Construction Method and Application of Recombinant Yeast with High Ergoline Alkaloid Yield in High-Yield Farmland

Abstract

The present invention relates to the field of biotechnology, and specifically to a method for constructing a recombinant yeast with high-yield agroclavine and its application. The present invention optimizes the yield of agroclavine by reconstructing the heterologous synthesis pathway by determining the subcellular expression sites of the enzymes (DmaW, EasF, EasE, EasC, EasD, EasA, EasG) of the heterologous pathway for the biosynthesis of agroclavine in Saccharomyces cerevisiae strains. The present invention determines the subcellular expression sites and expression levels of the enzymes (DmaW, EasF, EasE, EasC, EasD, EasA, EasG) of the heterologous pathway for the biosynthesis of agroclavine in Saccharomyces cerevisiae strains, and further proves that the introduction of this heterologous pathway will cause cofactor imbalance in the endogenous environment, providing favorable evidence for subsequent further optimization of agroclavine production, and also providing a high-yield chassis for the biosynthesis of ergotic acid derivatives using agroclavine as a precursor.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for constructing a high-yield ergot alkaloid recombinant yeast and its application. Background Art

[0002] Ergot alkaloids are mainly secondary metabolites of three types of fungi, namely Aspergillus, Claviceps, and Neotyphodium. They are a class of fungal indole alkaloid natural products with strong pharmacological activities and are raw materials for treating migraine, uterine bleeding, Parkinson's disease, and other diseases. Alkaloid drugs are usually semi-synthesized from starting materials extracted from plants, which often limits their availability and final price. In recent years, the progress of synthetic biology has made it possible to introduce complete plant pathways into microorganisms to produce plant alkaloids.

[0003] The production of modified alkaloids by microorganisms has the potential to accelerate the semi-synthesis of alkaloid drugs. It provides higher-level intermediates that are structurally closer to the final drugs and can be used as higher-level intermediates for the synthesis of new drugs. For decades, ergot alkaloids have been intensively studied, mainly because of their harmful effects in contaminated food and feed, but also because of their beneficial applications in medicine and agriculture.

[0004] The source substrates for ergot alkaloid synthesis are tryptophan and dimethylallyl pyrophosphate (DMAPP). Although the common precursor in its biosynthetic pathway can currently be determined as chanoclavine-I, the downstream synthetic pathway of chanoclavine-I is not very clear, and the specific catalytic mechanism and reaction mechanism are unknown. A total of four enzymes are involved in the formation of chanoclavine-I, namely DamW, EasF, EasE, and EasC. The two enzymes DamW and EasF are not the limiting factors for the formation of chanoclavine-I. The key is the study of EasE and EasC. The researchers successfully synthesized chanoclavine-I from tryptophan and DMAPP in Saccharomyces cerevisiae, screened the two proteins EasE and EasC from Aspergillus japonicus to achieve the synthesis of chanoclavine-I, making it possible to express EasE and EasC heterologously in yeast. The study of the key enzymes EasE and EasC depends on fungal gene complementation, but further characterization is hindered by the difficult expression of the EasE protein. Finally, it was found that the N-terminal ER targeting signal peptide of EasE affects its expression activity in yeast. The researchers truncated the signal peptide of EasE for verification and did not attempt to co-localize other enzymes to organelles. The researchers achieved de novo synthesis of cycloclavine, a one-step downstream product of chanoclavine-I, in Saccharomyces cerevisiae. By increasing three copies of DamW and four copies of EasC, the yield of cycloclavine was 529 mg / L, the yield of chanoclavine-I was 0.75 mg / L, and the parallel by-product festuclavine was 89 mg / L. Fermentation optimization found that a low temperature of 22 °C significantly increased the catalytic rate of EasE and EasC, doubling the yield of chanoclavine-I by more than ten times. The researchers found that EasA is an important branch control point in the ergot alkaloid synthesis pathway. Sequence alignment showed that EasA is highly homologous to flavoenzymes. EasA is responsible for two functions, namely isomerization and reduction. The researchers obtained soluble protein EasG by expressing it in Escherichia coli. In vitro, by controlling the amount of reduced glutathione (GSH), NADPH, and chanoclavine aldehyde were incubated together, and agroclavine was finally obtained. In the ergot alkaloid synthesis pathway, GSH replaces the role of EasA, indicating that the specific catalytic mechanism of EasA or the catalytic mechanism from chanoclavine aldehyde to agroclavine is still unclear. The researchers further analyzed the catalytic reaction mechanism of EasC. EasC is mainly responsible for the biosynthesis of the central carbon ring of ergot alkaloids. The researchers proposed a radical theory to explain the dual functions of EasC - catalase and monooxygenase functions. So far, the difficulty in synthesizing agroclavine in heterologous hosts lies in the functional assignment of the EasA enzyme. The expression of the reduction function redirects chanoclavine aldehyde to festuclavine, and a titer of 89 mg / L has been achieved. The researchers also achieved heterologous synthesis of ergot acid in Aspergillus nidulans by optimizing the P450 electron transfer pathway and the copy number of CloA.By using the Enzyme Function Initiative - Enzyme Similarity Tool (EFI - EST), the researchers searched for homologous genes of pathway enzymes (EasE, EasA, and CloA) to reconstruct the pathway in engineered Saccharomyces cerevisiae. Finally, ergine with a titer of 1.7 mg / L was produced in a 1 L bioreactor, where the titer of its important precursor agroclavine could only reach 2.8 - 3.1 μg / L.

[0005] As an intermediate in an important branch direction of the ergoline alkaloid synthesis pathway, agroclavine plays a crucial role in the development of a series of biosynthetic ergine derivatives. Successfully achieving the synthesis of ergine in engineered Saccharomyces cerevisiae will further prove the great potential of optimizing the production of agroclavine in Saccharomyces cerevisiae. Among ergoline alkaloids, ergine derivatives are a class mainly used for pharmaceutical development. Therefore, optimizing the high - yield biosynthesis of agroclavine is of great significance for the research of downstream ergoline alkaloids. Summary of the Invention

[0006] In view of this, the present invention provides a method for constructing a recombinant yeast with high - yield agroclavine and its application.

[0007] The present invention provides a method for constructing a recombinant yeast with high - yield agroclavine and its application. The present invention determines the subcellular expression sites and expression levels of heterologous pathway enzymes (DmaW, EasF, EasE, EasC, EasD, EasA, EasG) for the biosynthesis of agroclavine in Saccharomyces cerevisiae strains, and further proves that the introduction of this heterologous pathway will cause cofactor imbalance in the endogenous environment, providing favorable evidence for subsequent continuous optimization of agroclavine production, and also providing a high - yield chassis for the biosynthesis of ergine derivatives using agroclavine as a precursor.

[0008] To achieve the above - mentioned invention purpose, the present invention provides the following technical solutions:

[0009] The present invention provides the application of any of the following items in the synthesis of agroclavine;

[0010] (I), localize EasD, EasA, and / or EasG to the endoplasmic reticulum; and / or

[0011] (II), over - express POS5; and / or

[0012] (III), localize DmaW to the endoplasmic reticulum; and / or

[0013] (IV), increase the copy number of EasE and / or EasC; or

[0014] (V), increase the copy numbers of DmaW, EasE, and EasC; or

[0015] (VI), insert Tat2 to increase the copy numbers of DmaW, EasE, and EasC; or

[0016] (VII), insert Tat2, localize DmaW to the endoplasmic reticulum, and increase the copy numbers of DmaW, EasE, and EasC.

[0017] The present invention also provides a combined element, which includes EasD, EasA, and / or EasG that are co-localized on the endoplasmic reticulum.

[0018] In some specific embodiments of the present invention, the co-localization is achieved by means of the signal peptide HDEL; the signal peptide is placed at the C-terminus of EasD, EasA, and EasG.

[0019] In some specific embodiments of the present invention, the combined element further includes overexpressed POS5.

[0020] In some specific embodiments of the present invention, the combined element further includes DmaW that is localized on the endoplasmic reticulum.

[0021] In some specific embodiments of the present invention, the combined element further includes DmaW, EasE, and / or EasC that independently increase the copy numbers.

[0022] In some specific embodiments of the present invention, the combined element further includes Tat2, and

[0023] (I), the DmaW is localized on the endoplasmic reticulum, and the copy numbers of EasE and / or EasC are increased; or

[0024] (II), the copy numbers of DmaW, EasE, and EasC are increased; or

[0025] (III), the DmaW is localized on the endoplasmic reticulum, and the copy numbers of DmaW, EasE, and EasC are increased.

[0026] In some specific embodiments of the present invention, the localization of DmaW is achieved by means of the signal peptide HDEL; the signal peptide is placed at the C-terminus of DmaW.

[0027] Based on the above research, the present invention also provides a plasmid, which includes the combined element.

[0028] The present invention also provides a host, which includes the plasmid.

[0029] In some specific embodiments of the present invention, the host includes but is not limited to Saccharomyces cerevisiae;

[0030] The host further includes other yeasts, algae, molds, and / or bacteria;

[0031] The other yeasts include yeasts of the genus Lipomyces and yeasts of the genus Kluyveromyces; the molds include Streptomyces; the bacteria include Escherichia coli and Bacillus subtilis.

[0032] The present invention also provides the use of any of the following in the synthesis of agroclavine;

[0033] (I), the combination element; and / or

[0034] (II), the plasmid; and / or

[0035] (III), the host.

[0036] The present invention also provides the use of any of the following in the synthesis of ergot alkaloids and / or drugs;

[0037] (I), the combination element; and / or

[0038] (II), the plasmid; and / or

[0039] (III), the host.

[0040] In some specific embodiments of the present invention, the ergot alkaloids include ergot acid derivatives; the drugs include ergot acid derivatives.

[0041] In some specific embodiments of the present invention, the use includes using the combination element to regulate cofactor balance.

[0042] The present invention also provides a method for synthesizing agroclavine, comprising culturing the host.

[0043] Specifically, the present invention provides a method for synthesizing agroclavine, including heterologous enzyme localization and quantitative detection, re-designing and constructing a strain, and quantifying agroclavine in the strain.

[0044] In some specific embodiments of the present invention, the method for heterologous enzyme localization includes co-transforming plasmid A carrying different subcellular organelle characteristic proteins with green fluorescent labels and plasmid B carrying the target protein with red fluorescent labels into YCTH, culturing to obtain a seed culture, and then culturing the seed culture to observe the localization.

[0045] In some specific embodiments of the present invention, plasmid A includes P APC , P AMC , P AER , P AC ; plasmid B includes P BW , P BF , P BE , P BC , P BD , P BA , P BG .

[0046] In some specific embodiments of the present invention, the medium used for culturing the seed culture is SD medium; the temperature for culturing the seed culture is 30 °C, the rotation speed is 220 rpm, and the time is 24 h; the temperature for further culturing the seed culture is 30 °C, the rotation speed is 250 rpm, and the time is 10 h.

[0047] In some specific embodiments of the present invention, the method for quantifying the heterologous enzyme includes culturing the co-transformed YCTH to obtain a seed solution and a bacterial solution, and measuring the RFP fluorescence value; the medium used for culturing the seed solution is SD medium; the temperature for culturing the bacterial solution is 30 °C, the rotation speed is 250 rpm, and the time is 120 h; the OD of the bacterial solution required for measuring the RFP fluorescence value 600 is 2.5.

[0048] In some specific embodiments of the present invention, the culturing of the host includes seed culture and fermentation culture; the temperature for the seed culture is 30 °C, the rotation speed is 250 rpm, and the time is 14 - 16 h; the medium formula for the seed culture includes synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, and a mixed amino acid powder lacking tryptophan, leucine, histidine, and uracil 2 g / L; leucine and histidine are supplemented in the form of a 100× mother liquor.

[0049] In some specific embodiments of the present invention, the temperature for the fermentation culture is 22 °C, the rotation speed is 220 rpm, and the time is 120 h; the medium formula for the fermentation culture includes synthetic yeast nitrogen source YNB 6.7 g / L, glucose 40 g / L, and a mixed amino acid powder lacking tryptophan, leucine, histidine, and uracil 2 g / L; leucine and histidine are supplemented in the form of a 100× mother liquor.

[0050] In some specific embodiments of the present invention, the method for quantifying ergocornine includes: taking the fermentation broth of the host, centrifuging to obtain the supernatant, and performing LC-MS / MS analysis.

[0051] In some specific embodiments of the present invention, the rotation speed for centrifugation is 5000 rpm; the column used for LC-MS is a BEH amide column; the mobile phase A used for LC-MS / MS is 100% acetonitrile + 0.1% formic acid; the mobile phase B used for LC-MS / MS is water + 0.1% formic acid.

[0052] In some specific embodiments of the present invention, the flow rate of the LC-MS / MS gradient elution is 0.3 mL / min, and the time is 20 min; the mass resolution of the precursor used in the LC-MS / MS is 120,000; the positive spray voltage used in the LC-MS / MS is 3.5 kV, the capillary temperature is 320 °C, the sheath gas flow rate (arb) is 40, the aux gas flow rate (arb) is 10, the probe heater temperature is 350 °C, and the mass range (m / z) is 100-500.

[0053] The present invention also provides a method for synthesizing ergot alkaloids and / or drugs. The host is cultured to synthesize agroclavine; the agroclavine is used to synthesize ergot alkaloids and / or drugs.

[0054] In some specific embodiments of the present invention, the ergot alkaloids include ergot acid derivatives; the drugs include ergot acid derivatives.

[0055] The present invention provides a method for constructing and applying a recombinant yeast with high yield of agroclavine. By determining the subcellular expression sites of the enzymes (DmaW, EasF, EasE, EasC, EasD, EasA, EasG) of the heterologous pathway for biosynthesizing agroclavine in the Saccharomyces cerevisiae strain, the heterologous synthesis pathway is reconstructed to optimize the yield of agroclavine. The present invention determines the subcellular expression sites and expression levels of the enzymes (DmaW, EasF, EasE, EasC, EasD, EasA, EasG) of the heterologous pathway for biosynthesizing agroclavine in the Saccharomyces cerevisiae strain, and further proves that the introduction of this heterologous pathway will cause cofactor imbalance in the endogenous environment, providing favorable evidence for subsequent continuous optimization of the yield of agroclavine, and also providing a high-yield chassis for biosynthesizing ergot acid derivatives using agroclavine as a precursor. Description of the Drawings

[0056] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0057] Figure 1 It shows the fluorescence co-localization result diagram of the enzymes in the agroclavine biosynthesis pathway in Example 1;

[0058] Figure 2 It shows the schematic diagram of the quantitative distribution of the localization of the enzymes in the agroclavine biosynthesis pathway in Example 1;

[0059] Figure 3 It shows the strategy diagram for repositioning and adjusting the enzymes in the downstream pathway of clavine in Example 2;

[0060] Figure 4 It shows the result diagram of agroclavine produced after repositioning the enzymes in the downstream pathway of clavine in Example 2;

[0061] Figure 5 Figure showing the ergovaline results after overexpressing POS5 in Example 3;

[0062] Figure 6 Figure showing the ergovaline results produced after relocating the enzymes in the upstream pathway of lysergic acid in Example 4. Detailed implementation manners

[0063] The present invention discloses a method for constructing a recombinant yeast with high yield of ergovaline and its application. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0064] The object of the present invention is to provide a recombinant Saccharomyces cerevisiae strain with high yield of ergovaline by determining the subcellular localization and expression level of each pathway enzyme to adjust the relocation of the entire heterologous synthesis pathway in a recombinant Saccharomyces cerevisiae that can heterologously synthesize ergovaline, combined with the assistance of regulating the balance of endogenous cofactors.

[0065] The technical solution of the present invention is outlined as follows:

[0066] A method for optimizing a recombinant Saccharomyces cerevisiae strain for the production of agroclavine, comprising the following steps: (1) We established a system that can simultaneously detect the localization and quantification of heterologous enzymes. This system consists of two standardized plasmids (plasmid A and plasmid B). Plasmid A carries characteristic proteins of different subcellular organelles labeled with green fluorescence, and plasmid B carries the target protein labeled with red fluorescence. The localization and quantification of each pathway enzyme were determined by a laser confocal microscope and an enzyme-linked immunosorbent assay (ELISA) respectively to find the target problems existing in the agroclavine biosynthesis pathway. Among them, DmaW and EasA are localized in peroxisomes, EasF and EasC are expressed in the cytoplasm, EasE is localized in the endoplasmic reticulum, which is consistent with the reported results, and EasD and EasG are localized in mitochondria. (2) Normalized relocalization design was carried out on EasD, EasA, and EasG downstream of norverticillin. Using a strain producing agroclavine in the laboratory as the chassis strain (the chassis strain is the strain SyBE_Sc06130032 in patent CN202110467433.8), the optimization verification of agroclavine production was carried out. It was found that normalizing the relocalization of EasD, EasA, and EasG to the endoplasmic reticulum could significantly increase the yield of agroclavine; (3) Given the basis of previous studies on cofactor regulation, we overexpressed POS5 in the chassis after optimizing the downstream module to improve the cofactor balance in the endogenous environment and further increase the yield of agroclavine; (4) For DmaW, EasF, EasE, and EasC upstream of norverticillin, we relocalized DmaW to the endoplasmic reticulum and simultaneously increased the copy numbers of EasE and EasC, resulting in a further increase in the yield of agroclavine. Finally, a recombinant Saccharomyces cerevisiae strain with high agroclavine production was obtained.

[0067] Advantages of the present invention: The present invention determines the subcellular expression sites and expression levels of the heterologous pathway enzymes (DmaW, EasF, EasE, EasC, EasD, EasA, EasG) for the biosynthesis of agroclavine in Saccharomyces cerevisiae strains, and further proves that the introduction of this heterologous pathway will cause cofactor imbalance in the endogenous environment, providing favorable evidence for subsequent continuous optimization of agroclavine production improvement, and also providing a high-yield chassis for the biosynthesis of ergotic acid derivatives using agroclavine as a precursor.

[0068] Obtaining a recombinant Saccharomyces cerevisiae strain producing agroclavine: provided by the Yuan Yingjin research group, with the strain number SyBE_Sc06130032. The genetic modifications contained in this recombinant Saccharomyces cerevisiae are as follows: dmaW-easF is inserted at the Δ22 locus of chromosome XV, easE-easC is inserted at the Δ15 locus of chromosome XVI, ero1-fad1 is inserted at the Δ14 locus of chromosome VIII, easD is inserted at the GAL1 / 7 / 10 position, and easG-Pgal110-easA is ligated into the wn416 functional cassette (mentioned in patent CN202110466187.4) and exists in the form of a plasmid. The chassis strain for fluorescence imaging described in the present invention is a high-yield DMAPP recombinant Saccharomyces cerevisiae, provided by the Yuan Yingjin research group, with the strain number YCTH.

[0069] The name of the Saccharomyces cerevisiae strain used in the present invention is CEN.PK2-1D, but Saccharomyces cerevisiae is not limited to this one. In addition to the CEN.PK series, there are also the BY series, etc.; furthermore, the heterologous biosynthetic pathway of agroclavine provided by the present invention can be applied not only in Saccharomyces cerevisiae, but also in other yeasts (such as yeast of the genus Lipomyces, yeast of the genus Kluyveromyces, etc.), algae, molds (such as Streptomyces, etc.) and bacteria (such as Escherichia coli, Bacillus subtilis, etc.).

[0070] The sequences of the enzymes in the heterologous biosynthetic pathway of agroclavine in the present invention are shown as follows:

[0071] SEQ NO:1 (dmaW):

[0072]

[0073] SEQ NO:2 (easF):

[0074]

[0075] SEQ NO:3 (easE):

[0076]

[0077] SEQ NO:4 (easC):

[0078]

[0079] SEQ NO:5 (easD):

[0080] GCGGCCGCGGTCTCCAATGCCATCCATGACCTCTAAAGTTTTTGCTATTACTGGTGGTGCTTCTGGTATTGGTGCTGCTACATGTAGATTGTTGGCTGAAAGAGATGCTGCTGTTATTTGTTTGGCTGATGTTTCTTCTACTAATTTTACTTCTTTGCAAGAATCCATTGCTAAATCTAATCCATCTACTTTGGTTCATTGTACTGAATTGGATGTTAGATCAGCTGATAAGGTTGATCAATGGTTGCAATCTATTGTTTCTACTCATGGTGATTTACATGGTGCTGCTAATGTTGCTGGTATTGCTCAAGGTGCTGGTTTGAGAGCTACTCCAACTATTTTGGAAGAAAATGATGCTGAATGGTCTAGAATTTTGGATGTTAATTTGAACGGTGTTTTCTATTCTACTAGAGCTCAAGTTAGAGTTATGAAAGATTTGCCACCAGGTCATAGATCAATTGTTAATGTTGCTTCTATTGCTGCTTTTTCTCATGTTCCAGATGTTTATGCTTATGGTACTTCTAAATCCGCTTGTGCTTACTTGACTACCTGTATTGCTGCTGATGTTTTTTGGTCTGGTATTAGAGTTAATTGTGTTTCTCCTGGTATTACTAACACTCCAATGTTGCCACAATTTGAACCTAAAGCTAAATCTTTGGATGCTATTAAAGATATGTACAGAGATCAAGGTTACCCAACTGGTGAAGCTGATGGTGTTGCTAGAACAATTGTTTGGTTATTGAGTGAAGATTCTATTCCAGTTTACGGTGCTAATATTAATGTTGGTGCTTGTCCACCATAAAGGAGACCGCGGCCGC

[0081] SEQ NO:6 (easG):

[0082] GCGGCCGCGGTCTCCAATGACAATTTTGGTTTTGGGTGGTAGAGGTAAGACTGCTTCTAGATTGTCCTTGTTGTTGGATAATGCTGGTGTTCCATTTTTGGTTGGTTCTTCTTCTACTTCTTATGTTGGTCCATATAAGATGACTCATTTTGATTGGTTGAACGAAGATACTTGGACTAATGTTTTTTTGAGAGCTTCTTTGGATGGTATTGATCCTATTTCTGCTGTTTATTTGGTTGGTGGTCATGCTCCTGAATTGGTTGATCCTGGTATTAGATTTATTAACGTTGCTAGAGCTCAAGGTGTTAATAGATTTGTTTTGTTGTCTGCTTCTAACATTGCTAAGGGTACTCATTCTATGGGTATTTTGCATGCTCATTTGGATTCTTTGGAAGATGTTCAATATGTTGTTTTGAGGCCTACTTGGTTTATGGAAAATTTGTTGGAAGATCCACATGTTTCTTGGATTAAAAAGGAAGATAAGATTTACTCCGCTACTGGTGATGGTAAAATTCCATTCATTAGTGCTGATGATATTGCAAGAGTTGCTTTTTCAGTTTTGACAGAATGGAAAAGTCAAAGAGCTCAAGAATATTTTGTTTTGGGTCCAGAATTGTTGTCTTATGATCAAGTTGCTGATATTTTGACTACTGTTTTAGGTAGAAAGATTACTCATGTTTCATTGGCTGAAGCTGATTTGGCTAGATTGTTGAGAGATGATGTTGGTTTGCCTCCTGATTTTGCTGCTATGTTGGCTTCTATGGAAACCGATGTTAAGCATGGTACTGAAGTTAGAAATTCTCATGATGTTAAGAAGGTTACAGGTAGTTTGCCATGTTCTTTTTTGGATTTTGCTGAACAAGAAAAGGCTAGATGGATGAGACATTAAAGGAGACCGCGGCCGC

[0083] SEQ NO:7 (easA):

[0084]

[0085] In the method for constructing a high-yield ergoline recombinant yeast provided by the present invention and the application thereof, the raw materials and reagents used can all be purchased from the market.

[0086] The present invention will be further described below in conjunction with examples:

[0087] Example 1 Dual-color fluorescence co-localization and quantification standard system

[0088] The present invention has established a localization and quantification system that can simultaneously detect heterologous enzymes. This system consists of two standardized plasmids (plasmid A and plasmid B). Plasmid A carries different sub-organelle characteristic proteins labeled with green fluorescence, and plasmid B carries the target protein labeled with red fluorescence. Plasmid A (abbreviated as P A ) is obtained by seamless cloning and connection of PGAL1-PEX3-GGGS-GFP-TDH1t, PGAL1-COX4-GGGS-GFP-TDH1t, PGAL1-SEC61-GGGS-GFP-TDH1t, and PGAL1-yeGFP-TDH1t through primer design with homologous arms of 20 bp on each side of the incision after digestion of pRS414 with NotI. Among them, PEX3 is a characteristic protein of peroxisomes, and the corresponding plasmid A is P APC ; COX4 is a characteristic protein of mitochondria, and the corresponding plasmid A is P AMC ; SEC61 is a characteristic protein of the endoplasmic reticulum, and the corresponding plasmid A is P AER ; yeGFP is a characteristic protein of the cytoplasm, and the corresponding plasmid A is P AC . Plasmid B (abbreviated as P B ) is obtained by seamless cloning and connection of DmaW-GGGS-RFP, EasE-GGGS-RFPEasD-GGGS-RFP, and EasG-GGGS-RFP through primer design with homologous arms of 20 bp on each side of the incision after digestion of WN415 with BsaI. EasF-GGGS-RFP, EasC-GGGS-RFP, and EasA-GGGS-RFP are seamlessly cloned and ligated into the incision of WN415 digested with BsmBI through primer design with homologous arms of 20 bp on each side of the incision. WN415 is constructed by inserting the target fragment T TDH2 -P GAL110 -T FBA1 into pRS415 through the restriction enzyme site NotI. The functional expression module T TDH2 -P GAL110 -T FBA1Consistent with T in 'A "push - pull - restrain" strategy to improve citronellol production in Saccharomyces cerevisiae' in the literature TDH2 -P GAL1 -T FBA1 Consistent. The plasmids B constructed with DmaW, EasF, EasE, EasC, EasD, EasA, and EasG correspond to P BW , P BF , P BE , P BC , P BD , P BA , P BG . Then, according to the prediction results of the subcellular localization of DmaW, EasF, EasE, EasC, EasD, EasA, and EasG at the website (https: / / rostlab.org / owiki / index.php / Loctree3), pre - experiments were carried out. Respectively, P APC and P BW , P BA , P AMC and P BD , P BG , P AER and P BE , P AC and P BF , P BC were co - transfected into the YCTH chassis. The results of laser confocal microscopy showed that DmaW and EasA were localized in peroxisomes, EasF and EasC were expressed in the cytoplasm, EasE was localized in the endoplasmic reticulum, and EasD and EasG were localized in mitochondria( Figure 1 ). At the same time, P BW , P BF , P BE , P BC , P BD , P BA , P BG were separately transfected into the YCTH chassis, and the expression levels of enzymes in each pathway were tested with a microplate reader( Figure 2 ). The specific steps are as follows:

[0089] Determine protein localization: The strain was cultured in 3 mL of SD medium at 30 °C and 220 rpm for 24 h. The seed culture was inoculated into the same medium (5 mL), and the initial OD 600It was 0.2, and the culture was carried out at 30 °C and 250 rpm for 10 h. Observe the subcellular localization of DmaW, EasF, EasE, EasC, EasD, EasG and EasA, using a THUNDER Imager 3D culture microscope (Leica, Germany) or a Nikon Ti-E automatic inverted microscope (A1, equipped with a CFI Apo TIRF 100× oil objective lens. The laser wavelengths were 488 nm and 561 nm respectively. After the images were processed by ImageJ, they were exported through NIS-Elements AR software (Nikon).

[0090] Measurement of protein expression: The strain was cultured in 3 mL of SD medium at 30 °C and 220 rpm for 24 h to obtain a seed solution. Then the seed solution was inoculated into the same medium (50 mL) with an initial OD 600 of 0.2 and cultured at 30 °C and 250 rpm for 120 h to obtain a bacterial solution.

[0091] Obtaining RFP fluorescence: Dilute the bacterial solution obtained above to OD 600 of 2.5, and the final volume was 200 μL in a Corning 96-well plate (transparent). Measure the RFP fluorescence value on a Tecan Infinite 200M PLEX plate reader using i-control 1.10 software. The RFP fluorescence measurement used an excitation wavelength of 530 nm and an emission wavelength of 588 nm (with a bandwidth of 5 nm for both excitation and emission).

[0092] Both of the above-mentioned standardized plasmids A and B were ligated by an in vitro seamless cloning method. The ligation system was introduced into DH5α together, and the transformants were selected for amplified culture to extract plasmids for sequencing. The plasmids with correct sequencing were transformed into YCTH by the lithium acetate method. After co-transformation of PA and PB, screening was carried out using an SD-Leu-Trp solid plate (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, a mixed amino acid powder lacking tryptophan, leucine, histidine and uracil 2 g / L, 2% agar powder). After single transformation of PA, screening was carried out using an SD-Leu solid plate (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, a mixed amino acid powder lacking tryptophan, leucine, histidine and uracil 2 g / L, 2% agar powder). The selected transformants were boiled with 20 mmol / L NaOH solution for PCR verification, and the correct single colonies were isolated and purified for fluorescence imaging detection.

[0093] Example 2 Design of the downstream module EasD, EasA, EasG of lysergic alkaloid for normalized relocation to improve the yield of agroclavine

[0094] Relocation design construction: EasD and EasG are localized to mitochondria, and EasA is localized to peroxisomes. We selected the endoplasmic reticulum, peroxisomes, and mitochondria as the normalized subcellular expression sites for the enzymes in these three pathways ( Figure 3 ). The relocation of the endoplasmic reticulum was achieved by placing the signal peptide HDEL at the C-terminus of EasD, EasA, and EasG respectively. The relocation of mitochondria was achieved by placing the signal peptide MLSLRQSIRFFKPATRTLCSSR at the N-terminus of EasA. The relocation of peroxisomes was achieved by placing the signal peptide AAVKLSQAKSKL at the C-terminus of EasD and EasG. To test the effect of the relocation modification on the production of ergovaline, a control strain was constructed by increasing the copy number of EasD, EasA, and EasG in the same chassis SyBE_Sc06130032, with the strain number SyBE_Sc06130155. The strain numbers of EasD, EasA, and EasG with normalized relocation to peroxisomes are SyBE_Sc06130156, the strain numbers with normalized relocation to mitochondria are SyBE_Sc06130157, and the strain numbers with normalized relocation to the endoplasmic reticulum are SyBE_Sc06130158.

[0095] Experimental materials: Strains SyBE_Sc06130155 - SyBE_Sc06130158

[0096] Experimental methods:

[0097] Seed medium: SD-URA-TRP liquid medium (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine, and uracil 2 g / L, leucine and histidine supplemented in the form of 100× stock solution);

[0098] Fermentation medium: SD-URA-TRP liquid medium (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 40 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine, and uracil 2 g / L, leucine and histidine supplemented in the form of 100× stock solution).

[0099] Inoculate the above strains into 5 mL of seed medium and culture at 30 °C and 250 rpm for 14 - 16 h. Then inoculate them into 50 mL of fermentation medium at an initial cell concentration OD 600 = 0.2 and culture at 22 °C and 220 rpm for 120 h. Monitor the cell density (OD 600 ) at the end of fermentation and the production of ergovaline.

[0100] Quantitative detection method of ergocornine: Take 1 mL of the fermentation broth at the end of fermentation, centrifuge the bacteria at 5000 rpm to separate the cells, collect the supernatant, prepare the sample for LC-MS detection, and prepare the mother liquor of the standard product ergocornine with acetonitrile to obtain the calibration curve. Perform LC-MS / MS analysis in the positive ion mode using a Q Exactive HF orbitrap mass spectrometer and an Ultimate3000RSLC nano (Thermo Fisher Scientific, USA). Use a BEH amide column (2.1 mm × 100 mm, Waters, USA) for LC separation. Mobile phase A is 100% acetonitrile + 0.1% formic acid; mobile phase B is water + 0.1% formic acid. Gradient elution, 5% (A) to 95% (A), flow rate 0.3 mL / min, 20 min. The mass resolution of the precursor is 120,000. Other detailed parameters of the ion source are as follows: spray voltage, positive electrode 3.5 kV; capillary temperature: 320 °C; sheath gas flow rate (arb), 40; aux gas flow rate (arb), 10; probe heater temperature: 350 °C; mass range (m / z), 100 - 500.

[0101] Test results: Among the 4 strains, through the statistics of the ergocornine production of each strain, it was found that the strain numbered SyBE_Sc06130158 had the highest production, indicating that the normalization and relocation of EasD, EasA, and EasG to the endoplasmic reticulum can effectively increase the production of ergocornine (Table 1, Figure 4 ).

[0102] Table 1 Production of ergocornine by strains SyBE_Sc06130155 - SyBE_Sc06130158

[0103]

[0104] Example 3 Adjusting cofactor balance to improve the production of ergocornine

[0105] Based on the previous research in the laboratory, at the HO locus of strain SyBE_Sc06130158, PGAL1-POS5-TDH2t was inserted into the genome by CRISPRCas9 for overexpression to obtain strain SyBE_Sc06130200 to test the effect of adjusting the cofactor NADPH / NADH balance on the production of ergocornine.

[0106] Test materials: Strains SyBE_Sc06130158 and SyBE_Sc06130200

[0107] Test methods:

[0108] Seed medium: SD-URA-TRP liquid medium (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine and uracil 2 g / L, leucine and histidine are supplemented in the form of 100× mother liquor);

[0109] Fermentation medium: Blank control: SD-URA-TRP liquid medium (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 40 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine and uracil 2 g / L, leucine and histidine are supplemented in the form of 100× mother liquor).

[0110] Inoculate the above strain into 5 mL of seed medium and culture at 30 °C and 250 rpm for 14 - 16 h. Inoculate into 50 mL of fermentation medium at an initial cell concentration OD 600 = 0.2 and culture at 22 °C and 220 rpm for 120 h, and monitor the cell density (OD 600 ) and the yield of agroclavine.

[0111] Quantitative detection method of agroclavine: Refer to Example 2.

[0112] Test results: Compared with the control, the yield of agroclavine increased by 27% (Table 2, Figure 5 ).

[0113] Table 2 Yields of agroclavine of strains SyBE_Sc06130158 and SyBE_Sc06130200

[0114]

[0115] Example 4 Adjust the upstream modules DamW, EasE, EasC of clavine to improve the yield of agroclavine

[0116] To optimize the upstream module of clavine, we attempted to express Tat2 under the condition that the host can provide sufficient precursor DMAPP to increase the intake of exogenous tryptophan. TDH3P-Tat2-ADH1t was inserted into LUE2 in strain SyBE_Sc06130200 to obtain strain SyBE_Sc06130197. Since EasE must be localized to the endoplasmic reticulum for its catalytic activity to be ensured, the relocation of the endoplasmic reticulum was achieved by placing the signal peptide HDEL at the C-terminus of DmaW, and at the same time increasing the copy numbers of EasE and EasC to ensure an increase in the flux of clavine.

[0117] The strain SyBE_Sc06130189 has an additional copy of DmaW, EasE, and EasC in SyBE_Sc06130197, and the strain SyBE_Sc06130190 has an additional copy of DmaW_ER, EasE, and EasC in SyBE_Sc06130197.

[0118] Test materials: strains SyBE_Sc06130200, SyBE_Sc06130197, SyBE_Sc06130189, SyBE_Sc06130190

[0119] Test methods:

[0120] Seed medium: SD-URA-TRP-LUE liquid medium (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine, and uracil 2 g / L, histidine supplemented in the form of a 100× stock solution);

[0121] Fermentation medium: Blank control: SD-URA-TRP-LUE liquid medium (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 40 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine, and uracil 2 g / L, histidine supplemented in the form of a 100× stock solution).

[0122] Inoculate the above strains into 5 mL of seed medium and culture at 30 °C and 250 rpm for 14 - 16 h. Then inoculate them into 50 mL of fermentation medium at an initial cell concentration OD 600 = 0.2 and culture at 22 °C and 220 rpm for 120 h. Monitor the cell density (OD 600 ) and the production of agroclavine at the end of fermentation.

[0123] Quantitative detection method for agroclavine: Refer to Example 2.

[0124] Test results: Compared with SyBE_Sc06130197 and SyBE_Sc06130200, the production of agroclavine did not increase significantly, indicating that the effect of Tat2 is not obvious, suggesting that the endogenous tryptophan in the strain can meet the metabolic flux of agroclavine. Compared with SyBE_Sc06130189 and SyBE_Sc06130197, the production of agroclavine increased by 60%, indicating that the flux of secalonic acid has a significant impact on the synthesis of agroclavine; compared with SyBE_Sc06130190 and SyBE_Sc06130189, after relocating DmaW to the endoplasmic reticulum, the production of agroclavine increased by 25% again (Table 3, Figure 6 ).

[0125] Table 3 Yield of ergocornine of strains SyBE_Sc06130200, SyBE_Sc06130197, SyBE_Sc06130189, SyBE_Sc06130190

[0126]

[0127] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of any of the following in the synthesis of ergovaline; (I), localization of EasD, EasA and EasG to the endoplasmic reticulum; or (II), localization of DmaW to the endoplasmic reticulum; or (III), insertion of Tat2, localization of DmaW to the endoplasmic reticulum, and increasing the copy numbers of DmaW, EasE and EasC.

2. A combination element, characterized in that it comprises a nucleic acid molecule encoding EasD, EasA and EasG that are co-localized to the endoplasmic reticulum.

3. The combination element according to claim 2, characterized in that it further comprises a nucleic acid molecule encoding overexpressed POS5.

4. The combination element according to claim 3, characterized in that it further comprises a nucleic acid molecule encoding DmaW that is localized to the endoplasmic reticulum.

5. The combination element according to claim 4, characterized in that it further comprises nucleic acid molecules encoding DmaW, EasE and EasC that independently increase the copy numbers.

6. The combination element according to claim 2 or 3, characterized in that it further comprises a nucleic acid molecule encoding Tat2, and (I), a nucleic acid molecule encoding DmaW that is localized to the endoplasmic reticulum, and a nucleic acid molecule that increases the copy numbers of EasE and EasC; or (II), nucleic acid molecules that increase the copy numbers of DmaW, EasE and EasC; or (III), a nucleic acid molecule encoding DmaW that is localized to the endoplasmic reticulum, and nucleic acid molecules that increase the copy numbers of DmaW, EasE and EasC.

7. A plasmid, characterized in that it comprises the combination element according to any one of claims 2 to 6.

8. A host, characterized in that it comprises the plasmid according to claim 7.

9. Use of any of the following in the synthesis of ergovaline; (Ⅰ), the combination element according to any one of claims 2 to 6; and / or (Ⅱ), the plasmid according to claim 7; and / or (Ⅲ), the host according to claim 8.

10. The use according to claim 9, characterized in that the use comprises using the combination element according to any one of claims 3 to 6 to regulate cofactor balance.

Images