately 236 nt long (located at positions 1–236 and 5493–5727 nt, respectively), and the terminal ~88 nt sequences (1–88 and 5641–5727 nt) are imperfect palindromic sequences that can fold to form an "I"-shaped hairpin structure, including a 39-base-pair stem, a hairpin loop, an inner loop, two dinucleotide protrusions, and one single nucleotide protrusion (see...). Figure 4 The stem, hairpin loop, and two dinucleotide protrusions are identical at both terminal hairpins, with only slight differences in the internal loop and single nucleotide protrusion. The 5' internal loop is an asymmetric loop composed of three nucleotides, while the 3' internal loop is a symmetric loop composed of two nucleotides. In summary, the 3' and 5' hairpin structures are very similar, therefore the MpDV2 genome has homologous ends.
[0085] Sequence analysis showed that this pyrenoid virus strain shared a high genomic sequence similarity (approximately 98.08%) with the earlier discovered peach aphid pyrenoid virus MpDV1, but their coding strategies differed significantly. MpDV1 encodes five ORFs; the three ORFs on the sense strand encode non-structural proteins (NS), potentially encoding NS1 (97 amino acids), NS2 (225 amino acids), and NS3 (698 amino acids) sequentially from the 5' end. The two ORFs on the antisense strand encode structural proteins (VP), which, starting from the 5' end, may form proteins of sizes 57 kDa, [missing information - likely a typo, should be 57 kDa], [missing information - likely a typo, should be 60 ... Five VP proteins with capacities of 64kDa, 68kDa, 85kDa, and 92kDa were identified. In comparison, the newly discovered peach aphid nucleovirus (MpDV2) encodes four ORFs. Two ORFs on the sense strand encode non-structural proteins (NS), which, starting from the 5' end, may encode NS1 (ORF1, 301 amino acids) and NS2 (ORF2, 796 amino acids). The two ORFs on the antisense strand encode structural proteins (VP), which, starting from the 5' end, may encode VP1 (ORF3, 193 amino acids) and VP2 (ORF4, 721 amino acids).
[0086] The virus strain was named Myzus persicae densovirus 2 (MpDV2), and was deposited at the China Center for Type Culture Collection on September 21, 2022, with accession number V202281, at Wuhan University, Wuhan, China.
[0087] Example 4: Evaluation of MpDV2 inoculation and infection efficiency
[0088] The tested inoculation methods mainly include: 1) mixing healthy peach aphids with infected peach aphids for inoculation; 2) using leaves that had previously been used to raise infected peach aphids to raise healthy peach aphids for inoculation; 3) using leaves coated with virus suspension to inoculate and infect healthy peach aphids.
[0089] 1) Mix healthy peach aphids with infected peach aphids for inoculation.
[0090] Ten healthy first-instar nymphs were reared together with ten virus-carrying adult aphids. To facilitate differentiation, one midleg of each healthy nymph was removed. After seven days of mixed rearing, healthy nymphs were collected individually. After rinsing twice with PBS, the virus-carrying status of the healthy nymphs was tested according to the method in Example 1. The results showed that the virus was detected in all 10 healthy aphids, indicating successful infection with a 100% infection rate.
[0091] 2) Use leaves that have previously been used to raise infected peach aphids to raise healthy peach aphids for inoculation.
[0092] Twenty infected adult aphids were transferred to petri dishes containing cabbage leaves and reared for seven days. The infected aphids were then removed and replaced with 20 healthy first-instar nymphs. Three days after inoculation, the nymphs were removed and reared individually for seven days before virus infection was assessed. The results showed that nearly 60% of the aphids were infected with the virus.
[0093] 3) Inoculate and infect leaves that have been coated with virus suspension.
[0094] First, infected aphids were collected into 1.5 mL centrifuge tubes. A small amount of ultrapure water was added at a ratio of 5 μL per aphid, and the mixture was thoroughly ground on ice using a grinder. After thorough grinding, the tubes were centrifuged at 13,000 rpm for 3 minutes, and the supernatant was collected as the virus inoculation solution. Then, total DNA was extracted from the infected aphids, and the virus was quantified using real-time quantitative PCR (approximately 3.2 × 10⁻⁶). 9 Finally, spread 10 μL of supernatant evenly over a 1 cm area. 2 Apply approximately 3×10 to the leaves. 10 After the sap on the leaves dried, one healthy first-instar nymph was inoculated onto each infected leaf. After 7 days of rearing, the infection status of the aphids was tested using the method described above. The results showed that all aphids were successfully infected, with an infection rate of 100%.
[0095] Example 5: Evaluation of MpDV2 proliferation in peach aphids
[0096] To detect the dynamic changes in virus content in aphids at different developmental stages, first, second, third, and fourth instar nymphs, as well as adult aphids on days 1, 3, 5, 7, 9, 11, 13, 15, and 17, were collected from virus-carrying aphid populations fed with cabbage and peppers. Total DNA was extracted from the samples, and the virus concentration was detected by quantitative real-time PCR. The qPCR primers are as follows:
[0097] Forward primer DVqF1: CCTCTGATCGCGTTGCTATTA;
[0098] Reverse primer DVqR1: CCAGTAGGTCGCATTTCTTAGT.
[0099] The total volume of the PCR reaction system for the sample was 20 μL, including 2 μL DNA template (40 ng / μL), 1.5 μL each of 5 μM forward and reverse primers, 10 μL TB Green Premix Ex Taq II (TaKaRa), and 5 μL ddH2O.
[0100] To create the standard curve, the amplified fragment was cloned into the pMD18-T plasmid and diluted into seven gradients as templates: 0.2 × 10⁻⁶. 9 copies / μL, 0.2×10 8 copies / μL, 0.2×10 7 copies / μL, 0.2×10 6 copies / μL, 0.2×10 5 copies / μL, 0.2×10 4 copies / μL, 0.2×10 3 The total volume of the reaction system was 20 μL, consisting of 5 μL of diluted plasmid template, 1.5 μL (5 μM) each of forward and reverse primers, 10 μL of TB GreenPremix Ex Taq II (TaKaRa), and 2 μL of ddH2O.
[0101] The thermal cycling reaction was as follows: pre-denaturation at 95℃ for 30 seconds for one cycle; then denaturation at 95℃ for 5 seconds, annealing at 60℃ for 30 seconds, for 40 cycles. The plasmid used to prepare the standard curve was obtained by a series of serial dilutions. The copy number of concentrated nucleovirus DNA at different instars of the peach aphid was expressed as the number of viral copies per ng of total DNA. Figure 5 The results showed that the virus content gradually increased as the aphids developed, although there were slight fluctuations during the adult stage. The highest virus content was observed on the last day of virus monitoring, day 17 of adult aphids (24-day-old aphids). This indicates that the virus can replicate within the peach aphid and that the virus content gradually increases from nymph to adult stage.
[0102] Example 6: Evaluation of the effects of MpDV2 on the growth, development, and population growth of the peach aphid
[0103] To analyze the impact of the virus on peach aphids, this invention established population life tables for healthy peach aphids and virus-infected peach aphids. Since the peach aphid populations have overlapping generations and relatively stable age groups, this experiment used a time-specific life table to record the daily number of surviving aphids, their age groups, and the number of offspring produced.
[0104] The population life tables for healthy and virus-infected peach aphids are set as follows:
[0105] Life table analysis of the peach aphid population was conducted in an intelligent light incubator (model: GXZ-280B, Ningbo Jiangnan Instrument Factory). The temperature was set at 20℃±0.5℃, and the photoperiod was 16L:8D (light intensity approximately 12000lx). Two groups of populations were established for time-specific life table experiments: one group consisted of healthy peach aphids, and the other group consisted of peach aphids infected with MpDV2. Virus inoculation was performed using the method described in Case 3. First, 70 nymphs were randomly selected from the first-instar nymphs newly laid by healthy adults and reared in a 1cm layer of water that had been pre-treated with the virus inoculation solution. 2 Chili pepper leaves (pre-laid on the bottom layer of a 35mm sterile petri dish containing 1% agar, with filter paper on top for moisture retention and protection) were reared for three days before being inoculated with the virus again as a viral infection population. Forty healthy first-instar nymphs that were not inoculated with the virus were used as a control. Subsequently, the survival status, instar, and number of offspring of each aphid were recorded every 12 hours. During the observation period, molted and newly laid nymphs were promptly removed until all initially observed aphids died.
[0106] The statistical and analytical methods for life table data are as follows:
[0107] Raw life table data were analyzed using TWO SEX-MS Chart (Chi, 2018) to construct population life tables for healthy peach aphids and MpDV2-infected peach aphids, obtaining age-specific survival rates (l x ), reproductive capacity at a specific age (m x The parameters include intrinsic growth rate (r), finite growth rate (λ), average generation time (T), net reproductive rate (R0), and developmental duration at each stage. The calculation formulas are as follows:
[0108] Age-specific survival rate (l x )
[0109]
[0110] In the formula, s xj This represents the survival rate of an individual insect at age x and instar j, where m represents the maximum instar number.
[0111] Reproductive capacity at a specific age (m x )
[0112]
[0113] In the formula, s xj f represents the survival rate of an individual insect at age x and instar j; xj This represents the number of offspring produced by a female adult at age x and age j; m represents the maximum age.
[0114] Net reproductive rate (R0)
[0115]
[0116] The intrinsic growth rate (r) is calculated using the Euler-Lotka equation:
[0117]
[0118] Weekly growth rate (λ)
[0119] λ=e r
[0120] Mean generation time (T)
[0121]
[0122] The variance and standard error of each parameter of the population were calculated using the Bootstrap technique (Efron and Tibshirani, 1994) (parameters are expressed as mean ± standard error). To obtain stable and accurate calculation results, 100,000 repeated samplings were used, and a p-value < 0.05 was set as a significant difference between treatment groups.
[0123] 1) The effect of peach aphid concentrated nucleovirus 2 on the population parameters of the host peach aphid
[0124] To assess the impact of MpDV2 infection on the growth, development, population growth and decline, and reproductive capacity of the peach aphid population, this invention obtained population parameters for infected and healthy peach aphids (see Table 2). Table 2 shows that the intrinsic growth rate (r), net reproductive rate (R0), and periodic growth rate (λ) of the peach aphid population infected with MpDV2 were significantly lower than those of the healthy population, while the average generation time (T) was significantly higher. This indicates that MpDV2 infection significantly prolongs the average generation time of the peach aphid population, reducing its reproductive capacity and population growth rate.
[0125] Table 2. Effects of peach aphid nucleovirus on peach aphid population parameters
[0126]
[0127] *The standard error is calculated from 100,000 bootstrap. Different letters after the data in the same column indicate that the differences are significant at the 5% level according to the pairwise comparison test of bootstrap.
[0128] 2) The effect of peach aphid congestion virus 2 on the developmental period of peach aphid populations
[0129] To analyze the impact of MpDV2 infection on the developmental duration of different stages of the peach aphid, this invention statistically analyzed the developmental duration data of MpDV2-infected and healthy peach aphids at different stages (see Table 3). As shown in Table 3, MpDV2 infection significantly prolonged the developmental time of each nymphal stage of the peach aphid, including the first, second, third, and fourth instars, resulting in a total nymphal period (pre-adult stage) that was more than 3 days longer than that of healthy peach aphids, but had little impact on the adult stage. In comparison, the pre-laying stage and the total pre-laying stage of MpDV2-infected peach aphids were significantly longer than those of healthy peach aphids, indicating that MpDV2 infection delayed the onset of aphid laying. Furthermore, the laying period (Ovi-days) of healthy aphids was significantly longer than that of MpDV2-infected peach aphids, by approximately 3.8 days, indicating that MpDV2 infection shortened the laying period of peach aphids.
[0130] In summary, infection with MpDV2 significantly reduced the intrinsic growth rate (r), net reproductive rate (R0), and periodic growth rate (λ) of the peach aphid population, and prolonged the average generation time (T). Furthermore, MpDV2 infection significantly delayed the development time and the start of aphid production at all nymphal instars, and significantly shortened the aphid-producing period (Ovi-days). These results indicate that MpDV2 infection has a significant impact on the growth, development, and population growth of the peach aphid.
[0131] Table 3. Effects of peach aphid cryptovirus on the developmental stages of peach aphid populations.
[0132]
[0133] *The standard error is calculated from 100,000 bootstrap. Different letters after the data in the same column indicate that the differences are significant at the 5% level according to the pairwise comparison test of bootstrap.
[0134] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A peach aphid congestion virus, characterized in that, The name of the peach aphid concentrating core virus is Myzus persicae densovirus 2, abbreviated as MpDV2, is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO:V202281.
2. A method for inoculating with the peach aphid concentrating virus as described in claim 1, characterized in that, The inoculation method for peach aphid cryptovirus includes the following steps: Step 1: Collect the infected aphids into a 1.5 mL centrifuge tube, add a small amount of ultrapure water at a ratio of 3 μL per aphid, and grind them thoroughly on ice using a grinding rod. Step 2: After thorough grinding, centrifuge at 13000 rpm for 3 min, collect the supernatant, and obtain the virus inoculation solution; Step 3: Spread 10 μL of supernatant evenly over a 1 cm area. 2 Apply 5×10 to the plant leaves 10 A virus with one genome copy was inoculated onto leaves that had been dried, and then inoculated with five healthy first-instar peach aphid nymphs and fed for seven days.
3. The application of the peach aphid nucleus virus as described in claim 1 in the preparation of reagents and drugs for the prevention and control of peach aphids.
4. The application of the peach aphid nucleovirus as described in claim 1 in the construction of an expression vector.
5. The application of the peach aphid nucleovirus as described in claim 1 in the construction of a viral infectious cloning vector.