Protein, gene, vector and application for controlling symbiotic nitrogen fixation efficiency of soybean

Abstract

The present invention belongs to the field of biotechnology, relates to new applications of genes, and particularly refers to proteins, genes, their editing vectors and applications for controlling the symbiotic nitrogen fixation efficiency of soybeans. The present application has discovered two genes of soybeans GmNAS1 , GmNAP1 and one transcription factor GmNFYC10a , and obtained the gene sequences of the three through reverse genetics means, and successfully isolated, cloned and verified them by using the soybean hairy root transient transformation system, stable transgenic plants, PCR reactions and gene sequencing. The soybean genes GmNAS1 , GmNAP1 and the transcription factor GmNFYC10a control the symbiotic nitrogen fixation efficiency of soybeans through their interactions with each other, revealing the GmNAS1 , GmNAP1 and GmNFYC10a molecular mechanism for improving the nitrogen fixation efficiency of root nodules by regulating the flow direction of PEP.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to new applications of genes, and particularly refers to proteins, genes, their vectors and applications for controlling the symbiotic nitrogen fixation efficiency of soybeans. Background Art

[0002] Cultivated soybean Glycine max (L.) Merr] originated in China and is an important food, feed, oilseed and energy crop in the world. It is also an important source of protein intake for humans. Since the mid-1990s, China has become a net importer of soybeans, and the import volume has been increasing year by year. By 2019, China's soybean import volume had reached 88.51 million tons, ranking first in the world. Therefore, developing China's soybean production and realizing the "revitalization of soybeans" are of great significance for ensuring national food security.

[0003] At the same time, with the development of China's economy and the pressure of increasing food demand due to the rapid growth of the population, a large amount of chemical fertilizers, especially nitrogen fertilizers, are applied in China's food production. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the annual nitrogen fertilizer usage in China has been increasing from 2002 to 2014. Although China's arable land area accounts for only 8% of the world's total, the nitrogen fertilizer usage reaches 35% of the world's total usage (http: / / faostat.fao.org / ). The excessive application of nitrogen fertilizers and nutrient loss have led to serious water eutrophication pollution. At the same time, it has also affected the composition of soil organic matter, reduced biological activity, and caused soil compaction. Nitrogen-fixing microorganisms can use the nitrogenase synthesized by themselves to reduce atmospheric nitrogen into ammonia that can be directly utilized by plants. In the global ecosystem, the nitrogen fixed by the symbiotic nitrogen fixation of leguminous plants and rhizobia accounts for 60%-70% of the total biological nitrogen fixation. The symbiotic nitrogen fixation of leguminous plants and rhizobia not only reduces energy consumption but also helps to improve the soil, which is an important way to improve the nitrogen efficiency of leguminous crops. In the agricultural system, the nitrogen fixation amount of soybeans accounts for more than 86% of the total symbiotic nitrogen fixation of legumes, with an annual nitrogen production of 16.44 million tons. Therefore, improving the symbiotic nitrogen fixation efficiency of soybeans and rhizobia is of great significance for the development of green and sustainable agriculture.

[0004] Like other leguminous plants, soybeans can form root nodules in symbiosis with rhizobia, thereby assimilating nitrogen in the atmosphere into ammonia and providing themselves with a nitrogen source. Designing and cultivating soybean varieties with high nitrogen fixation efficiency is beneficial to reducing the use of chemical nitrogen fertilizers while increasing soybean yields, thus ensuring the sustainable development of agriculture. Previous studies have shown that the nitrogen fixation ability of root nodules in many leguminous plants is extremely vulnerable to environmental changes. Abiotic stresses such as drought, high salinity, and low light can significantly inhibit the nitrogen fixation ability of root nodules, while an increase in atmospheric carbon dioxide concentration and a lack of soil nitrogen source can enhance the nitrogen fixation ability of root nodules. Therefore, designing and cultivating widely adaptable soybean varieties with high nitrogen fixation efficiency urgently requires us to conduct more in-depth research on the regulatory mechanisms of the nitrogen fixation ability of soybean root nodules in response to environmental changes.

[0005] As the site for carbon and nitrogen exchange between host leguminous plants and rhizobia, mature root nodules can receive sucrose synthesized by photosynthesis in the above-ground part through the phloem after formation. Sucrose reaching the root nodules will be decomposed into hexoses by sucrose synthase and alkaline invertase and then enter the glycolysis pathway to generate phosphoenolpyruvate (PEP). PEP can undergo two-step reactions catalyzed by phosphoenolpyruvate carboxylase (PEPC) and malate dehydrogenase (MDH) to generate malate. Malate is transported into bacteroids for the tricarboxylic acid cycle to produce ATP to provide energy for the nitrogen fixation reaction. Subsequently, the ammonium ions generated by nitrogen fixation will be assimilated into asparagine and glutamine and transported to the above-ground part in amide-exporting legumes, while in ureide-exporting legumes represented by soybeans, the glutamine generated from ammonium will enter the de novo purine biosynthesis pathway to generate inosinemonophosphate (IMP), and finally be converted into ureide and transported to the above-ground part; in addition, PEP can also be catalyzed by pyruvate kinase (PK) to generate pyruvate, the final product of glycolysis, and then pyruvate enters the tricarboxylic acid cycle in the mitochondria to produce ATP to provide energy for nitrogen assimilation in root nodules.

[0006] Although the carbon and nitrogen metabolic pathways in soybean root nodules have been relatively well studied, the genes and regulatory mechanisms that regulate these metabolic pathways to improve the nitrogen fixation efficiency of root nodules have not been elucidated yet. How to regulate the nitrogen fixation efficiency of soybean root nodules and how to utilize this regulatory mechanism to improve the nitrogen fixation ability of soybeans and further improve the utilization rate of nitrogen by soybeans are the technical problems to be solved by our research group. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a protein, a gene, an editing vector thereof, and an application for controlling the symbiotic nitrogen fixation efficiency of soybeans.

[0008] The technical solution of the present invention is realized as follows:

[0009] A protein for controlling the symbiotic nitrogen fixation efficiency of soybeans, the protein having a chloroplast transit peptide at the amino terminus, four CBS functional domains, one PB1 functional domain, and a transmembrane domain at the carboxyl terminus.

[0010] Furthermore, the protein is localized in mitochondria and interacts with the transcription factor GmNFYC10a.

[0011] Preferably, the protein is localized in mitochondria through the transmembrane domain at the carboxyl terminus.

[0012] The above-mentioned protein for controlling the symbiotic nitrogen fixation efficiency of soybeans, the protein being GmNAS1 protein and GmNAP1 protein, wherein the amino acid sequence of GmNAS1 protein is shown in SEQ ID NO.4, the amino acid sequence of GmNAP1 protein is shown in SEQ ID NO.5; the amino acid sequence of the transcription factor GmNFYC10a is shown in SEQ ID NO.6.

[0013] The nucleotide sequence of the GmNAS1 gene encoding GmNAS1 protein GmNAP1 is shown in SEQ ID NO.1, the nucleotide sequence of the

[0014] gene encoding GmNAP1 protein GmNAS1 is shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the transcription factor GmNFYC10a is shown in SEQ ID NO.1. GmNAP1 An overexpression vector containing the above

[0015] gene and / or

[0016] gene.

[0017] The application of the above protein or gene in improving the symbiotic nitrogen fixation efficiency of plants, enhancing the environmental adaptability of plants, and increasing the yield of plants.

[0018] The application of the above overexpression vector in improving the symbiotic nitrogen fixation efficiency of plants, enhancing the environmental adaptability of plants, and increasing the yield of plants.

[0019] The present invention has the following beneficial effects:

[0020] 1. Two genes of soybean were discovered in this application GmNAS1 , GmNAP1 and one transcription factor GmNFYC10a . The gene sequences of the three were obtained by reverse genetics means, and isolation, cloning and verification were successfully carried out using the soybean hairy root transient transformation system, stable transgenic plants, PCR reaction and gene sequencing. The soybean genes GmNAS1 , GmNAP1 and the transcription factor GmNFYC10a control the symbiotic nitrogen fixation efficiency of soybean through their mutual interaction. When the carbon source supply in nodules increases, GmNAS1 can sense the decrease in AMP content caused by the increase in the energy state of nodules, thereby promoting the formation of more homologous dimers of GmNAS1 and GmNAP1 proteins. The homologous dimers of GmNAS1 and GmNAP1 bind to the transcription factor GmNFYC10a on mitochondria, reducing the nuclear content of GmNFYC10a, thereby reducing the expression of the pyruvate kinase gene, reducing the conversion of PEP to pyruvate, and enabling more PEP to form oxaloacetate and malate, increasing the carbon source supply to bacteroids in nodules, and thus enhancing the nitrogen fixation ability of nodules. This study reveals GmNAS1 , GmNAP1 and GmNFYC10a the molecular mechanism of improving nodule nitrogen fixation efficiency by regulating the flow direction of PEP.

[0021] 2. The two soybean genes of this application GmNAS1 , GmNAP1 and one transcription factor GmNFYC10a control the increase in nodule nitrogen fixation efficiency when the carbon source supply in soybean increases. By overexpressing the relevant genes in soybean, the operation of the relevant signal pathways will be further enhanced, increasing the carbon source supply to bacteroids in nodules, and thus further enhancing the nitrogen fixation efficiency of soybean nodules.

[0022] 3. Overexpression of a pair of homologous genes of the Cystathionine β synthase (CBS) family in soybean GmNAS1 and GmNAP1GmNAS1 and GmNAP1 will further improve the nitrogen fixation ability of nodules when the carbon source supply is sufficient. Specifically, it redistributes the flow direction of carbon sources in nodules by reducing the nuclear accumulation of a transcription factor GmNFYC10a, thereby enhancing the nitrogen fixation ability of soybean nodules, further increasing the aboveground biomass of plants and the final yield. The research of the inventor will provide gene resources for nitrogen-efficient and molecular breeding of leguminous plants including soybean, and provide a theoretical basis for the molecular design of high-nitrogen-fixing soybean varieties, thus promoting the development of environmentally friendly green sustainable agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0024] Figure 1 For GmNAS1 and GmNAP1 the expression patterns of genes in the publicly available transcriptome database.

[0025] Figure 2 For pGmNAS1:GUS and pGmNAP1:GUS the GUS staining of transgenic hairy root nodules.

[0026] Figure 3 are the protein functional domains of GmNAS1 and GmNAP1.

[0027] Figure 4 is the localization of cTP-GFP-GmNAS1 and GmNAP1-GFP-TMR fusion proteins in the epidermal cells of Nicotiana benthamiana.

[0028] Figure 5 is the localization of cTP-GFP-GmNAS1 and GmNAP1-GFP-TMR fusion proteins in nodule cells.

[0029] Figure 6 is the immunoblot detection of GmNAS1 and GmNAP1 proteins in different cell fractions.

[0030] Figure 7 is the localization of GmNAS1-CFP and GmNAP1-CFP fusion proteins in the epidermal cells of Nicotiana benthamiana

[0031] Figure 8 is the detection of the binding of GmNAS1 to AMP / ADP / ATP / cAMP by isothermal titration calorimetry.

[0032] Figure 9 is the detection of the binding of GmNAP1 to AMP / ADP / ATP / cAMP by isothermal titration calorimetry.

[0033] Figure 10 is the detection of the binding of the GmNAS1 protein lacking the CBS functional domain to AMP by isothermal titration calorimetry.

[0034] Figure 11 For Ri-GmNAS1 / NAP1Analysis of nodulation phenotypes of transgenic hairy roots.

[0035] Figure 12 For cr-nas1 , cr-nap1 , cr-nas1nap1-1 and cr-nas1nap1-2 analysis of nodulation phenotypes of transgenic plants, where (A) cr-nas1 , cr-nap1 , cr-nas1nap1-1 and cr-nas1nap1-2 diagram of gene editing sites of mutants. (B) cr-nas1 , cr-nap1 , cr-nas1nap1-1 and cr-nas1nap1-2 detection of protein contents of GmNAS1 and GmNAP1 in mutants. (C-E) cr-nas1 , cr-nap1 , cr-nas1nap1-1 and cr-nas1nap1-2 analysis of nodulation phenotypes of mutants.

[0036] Figure 13 For GmNAS1 / GmNAP1 to interact with GmNFYC10a in mitochondria, where (A) immunoprecipitation mass spectrometry detection of GmNAP1. (B) BiFC detection of the interaction between GmNAS1 / GmNAP1 and GmNFYC10a. (C) Pull-down detection of the interaction between GmNAS1 / GmNAP1 and GmNFYC10a.

[0037] Figure 14 For the energy state of soybean nodules to regulate the nuclear localization of GmNFYC10a, where (A) fluorescence localization of GmNFYC10a-GFP in tobacco epidermal cells. (B) Treatment with oligomycin or AMP induced the nuclear entry of GmNFYC10a protein in nodule cells. (C) Statistical analysis of the fluorescence localization of GmNFYC10a-GFP.

[0038] Figure 15 For GmNAS1 / GmNAP1 to affect the glycolysis pathway in soybean nodules, where (A-B) Ri-EV and Ri- GmNAS1 / NAP1 differentially expressed genes in nodules of transgenic hairy roots. (C) Ri-GmNAS1 / NAP1 KEGG enrichment analysis of downregulated genes in nodules. (D) Ri-GmNAS1 / NAP1 glycolysis genes downregulated in nodules.

[0039] Figure 16 For GmNFYC10a to activate the glycolysis pathway in soybean nodules, where (A) regulatory motif analysis of the promoters of 10 glycolysis genes. (B) GmNFYC10a and PK1a / GAPC1 / PK2aChIP-qPCR analysis of the promoter. (C) GmNFYC10a and PK1a / GAPC1 / PK2a Transcriptional activation analysis of promoters.

[0040] Figure 17 GmNAS1 / GmNAP1 and GmNFYC10a regulate the distribution of PEP in soybean nodules, including (A) Detection of GmNFYC10a protein content in nodule nuclei before and after sucrose treatment. (B) Detection of glycolytic gene expression levels in nodules before and after sucrose treatment. (C) After sucrose treatment, W82, cr-nas1 , cr-nap1 and cr-nas1nap1-1 Detection of the expression level of glycolytic genes in nodules. (DF) After sucrose treatment, W82, cr-nas1 , cr-nap1 and cr-nas1nap1-1 The contents of pyruvate, oxaloacetate, and malate in nodules, as well as the ratio of pyruvate to oxaloacetate. DETAILED DESCRIPTION

[0041] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0042] Example 1

[0043] This application identified a pair of homologous genes highly expressed in soybean nodules by searching the expression of soybean CBS family genes in the soybean gene transcriptome database published online. GmNAS1 and GmNAP1 ( Figure 1 );

[0044] GmNAS1 The gene sequence was obtained using the following method:

[0045] The total volume of the reaction system was 50 μl, and the template was 1 μL (about 50 ng) of genomic DNA of soybean line W82, 5 μl of 10×KOD enzyme reaction buffer, 2 μl of 25 mM MgCL2, 5 μl of 5 mM dNTP, 5 μl of 5 uM primer (primers NAS1-F and NAS1-R, 2.5 μl of each primer), 1 μl of KOD enzyme, and ddH2O (sterile deionized water) was added to 50 μl.

[0046] The reaction program was as follows: denaturation at 94°C for 5 min, 35 cycles of 94°C for 30 s, 55°C for 1 min, and 68°C for 4 min, and extension at 68°C for 10 min.

[0047] The primers are as follows:

[0048] NAS1-F: ATGAGCACCACTCAAGCTTC;

[0049] NAS1-R: TTACTGTCTAGAGCGCTTTA;

[0050] Finally, a gene sequence containing the nucleotide as described in SEQ ID NO.1 is obtained, and the protein encoded by this gene is as shown in SEQ ID NO.4.

[0051] The protection scope of the present invention also includes the nucleotide sequence corresponding to the amino acid sequence shown in SEQ ID NO.4, and also includes the protein with the same function obtained by modifying and modifying the sequence shown in SEQ ID NO.4.

[0052] GmNAP1 The gene sequence of... is obtained by the following method:

[0053] The total volume of the reaction system is 50 μl. The template is 1 μL (about 50 ng) of genomic DNA of soybean line W82, 5 μl of 10×KOD enzyme reaction buffer, 2 μl of 25 mM MgCL2, 5 μl of 5 mM dNTP, 5 μl of 5 uM primers (primers NAP1-F and NAP1-R, 2.5 μl for each primer), 1 μl of KOD enzyme, and ddH2O (sterile deionized water) is added to 50 μl.

[0054] The reaction procedure is: denaturation at 94°C for 5 min, 94°C for 30 s, 55°C for 1 min, 68°C for 3.5 min for 35 cycles, and extension at 68°C for 10 min.

[0055] The primers are as follows:

[0056] NAP1-F: ATGAGCAGCACTGAAACTTC;

[0057] NAP1-R: TTACTGTCTAGAGCGCTTTA;

[0058] Finally, a gene sequence containing the nucleotide as described in SEQ ID NO.2 is obtained, and the protein encoded by this gene is as shown in SEQ ID NO.5.

[0059] The protection scope of the present invention also includes the nucleotide sequence corresponding to the amino acid sequence shown in SEQ ID NO.5, and also includes the protein with the same function obtained by modifying and modifying the sequence shown in SEQ ID NO.5.

[0060] GmNFYC10aThe gene sequence was obtained using the following method:

[0061] The total volume of the reaction system was 50 μl, with the template being 1 μL (about 50 ng) of genomic DNA of soybean line W82, 5 μl of 10×KOD enzyme reaction buffer, 2 μl of 25 mM MgCL2, 5 μl of 5 mM dNTP, 5 μl of 5 uM primers (primers NFYC10a-F and NFYC10a-R, 2.5 μl for each primer), 1 μl of KOD enzyme, and ddH2O (sterile deionized water) was added to make up to 50 μl.

[0062] The reaction program was: denaturation at 94°C for 5 min, 30 s at 94°C, 1 min at 55°C, 2 min 35 cycles at 68°C, and extension at 68°C for 10 min.

[0063] The primers were:

[0064] NFYC10a-F: ATGGCTTCCTCCAACACTCC;

[0065] NFYC10a-R: TTAACTTCCTCCTTTTCCTG;

[0066] Finally, a gene sequence containing the nucleotide shown in SEQ ID NO.3 was obtained, and the protein encoded by this gene is shown as SEQ ID NO.6.

[0067] The protection scope of the present invention also includes the nucleotide sequence corresponding to the amino acid sequence shown in SEQ ID NO.6, and also includes the protein with the same function obtained by modifying and modifying the sequence shown in SEQ ID NO.6.

[0068] Example 2

[0069] By constructing GmNAS1 and GmNAP1 vectors for driving the expression of the reporter gene GUS by the gene promoter (the nucleotide sequences of the promoters are shown as SEQ ID NO.7 and SEQ ID NO.8 respectively) pGmNAS1:GUS and pGmNAS1:GUS and transforming soybean hairy roots, GUS staining was performed on the obtained positive roots and root nodules, and it was found that GmNAS1 and GmNAP1 were not expressed in the early stage of root and root nodule development, but GmNAS1 was expressed in all regions of mature root nodules, GmNAP1 and was highly expressed only in the infection zone of mature root nodules ( Figure 2 ).

[0070] The GmNAS1 and GmNAP1 proteins are predicted to have a chloroplast transit peptide (cTP) at the amino terminus, four CBS domains, a PB1 (Phox and Bem1) domain, and a transmembrane region (TMR) at the carboxyl terminus ( Figure 3 ).

[0071] Construct p35S:cTP-GFP-GmNAS1 and p35S:GmNAP1-GFP-TMR vectors and transform Agrobacterium tumefaciens GV3101. Inject the successfully transformed Agrobacterium tumefaciens GV3101 into the leaves of Nicotiana benthamiana, and observe the GFP fluorescence in the leaf epidermal cells using a laser confocal microscope. It is found that the fluorescence is localized in the mitochondria ( Figure 4 ). Construct pGmNAS1:cTP- GFP-GmNAS1 and pGmNAP1:GmNAP1-GFP-TMR vectors and transform Agrobacterium rhizogenes K599. Infect the soybean root callus with the successfully transformed Agrobacterium rhizogenes K599 to obtain soybean hairy roots. Twenty-five days after inoculating the soybean hairy roots with the slow-growing rhizobium USDA110, section the nodules on the hairy roots and observe the GFP fluorescence in the nodule section cells using a laser confocal microscope. It is found that the fluorescence is localized in the mitochondria ( Figure 5 ). Harvest the soybean nodules, use density gradient centrifugation to separate the mitochondrial, cytoplasmic, and nuclear fractions of the nodule cells, then extract the proteins from each fraction and detect the protein levels of GmNAS1 and GmNAP1. It is found that GmNAS1 and GmNAP1 are only detected in the mitochondrial fraction ( Figure 6 ). Construct p35S: GmNAS1-CFP and p35S:GmNAP1-CFP vectors and transform Agrobacterium tumefaciens GV3101. Inject the successfully transformed Agrobacterium tumefaciens GV3101 into the leaves of Nicotiana benthamiana, and observe the CFP fluorescence in the leaf epidermal cells using a laser confocal microscope. It is found that the fluorescence is localized in the nucleus and cytoplasm, indicating that the mitochondrial localization of GmNAS1 and GmNAP1 requires the transmembrane domain at the carboxyl terminus ( Figure 7 ).

[0072] Express and purify the GmNAS1 and GmNAP1 proteins using the Escherichia coli prokaryotic expression system, and then use isothermal titration calorimetry to detect the binding ability of GmNAS1 / GmNAP1 to AMP, ADP, ATP, and cAMP. It is found that GmNAS1 can bind AMP and ADP, and the dissociation constants are 3.94 μM and 40.32 μM respectively. GmNAS1 does not bind to ATP and cAMP ( Figure 8 ); GmNAP1 does not bind to AMP, ADP, ATP, or cAMP (Figure 9 ), the GmNAS1 protein lacking any one of the CBS domains could not bind AMP either ( Figure 10 ).

[0073] Example 3

[0074] GmNAS1 and GmNAP1 Construction and application of gene interference vector:

[0075] In the soybean line W82, GmNAS1 and GmNAP1 genes were subjected to RNAi in the hairy root transformation system. After inoculating the obtained transgenic hairy roots with USDA110, the phenotypes of the nodules formed were statistically analyzed on the 25th day, and it was found that Ri-GmNAS1 / NAP1 there were no changes in the number and weight of nodules on the transgenic hairy roots, but the nitrogenase activity of the nodules was significantly reduced ( Figure 11 ).

[0076] (1) Construction of plant expression vector Ri-GmNAS1 / NAP1 Construction

[0077] A 411bp fragment with high homology to the coding regions of GmNAS1 and GmNAP1 genes was amplified from W82, digested with AscI / SwaI and AvrII / BamHI restriction sites, and ligated to the RNAi vector pG2RNAi2 to construct Ri- GmNAS1 / NAP1 the recombinant vector.

[0078] The primers used are as follows:

[0079] Ri-GmNAS1 / NAP1-F: ACTCCTAGGGGCGCGCCCAAGCTTCCTCCAACAACAAG

[0080] Ri-GmNAS1 / NAP1-R: ACTGGATCCATTTAAATCACAACAGGGAGGTGTCTAAATC

[0081] (2) Soybean hairy root transformation mediated by Agrobacterium rhizogenes K599

[0082] 1) Sterilization and germination of soybean seeds

[0083] ① Seed sterilization. Select intact and disease-free soybeans and sterilize them with chlorine gas (measure 100 ml of sodium hypochlorite and place it in a 250 ml beaker. Slowly add 5 ml of concentrated hydrochloric acid along the inner wall of the beaker, and seal for sterilization for 16 hours).

[0084] ② Seed germination. Sow the sterilized soybean seeds in sterilized quartz sand, and place them in a soybean artificial climate chamber for 4 - 5 days until the cotyledons stand up and form an approximately right angle with the hypocotyl.

[0085] 2) Preparation of Agrobacterium rhizogenes carrying the target recombinant vector

[0086] Introduce the recombinant plasmid into Agrobacterium rhizogenes K599 to obtain the engineered bacteria; activate the engineered bacteria in a liquid medium, take 500 μl of the engineered bacteria liquid and spread it on a plate, and culture it at 28 °C for about 2 - 3 days to form a "bacterial film".

[0087] ) Infection

[0088] ① On the 5th day of germination (i.e., after 3 days of dark culture and 2 days of light culture), take out the soybean, and make an oblique cut along the 45° angle at the "green - white junction" of the hypocotyl.

[0089] ② Dip the cut of the soybean hypocotyl into the engineered bacteria on the bacterial plate of the engineered bacteria; put the infected soybean into a nitrogen - free solid medium and co - culture it in the dark for 2 days.

[0090] ③ Transfer the plant to a square dish with a nitrogen - containing medium, and culture the hypocotyl in the dark for 6 days.

[0091] ) Hairy root culture

[0092] Take out the plant, remove the roots growing from the callus at the cut surface, and then put the plant into a nitrogen - containing liquid medium and culture it for 9 - 10 days.

[0093] ) Identification and screening of transgenic positive roots

[0094] Take out the plant, dry the water on its roots with absorbent paper, detect the positive roots under a stereoscopic fluorescence microscope, and the roots with GFP green fluorescence are positive roots; only leave the thickest single positive root, and cut off the rest; continue to culture the plant with a single positive root in a nitrogen - containing FM medium for 4 - 5 days, and then transfer it to the soil for culturing and inoculating bacteria.

[0095] (3)Transgenic plant hairy roots GmNAS1 and GmNAP1 Expression level identification and phenotypic analysis.

[0096] After 25 days of inoculating with Rhizobium USDA110, measure the nodule number, nodule weight and nodule nitrogenase activity of the transgenic plant hairy roots, and at the same time use the Real Time qRT - PCR method to analyze the GmNAS1 and GmNAP1 gene expression levels in the nodules.

[0097] GmNAS1 - qF: CTGCCGTCAGCTATGCTAGG;

[0098] GmNAS1-qR: CCAGAACGGAGACGCAATGTA;

[0099] GmNAP1-qF: CATCCCCGACGGAACCAC;

[0100] GmNAP1-qR: GCCCCTCTGTGACGACTCTA

[0101] The transformed Agrobacterium rhizogenes K599 was used to infect the soybean root callus to obtain soybean hairy roots. Twenty-five days after inoculating the soybean hairy roots with the slow-growing rhizobium USDA110, Ri-GmNAS1 / NAP1 the nodules on the transgenic hairy roots were phenotypically counted and it was found that GmNAS1 and GmNAP1 down-regulation of the expression did not affect the number and weight of nodules, but significantly reduced the nitrogen fixation ability of nodules ( Figure 11 ).

[0102] Example 4

[0103] GmNAS1 and GmNAP1 Construction and application of gene editing vectors:

[0104] (1) Construction of plant expression vector CR-GmNAS1 / NAP1

[0105] First, 5’-CGGTGTCGAAAGTAATGACG-3’ and 5’-CTACTAGAGTCGTCGCCGAG-3’ were selected as the GmNAS1 and GmNAP1 sgRNA target sequences. The amplified sgRNA fragments were ligated into pBluescript-GmU6-tRNA to obtain the tRNA-gRNA intermediate vector. Then, the GmU6-tRNA-gRNA fragment of the intermediate vector was digested with PstI and KpnI and ligated into pCambia1300-35S-Cas9 vector to obtain the plant expression vector CR-GmNAS1 / NAP1 , which was transferred into W82 plants.

[0106] Among them, pBluescript-GmU6-tRNA vector was obtained by ligating the promoter sequence of soybean gene U6 (shown as SEQ ID NO.10) with the tRNA sequence (shown as SEQ ID NO.11), and then inserting them together into the commercial vector pBluescript to obtain pBluescript-GmU6-tRNA vector.

[0107] The primers used were as follows:

[0108] CR-GmNAS1 / NAP1-F: ttcccggctggtgcacggtgtcgaaagtaatgacggttttagagctagaaatagc;

[0109] CR-GmNAS1 / NAP1-R: gctatttctagctctaaaacctcggcgacgactctagtagtgcaccagccgggaa;

[0110] (2)Soybean genetic transformation

[0111] In this study, soybean transformation was carried out using the Agrobacterium EHA105-mediated cotyledon node transformation method of soybean. It mainly referred to the transformation method reported by previous researchers (Luth et al 2015) and was improved on this basis.

[0112] )Sterilization and germination of soybean seeds

[0113] ① Seed sterilization. Select intact and disease-free soybeans and sterilize them with chlorine gas (measure 100 ml of sodium hypochlorite and place it in a 250 ml beaker. Slowly add 5 ml of concentrated hydrochloric acid along the inner wall of the beaker and seal it for 16 hours for sterilization).

[0114] ② Seed germination. Place the sterilized soybean seeds on the germination medium and place them in a 22°C incubator for dark incubation for 16 - 24 hours to germinate them.

[0115] )Activation of Agrobacterium and preparation of infection solution

[0116] Take 250 μl of the cryopreserved bacterial solution and spread it on the LB plate with the corresponding antibiotic, and culture it overnight at 28°C. Use a disposable inoculation loop to scrape the bacterial film and suspend it in the liquid co-culture medium. Measure the concentration of the bacterial solution with a spectrophotometer to make the final concentration OD 600 = 0.5 - 0.6.

[0117] )Preparation of explants and infection

[0118] Retain the hypocotyl with a length of 3 - 5 mm, separate the two cotyledons, remove the seed coat, and cut off the primary bud. Then, use a blade to make several cuts at the cotyledon node part to obtain the cotyledon node explants for transformation. Place them in the infection solution and shake them on a horizontal shaker (rotation speed 50 - 80 r / min) for 30 minutes for infection.

[0119] )Co-culture

[0120] Pour out the bacterial solution, transfer the explants to the solid co-culture medium covered with a layer of sterile filter paper, 15 - 20 per petri dish, and culture them in a 22°C incubator in the dark for 3 - 5 days.

[0121] )Screening culture and plant regeneration

[0122] ① Bud induction culture: After co-culturing for 3 - 5 days, transfer the explants to the bud induction medium, place 5 explants in each petri dish, and culture under a photoperiod of 16 / 8 h (light / dark) at 25 °C. Subculture once every 2 weeks for 2 times.

[0123] ② Bud elongation culture: Remove the dead buds, cut off the cotyledon part, transfer the explants to the bud elongation medium, place 5 explants in each petri dish, and culture under a photoperiod of 16 / 8 h (light / dark) at 25 °C. Subculture once every 3 weeks for 2 - 4 times.

[0124] ③ Root induction: When the elongated seedlings grow to 3 cm in length, cut them off and transfer them to the root induction medium, and culture under a photoperiod of 16 / 8 h (light / dark) at 25 °C.

[0125] ) Acclimatization and transplanting culture

[0126] ① When the regenerated plants take root and grow more than two compound leaves, take out the plants, wash the medium on the roots, and plant them in small flower pots filled with sterilized vermiculite. Acclimatize the plants in an artificial intelligence incubator (temperature 25 °C, photoperiod 16 / 8 h, relative humidity 85% RH, light intensity 90 μM / m 2 / s) for 5 - 7 days.

[0127] ② After the plants become strong, transplant them into large flower pots (nutrient soil: vermiculite = 1:1), and transfer them to a culture room (temperature 28 ± 2 °C, photoperiod 13.5 / 10.5 h, relative humidity 40% - 60% RH, light intensity 90 μM / m 2 / s) to grow to maturity.

[0128] (3) Transgenic plants CR-GmNAS1 / NAP1 Identification of editing sites and phenotypic analysis.

[0129] Design primers for identifying editing sites according to the target sequences of sgRNA on GmNAS1 and GmNAP1 . After amplifying the corresponding fragments, send them for sequencing, and analyze the sequencing results to obtain cr-nas1 , cr-nap1 , cr-nas1nap1-1 and cr-nas1nap1-2 four loss-of-function mutants. Measure the nodule number, nodule weight, and nodule nitrogenase activity of these mutant plants 25 days after inoculating with rhizobia USDA110.

[0130] The primers used are as follows:

[0131] GmNAS1-JD-F: CATTCACATTCAGAAGAATGAGCAC

[0132] GmNAS1-JD-R: CTAGACGTGTTTTTTTTAGACACCG

[0133] GmNAP1-JD-F: TCATTCATCGAAACACAGAGAGAAG

[0134] GmNAP1-JD-R: TTGAAAAATGCTTTCCTCCAAACAG

[0135] Using gene editing technology, we obtained GmNAS1 functional knockout mutants cr-nas1 , GmNAP1 functional knockout mutants cr-nap1 , and GmNAS1 and GmNAP1 double knockout mutants cr-nas1nap1-1 and cr-nas1nap1- 2 , and phenotypic measurements were performed on the nodules of these four soybean mutants 25 days after inoculation with USDA110. It was found that under normal growth conditions, there were no significant differences in the nodule number, weight, and nitrogenase activity of these mutants compared with the wild-type W82 plants. However, after treatment with 3% (w / v) sucrose solution for three days, we found that the nitrogenase activity of the wild-type plants was significantly increased compared with that without sucrose application, but cr-nas1 , cr-nap1 , cr-nas1nap1-1 and cr-nas1nap1-2 the nitrogenase activities of the mutants were similar to those of the plants without sucrose application, indicating that GmNAS1 and GmNAP1 controlled the enhancement of sucrose on the nitrogen fixation ability of soybean nodules ( Figure 12 ).

[0136] Example 5

[0137] This application also used immunoprecipitation coupled with mass spectrometry analysis technology to search for candidate proteins that bind to GmNAP1. A transcription factor GmNFYC10a was found in the mass spectrometry results. The pull-down method proved that GmNFYC10a could interact with GmNAS1 / GmNAP1, and it was found that the binding of AMP to GmNAS1 would significantly inhibit the interaction between GmNAS1 and GmNFYC10a. Bimolecular fluorescence complementation (BiFC) technology further showed that GmNFYC10a interacted with GmNAS1 / GmNAP1 on mitochondria ( Figure 13). After injecting the GmNFYC10a-GFP fusion protein into Nicotiana benthamiana leaves, we found that GmNFYC10a was localized in the nucleus, indicating that GmNFYC10a might be localized on mitochondria by interacting with GmNAS1 / GmNAP1, and the intracellular AMP concentration might affect the nuclear localization of GmNFYC10a. To verify this speculation, we first obtained GmNFYC10a-GFP transgenic hairy roots, performed vibratome sectioning on mature nodules 25 days after inoculation with rhizobia, and found that the fluorescence was mainly localized in mitochondria. After treating the sections with oligomycin or AMP for 2 hours, the fluorescence in the nucleus increased significantly, indicating that the increased AMP content caused by the reduced energy state of nodule cells would increase the content of GmNFYC10a in the nucleus by weakening the interaction between GmNFYC10a and GmNAS1 in mitochondria ( Figure 14 ).

[0138] For Ri-GmNAS1 / NAP1 transcriptome sequencing analysis of nodules on transgenic hairy roots, we found GmNAS1 / GmNAP1 downregulated expression affected many biological processes, including glycolysis and gluconeogenesis pathways. Among them, the expression of 10 genes in the glycolysis pathway was significantly downregulated, and 5 of these 10 genes were pyruvate kinase genes ( Figure 15 ). Analysis of the promoters of these 10 glycolytic genes identified a binding motif for the Nuclear Factor Y (NF-Y) transcription complex, indicating that the subunit GmNFYC10a of the NF-Y complex might regulate the expression of these glycolytic genes. The results of chromatin immunoprecipitation coupled with quantitative PCR (ChIP-qPCR) showed that GmNFYC10a indeed bound to PK1a / GAPC1 / PK2a the promoter region of the gene. Further dual-luciferase activation assays (dual-LUC) proved that GmNFYC10a could indeed activate the expression of the glycolytic gene PK1a / GAPC1 / PK2a ( Figure 16 ).

[0139] Example 6

[0140] Previous experimental results showed that a decrease in nodule energy status increased the nuclear content of GmNFYC10a, while sucrose treatment could improve nodule energy status. Therefore, we isolated the nuclei of soybean nodule cells before and after sucrose treatment and detected the protein level of GmNFYC10a in them. It was found that the protein content of GmNFYC10a in the nuclei decreased significantly after sucrose treatment, and the expression of glycolysis-related genes was also significantly down-regulated. After sucrose treatment GmNAS1 / GmNAP1 mutant cr-nas1 、 cr- nap1 and cr-nas1nap1-1 showed significantly higher expression of glycolysis-related genes than the wild type W82, indicating that the decrease in the nuclear content of GmNFYC10a regulated by GmNAS1 / GmNAP1 controlled the inhibition of glycolysis gene expression under sucrose treatment ( Figure 17 ). Since half of these regulated glycolysis genes encode pyruvate kinase (catalyzing the conversion of PEP to pyruvate), we detected the pyruvate content in the nodules of W82, cr-nas1 、 cr-nap1 and cr-nas1nap1-1 under sucrose treatment and found that cr- nas1 、 cr-nap1 and cr-nas1nap1-1 had significantly higher pyruvate content in nodules than the wild type, while the content of oxaloacetate and malate converted from PEP was significantly lower than that of the wild type, indicating that GmNAS1 and GmNAP1 loss of function affected the distribution of PEP in soybean nodules ( Figure 17 ).

[0141] The above is only the preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of GmNAS1 protein and GmNAP1 protein in improving symbiotic nitrogen fixation efficiency of plants, enhancing plant environmental adaptability and increasing plant yield, characterized in that: The amino acid sequence of the GmNAS1 protein is shown in SEQ ID NO.4, and the amino acid sequence of the GmNAP1 protein is shown in SEQ ID NO.

5. The plant is soybean.

2. Use of genes encoding GmNAS1 protein and GmNAP1 protein in improving symbiotic nitrogen fixation efficiency of plants, enhancing plant environmental adaptability and increasing plant yield, characterized in that: The amino acid sequence of the GmNAS1 protein is shown in SEQ ID NO.4, and the amino acid sequence of the GmNAP1 protein is shown in SEQ ID NO.

5. The plant is soybean.

3. Comprising GmNAS1 gene and GmNAP1 The application of the overexpression vector of the gene in improving the symbiotic nitrogen fixation efficiency of plants, enhancing the environmental adaptability of plants and increasing the plant yield, characterized in that: The said GmNAS1 nucleotide sequence of the gene is shown as SEQ ID NO.1, and the said GmNAP1 nucleotide sequence of the gene is shown as SEQ ID NO.2, and the plant is soybean.

4. The application according to claim 3, wherein: The overexpression vector described in claim 3 is transferred into the plant to be improved by a genetic transformation method, and then transgenic positive plants are screened for cultivation.

Images