A circRNA for gastric cancer diagnosis and / or treatment, its application, detection primer pair and diagnostic kit
By using hsa_circ_0012172 circular RNA as an exosome marker, the problems of high invasiveness and low sensitivity in the diagnosis and treatment of gastric cancer are solved, non-invasive high-sensitivity diagnosis and effective treatment targets are achieved, and new diagnostic and treatment options are provided for gastric cancer patients.
Patent Information
- Application Number
- CN202210838312.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-18
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2042-07-18
AI Technical Summary
Existing gastric cancer diagnosis methods are highly invasive and have low sensitivity and specificity. There is a lack of minimally invasive or non-invasive sensitive and specific early diagnosis methods, and there is a lack of effective treatment targets.
The hsa_circ_0012172 circular RNA was used as an exosome marker and amplified by designing specific primer pairs to prepare a diagnostic kit for gastric cancer. Functional experiments showed that it has the ability to inhibit the proliferation, migration and invasion of gastric cancer cells, and is being developed as a new target for gastric cancer treatment.
It achieves high sensitivity and specificity in non-invasive diagnosis of gastric cancer, provides a new approach to gastric cancer treatment, and significantly inhibits the proliferation, migration, and invasion of gastric cancer cells.
Smart Images

Figure CN116103393B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and molecular detection technology, and in particular to a circRNA for diagnosing and / or treating gastric cancer, and its application, detection primer pair, and diagnostic kit. Background Art
[0002] Gastric cancer is a common malignant tumor in the world, with the highest incidence and mortality rates. The early symptoms of gastric cancer are atypical and easily overlooked, leading to the development of advanced gastric cancer, which often results in poor treatment outcomes and poses a serious threat to human health and social development. At present, the gold standard for the diagnosis of gastric cancer is pathological biopsy, but this method is highly invasive and can easily cause varying degrees of harm to patients. In recent years, liquid biopsy has attracted much attention in the field of oncology. It is an information-rich minimally invasive tool that can continuously and in real time monitor the progression of tumor occurrence, metastasis, and recurrence. However, the sensitivity and specificity of the serological tumor biomarkers currently used in clinical practice are not high, and there are still certain limitations in their use for the diagnosis of gastric cancer. Therefore, there is an urgent need to explore the key molecules in the progression of gastric cancer, develop a minimally invasive or non-invasive, sensitive and specific early diagnosis method, and at the same time, effectively intervene in it as a new target for the treatment of gastric cancer, bringing good news to the majority of gastric cancer patients.
[0003] Circular RNA (circRNA) is an endogenous biomolecule in eukaryotes with a covalently closed circular structure. It is resistant to RNA exonucleases, making it resistant to degradation and stably expressed. CircRNAs can function as miRNA sponges, regulate protein binding, protein translation, and gene transcription, and are closely associated with the development and progression of tumors. CircRNAs are primarily found in the cytoplasm or exosomes. Studies have shown that abundant and stable circRNAs can be detected in human blood exosomes, demonstrating their potential as biomarkers and therapeutic targets for non-invasive liquid biopsies of tumors.
[0004] In recent years, with the continuous development of high-throughput sequencing, a large number of non-coding RNAs have come into the spotlight, and circRNAs are one of them. Although numerous studies have found that circRNAs play an important role in the development and progression of gastric cancer and may serve as candidate diagnostic, prognostic, or therapeutic targets, a large number of circRNAs remain unknown. Further research is needed to discover and understand more unknown circRNA molecules, explore their specific functions and significance in gastric cancer, and provide new ideas for the diagnosis and treatment of gastric cancer. Summary of the Invention
[0005] To address the above issues, the present invention provides a circRNA for the diagnosis and / or treatment of gastric cancer, its application, detection primer pairs, and diagnostic kit. The exosome marker provided by the present invention is a circRNA that is significantly underexpressed in plasma exosomes from gastric cancer patients and can be used as a diagnostic biomarker for gastric cancer, providing a new basis for diagnosis. Furthermore, the exosome marker can significantly inhibit the proliferation, migration, and invasion of gastric cancer cells, potentially leading to the development of new drugs and potential targets for gastric cancer treatment.
[0006] In order to achieve the above object, the present invention provides the following technical solutions:
[0007] The present invention provides an exosome marker for diagnosing and / or treating gastric cancer, wherein the exosome marker comprises hsa_circ_0012172 having a nucleotide sequence as shown in SEQ ID NO: 1.
[0008] The present invention also provides the use of the above-mentioned exosome markers in the preparation of a kit or reagent for diagnosing gastric cancer.
[0009] The present invention also provides the use of the above-mentioned exosome markers in the preparation of drugs for treating gastric cancer.
[0010] The present invention also provides a primer pair for detecting the above-mentioned exosome marker, characterized in that the primer pair comprises: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3.
[0011] The present invention also provides the use of the primer pair in preparing a kit or reagent for diagnosing gastric cancer.
[0012] The present invention also provides a kit for diagnosing gastric cancer, which comprises the above primer pair.
[0013] Preferably, the kit further comprises a primer pair for amplifying an internal reference gene β-actin.
[0014] Preferably, the primer pair for amplifying the internal reference gene β-actin comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 4 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 5.
[0015] Beneficial effects:
[0016] The present invention provides an exosome marker for gastric cancer diagnosis, comprising hsa_circ_0012172, the nucleotide sequence of which is shown in SEQ ID NO: 1. Based on circRNA chip sequencing of plasma-derived exosomes (exosomes), the present invention screened and found that hsa_circ_0012172 showed significant differences in plasma exosomes from gastric cancer patients and healthy subjects (the expression level of hsa_circ_0012172 in plasma exosomes from gastric cancer patients was lower than that in plasma exosomes from healthy subjects), suggesting that it may serve as a potential non-invasive biomarker for gastric cancer. Furthermore, through functional experiments, the present invention also found that hsa_circ_0012172 has a significant anti-cancer effect, and overexpression of hsa_circ_0012172 can significantly inhibit the proliferation, migration, and invasion of gastric cancer cells. This suggests that hsa_circ_0012172 may be a potential target for gastric cancer treatment, providing new insights into the treatment of gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 Schematic diagram of the structure of the target molecule hsa_circ_0012172 in the present invention;
[0018] Figure 2-1 This is a cluster diagram of the location of the target molecule hsa_circ_0012172 in plasma exosomes-circRNA chip sequencing in the present invention;
[0019] Figure 2-2 This is a volcano plot of the location of the target molecule hsa_circ_0012172 in plasma exosomes-circRNA chip sequencing in the present invention;
[0020] Figure 3-1 Amplification curves of the target molecule hsa_circ_0012172 (A) and the internal reference gene β-actin (B) in the present invention;
[0021] Figure 3-2 Melting curves of the target molecule hsa_circ_0012172 (C) and the internal reference gene β-actin (D) in the present invention;
[0022] Figure 4 This is an agarose gel electrophoresis image of the PCR product of the target molecule hsa_circ_0012172 in the present invention;
[0023] Figure 5 This is the sequencing identification map of the target molecule hsa_circ_0012172 in the present invention;
[0024] Figure 6This is the RNase R 15min result diagram of the target molecule hsa_circ_0012172 in the present invention;
[0025] Figure 7 Schematic diagram of the difference between the target molecule hsa_circ_0012172 in the plasma exosomes of gastric cancer patients (GC-ex) and the plasma exosomes of healthy people (Normal-ex);
[0026] Figure 8 : This is the ROC curve diagram of the specificity and sensitivity of hsa_circ_0012172 in plasma exosomes for gastric cancer diagnosis in the present invention;
[0027] Figure 9 The expression of the target molecule hsa_circ_0012172 in the gastric cancer cell line of the present invention is shown in Figure 2. *** indicates that different groups have significant differences compared with the GES-1 group.
[0028] Figure 10 Figure 2 shows the expression results of the hsa_circ_0012172 overexpression plasmid (OE-Circ12172) and the control plasmid (NC) in gastric cancer cells (SNU-1); *** indicates that the overexpression group has a significant difference compared with the NC group;
[0029] Figure 11 The results of the CCK8 assay in gastric cancer cells (SNU-1) 48 hours after transfection of the hsa_circ_0012172 overexpression plasmid (OE-Circ12172) and the control plasmid (NC) in the present invention; *** indicates a significant difference between the overexpression group and the NC group;
[0030] Figure 12 The results of the clone formation experiment of the hsa_circ_0012172 overexpression plasmid (OE-Circ12172) and the control plasmid (NC) in gastric cancer cells (SNU-1) after 48 hours of transfection;
[0031] Figure 13 The results of the Transwell migration assay were obtained after 48 h of transfection of the hsa_circ_0012172 overexpression plasmid (OE-Circ12172) and the control plasmid (NC) in gastric cancer cells (SNU-1).
[0032] Figure 14 These are the results of the Transwell invasion assay of gastric cancer cells (SNU-1) 48 h after transfection of the hsa_circ_0012172 overexpression plasmid (OE-Circ12172) and the control plasmid (NC) in the present invention. DETAILED DESCRIPTION
[0033] The present invention provides an exosome marker for diagnosing and / or treating gastric cancer, wherein the exosome marker comprises hsa_circ_0012172; the nucleotide sequence of hsa_circ_0012172 is shown in SEQ ID NO: 1:
[0034] 5'--3'.
[0035] The hsa_circ_0012172 described in the present invention is a circular RNA, which is formed by the cyclization of exons 1 to 6 of the RPS8 gene (exons 1 to 6 are arranged in sequence, and exon 1 and exon 6 are connected end to end to form a cyclization). The structural diagram is shown in Figure 1The hsa_circ_0012172 biomarker described in the present invention is a circRNA that is significantly low-expressed in the plasma exosomes of gastric cancer patients. It is expected to serve as a diagnostic biomarker for gastric cancer and provide a new basis for the diagnosis of gastric cancer.
[0036] The present invention also provides the use of the aforementioned exosome markers in the preparation of a kit or reagent for diagnosing gastric cancer. The hsa_circ_0012172 biomarker described in the present invention is a circRNA that exhibits significantly low expression in plasma exosomes from gastric cancer patients. Using the exosome markers provided by the present invention, primers for specific amplification are designed to produce a kit or reagent for the diagnosis of gastric cancer, enabling non-invasive diagnosis.
[0037] The present invention also provides the use of the aforementioned exosome markers in the preparation of drugs for treating gastric cancer. Functional experiments have revealed that hsa_circ_0012172 has a significant anti-cancer effect. Overexpression of hsa_circ_0012172 can significantly inhibit the proliferation, migration, and invasion of gastric cancer cells, making it a promising target for gastric cancer treatment and providing new insights into gastric cancer treatment. Drugs prepared using the aforementioned exosome markers, recombinant expression vectors capable of overexpressing the aforementioned exosome markers, or reagents capable of promoting overexpression of the aforementioned exosome markers can be used to treat gastric cancer.
[0038] The present invention preferably also provides a recombinant expression vector that can overexpress the above-mentioned exosome marker, wherein the base vector of the recombinant expression vector preferably includes pcDNA3.1(+), and the above-mentioned exosome marker is preferably located between the BamHI and EcoRI restriction sites of the base vector.
[0039] The present invention also provides a primer pair for detecting the above-mentioned exosome marker, the primer pair comprising: an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 2: GTTTTGTTCCCACACTCTTTCC and a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 3: CCCAACTCATACTTCCGCTT. In the present invention, the reaction system for amplifying the above-mentioned exosome marker is preferably 20 μL and includes qPCR SYBR Green Master Mix 10 μL, upstream primer 0.4 μL, downstream primer 0.4 μL, DNA template 2 μL, and balance ddH2O; the working concentration of the upstream primer and downstream primer are preferably 10 μM; the reaction procedure for amplifying the above-mentioned exosome markers preferably includes: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds, annealing at 54°C for 30 seconds, and 40 cycles.
[0040] The present invention also provides the use of the primer pair in preparing a kit or reagent for diagnosing gastric cancer.
[0041] The present invention also provides a kit for diagnosing gastric cancer, which comprises the above primer pair.
[0042] In the present invention, the kit preferably also includes a primer pair for amplifying the internal reference gene β-actin; the primer pair for amplifying the internal reference gene β-actin includes an upstream primer having the nucleotide sequence shown in SEQ ID NO: 4: CACGAAACTACCTTCAACTCC and a downstream primer having the nucleotide sequence shown in SEQ ID NO: 5: CATACTCCTGCTTGCTGATC. The present invention utilizes the above primer pair to specifically amplify exosome markers for gastric cancer diagnosis. Using the kit to detect gastric cancer plasma samples can achieve a faster and more accurate detection process.
[0043] To further illustrate the present invention, the following detailed description of a circRNA for the diagnosis and / or treatment of gastric cancer, its application, detection primer pairs, and diagnostic kit provided by the present invention is provided in conjunction with the Examples. However, these examples should not be construed as limiting the scope of protection of the present invention.
[0044] The kits used in the examples of this invention include the ExoQuick™ Exosome Precipitation Solution for extracting plasma exosomes and the miRNeasy Serum / Plasma Kit for extracting total RNA from exosomes. The reagents used in the detection kit include the HiScript IIIst Strand cDNA Synthesis Kit for reverse transcription and the AceQ qPCR SYBR GREEN MasterMix for quantitative PCR.
[0045] Example 1
[0046] Chip sequencing of circRNAs derived from plasma exosomes
[0047] 1.1 Collection of sequencing samples
[0048] After obtaining informed consent from the patients, blood samples were collected from six gastric cancer patients who met the inclusion criteria, as well as six healthy individuals matched for gender and age. Inclusion criteria for gastric cancer patients included: a confirmed diagnosis of gastric cancer on gastroscopy; a postoperative pathological diagnosis of gastric cancer by a pathologist; normal vital organ function, including normal liver and kidney function. Patients with gastric stump cancer or comorbidities with other tumors, those who had received preoperative treatment, those who had participated in other clinical trials, those with a confirmed diagnosis of neurological or psychiatric disease, and those with a history of hematologic or genetic diseases were excluded.
[0049] 1.2 Pretreatment of blood samples
[0050] (1) The collected blood sample was allowed to stand for 30 minutes and then centrifuged at 3000 rpm for 10 minutes at 4°C.
[0051] (2) After centrifugation, the supernatant was transferred to a 1.5 mL EP tube and centrifuged again at 3000 g for 15 min at 4°C.
[0052] (3) Aspirate the upper plasma layer and aliquot (260 μL per tube into an imported 1.5 mL EP tube), place at 4°C for use or store at -80°C for later use.
[0053] 1.3 Chip Sequencing
[0054] CircRNAs in exosomes were sequenced using a ceRNA chip. A total of 664 differential circRNA molecules (Foldchange ≥ 2, p < 0.05) were found, of which 23 were upregulated and 641 were downregulated. After primer design and verification, a molecule downregulated in gastric cancer, hsa_circ_0012172, was screened out. Figure 2-1 Cluster diagram and Figure 2-2 The volcano plots in the middle represent the positions of hsa_circ_0012172 in the sequencing results.
[0055] Example 2
[0056] Detection and identification of plasma exosomes hsa_circ_0012172
[0057] 2.1 Extraction of exosomes from plasma samples
[0058] (1) Take out the spare sample and thaw it on ice. Prepare a 1.5 mL EP tube and label it. After the sample is thawed, pipette 250 μL into the tube.
[0059] (2) Add 63 μL ExoQuick TMPrecipitation Solution: Mix thoroughly by pipetting gently and place at 4°C for 30 min to allow for complete precipitation.
[0060] (3) Centrifuge at 1500 g for 30 min at 4°C, discard the supernatant, and centrifuge again at 1500 g for 5 min at 4°C. Remove the remaining supernatant with a small imported pipette, add 200 μL of finished PBS to resuspend the precipitated exosomes, and gently pipette to mix to dissolve the exosomes.
[0061] (4) If downstream RNA experiments need to be performed immediately, add 200 μL of finished PBS and dissolve for half an hour, then use the miRNeasy serum / plasma kit to extract total RNA; if downstream RNA experiments are not performed immediately, aliquot and store at -80°C for later use;
[0062] 2.2 Extraction of total RNA from exosomes
[0063] (1) Add 5 times the volume of QIAzol Lysis Reagent to the exosomes (i.e., 200 μL exosomes plus 1 mL QIAzol), mix thoroughly by pipetting, and let stand at room temperature for 5 min. Add chloroform equal to the volume of exosomes (i.e., 200 μL chloroform), shake vigorously for 15 s, and let stand at room temperature for 2-3 min.
[0064] (2) Centrifuge at 12,000 g for 15 min at 4°C and transfer the upper aqueous phase to a new 1.5 mL EP tube (Note: Do not transfer the white intermediate layer).
[0065] (3) Add 1.5 times the volume of pre-cooled anhydrous ethanol and mix thoroughly by inverting;
[0066] (4) Place the spin column in a 2 mL collection tube, pipette 700 μL of the mixture from the previous step into the spin column, centrifuge at 12,000 g for 15 s at room temperature, and discard the filtrate.
[0067] (5) Recover the collection tube from the previous step, pipette the remaining mixed solution from step (3) into a centrifuge column, centrifuge at room temperature, 12000g for 15s, and discard the filtrate;
[0068] (6) Recover the collection tube from the previous step, add 700 μL of RWT buffer to the centrifuge column, centrifuge at 12,000 g for 15 s at room temperature, and discard the filtrate;
[0069] (7) Recover the collection tube from the previous step, add 500 μL of RPE buffer to the centrifuge column, centrifuge at 12,000 g for 15 s at room temperature, and discard the filtrate;
[0070] (8) Recover the collection tube from the previous step, add 500 μL of 80% ethanol to the centrifuge column, and centrifuge at 12,000 g for 2 min at room temperature;
[0071] (9) Discard the filtrate and collection tube, place the spin column in a new 2 mL collection tube provided with the kit, and centrifuge at 12,000 g for 5 min at room temperature to dry the membrane;
[0072] (10) Discard the collection tube and place the centrifuge column in a new 1.5 mL EP tube provided with the kit. Add 14 μL of RNase-free water to the middle of the membrane and let it stand at room temperature for 5 min to fully dissolve the RNA. Centrifuge at 12,000 g for 2 min at room temperature. Add the eluted RNA solution to the middle of the membrane again and centrifuge at 12,000 g for 2 min at room temperature to elute the total RNA.
[0073] 2.3 Reverse transcription of total RNA into cDNA
[0074] RNA is reverse transcribed into cDNA: the reverse transcription system is shown in Table 1, and the reverse transcription reaction procedure is shown in Table 2;
[0075] Table 1 Reverse transcription system
[0076] Reverse transcription system volume 10×RTMix 2μL Random hexamers (50 ng / μL) 1 μL HiScriptIIIEnzymeMix 2μL Total RNA ≤1 μg <![CDATA[RNasefreeddH2O]]> to20μL (make up to 20μL)
[0077] Table 2 Reverse transcription reaction procedure
[0078] Reverse transcription reaction procedure time 37℃ 15min 85℃ 5s 4℃ ∞
[0079] (3) The obtained cDNA product should be kept away from repeated freezing and thawing. qRT-PCR reaction can be performed immediately or stored at -20℃ for half a year. For long-term storage, it is recommended to store it at -80℃.
[0080] 2.4 Real-time fluorescence quantitative PCR reaction (qRT-PCR)
[0081] (1) The real-time fluorescence quantitative PCR reaction system is shown in Table 3, and the real-time fluorescence quantitative PCR reaction procedure is shown in Table 4. In the primer set for amplifying the target molecule hsa_circ_0012172 in qRT-PCR, the upstream primer sequence is: GTTTTGTTCCCACACTCTTTCC (SEQ ID NO: 2) and the downstream primer sequence is: CCCAACTCATACTTCCGCTT (SEQ ID NO: 3); in the primer set for amplifying the internal reference gene β-actin, the upstream primer sequence is: CACGAAACTACCTTCAACTCC (SEQ ID NO: 4) and the downstream primer sequence is: CATACTCCTGCTTGCTGATC (SEQ ID NO: 5).
[0082] Table 3 Real-time fluorescence quantitative PCR reaction system
[0083]
[0084] Applied 3. The reaction was carried out in a real-time fluorescence quantitative PCR system.
[0085] Table 4 Real-time fluorescence quantitative PCR reaction procedures
[0086]
[0087] (2) Result analysis
[0088] qRT-PCR test results are as follows Figure 3-1 and 3-2 As shown: The dissolution curves of hsa_circ_0012172 and β-actin showed a single peak ( Figure 3-1 A and B in the figure), the amplification curve is "S" shaped ( Figure 3-2 C and D in the figure). The qRT-PCR amplified products were subjected to agarose gel electrophoresis, and the product length was between 100 and 150 bp (e.g. Figure 4 ), which is consistent with the product of primer design of 126 bp.
[0089] 2.5 Identification of the Circular Formation of hsa_circ_0012172
[0090] 2.5.1 TA cloning and sequencing
[0091] The above qRT-PCR products were recovered and sent to Shanghai Bioengineering for the construction and sequencing of TA cloning plasmid vectors. Figure 5 As shown: The sequence at the circularization interface of hsa_circ_0012172 was detected in the product sequencing, indicating that the primer amplified circular RNA (hsa_circ_0012172).
[0092] 2.5.2 RNase R experiment
[0093] RNase R is a 3'-5' exoribonuclease that cleaves RNA into dinucleotides and trinucleotides. RNase R can digest almost all linear RNAs, but circRNAs are not easily digested. Therefore, RNase R treatment of total RNA, followed by reverse transcription and quantification, can be used to detect the relative expression changes of circRNAs before and after treatment to identify the circular structure of circRNAs. The specific experimental steps are as follows:
[0094] (1) RNase R stock solution was 20 U / μL and diluted 10-fold with RNase-free-ddH2O before use;
[0095] (2) In this experiment, two large groups were set for both hsa_circ_0012172 and linear RNARPS8: RNase R(+), i.e., group with added RNase R and Mock (no RNase R added) group. The setting time for each group was 15 min, with a total of 4 groups;
[0096] (3) The total mixed system of each group is 20 μL, as shown in Table 5;
[0097] Table 5 Amount of each component in the mixed system
[0098] Element volume RNA 2μg (volume converted based on concentration) RNaseR 6U (3μL) Buffer 2μL <![CDATA[Rnasefree-ddH2O]]> Up to 20 μL
[0099] Note: In the mock group, RNase R was replaced with RNase-free-ddH2O.
[0100] (4) Each group placed the mixed system in a 37°C metal bath for constant temperature treatment according to the treatment time;
[0101] (5) After the constant temperature treatment, 2 μL of 3 M sodium acetate and 50 μL of pre-cooled anhydrous ethanol were added to each group, mixed well, and placed at -20°C for 30 min;
[0102] (6) Centrifuge at 12000 rpm for 15 min at 4°C, discard the supernatant, and add 1 mL of 75% ethanol to resuspend the pellet;
[0103] (7) Centrifuge at 12000 g for 2 min at 4°C, discard the supernatant, and dissolve the precipitate in 7 μL of DEPC water after it becomes transparent. Immediately perform reverse transcription and quantitative detection of hsa_circ_0012172 and linear RNA RPS8;
[0104] (8) Result analysis
[0105] The results are as follows Figure 6 As shown in the figure: the expression of linear RNA RPS8 decreased significantly after RNase R digestion, while the expression of hsa_circ_0012172 did not decrease after RNase R digestion. It can be seen that hsa_circ_0012172 can tolerate RNase R digestion and has a more stable structure.
[0106] Example 3
[0107] Evaluation of the value of hsa_circ_0012172 as a gastric cancer biomarker
[0108] 3.1 Collection of clinical samples
[0109] From May 2021 to April 2022, plasma samples were collected from 53 patients diagnosed with gastric cancer at the Department of Gastrointestinal Surgery, First People's Hospital Affiliated to Jiangsu University. Plasma samples were also collected from 53 healthy individuals matched in age and gender to the gastric cancer patients. Both sets of samples were collected simultaneously and stored at -80°C until ready for use.
[0110] 3.2 Clinical Sample Testing and Data Analysis
[0111] The present invention uses the method of Example 2 to extract and detect hsa_circ_0012172 in the exosomes of the above clinical plasma samples. The experimental data adopts the relative quantitative analysis method, with β-actin as the internal reference gene and ΔCT=CT hsa_circ_0012172 -CT β-actin The results represent the detection values of each sample. The differences of hsa_circ_0012172 between the gastric cancer group and the corresponding healthy control group were compared. The data were analyzed and plotted using Graphpad Prism8.
[0112] 3.3 Results Analysis
[0113] The results are as follows Figure 7 As shown in Figure 2, the expression level of hsa_circ_0012172 in plasma exosomes of gastric cancer patients was significantly lower than that of matched healthy controls, which is consistent with the chip sequencing results in Example 1. The present invention also performed ROC curve analysis on the above results, and the results are as follows: Figure 8 As shown in the results, hsa_circ_0012172 in plasma exosomes has good specificity and sensitivity for the diagnosis of gastric cancer.
[0114] Example 4
[0115] Expression of hsa_circ_0012172 in gastric cancer cell lines
[0116] 4.1 Cell culture
[0117] (1) Cell recovery
[0118] The cells were taken out from the -80°C freezer, quickly thawed in warm water at 37°C, centrifuged at 600 rpm for 5 min at room temperature, inoculated into culture flasks, labeled, and cultured in an incubator at 37°C and 5% CO2.
[0119] (2) Cell culture medium replacement
[0120] Wash the cell surface twice with PBS buffer and add 4 mL of the corresponding culture medium. MKN-28 and SNU-1 cells were cultured in RPMI1640 medium containing 10% FBS; AGS cells were cultured in DMEM / F12 medium containing 10% FBS; HGC-27 and GES-1 cells were cultured in high-glucose DMED medium containing 10% FBS.
[0121] (3) Cell passage
[0122] Digested with trypsin, centrifuged at 800 rpm for 5 min at room temperature, and 3 × 10 5 The density of the cells was re-inoculated into culture flasks.
[0123] (4) Cell cryopreservation
[0124] After the cells were digested and centrifuged, they were stored in 1 mL of freezing solution (100 μL of DMSO + 900 μL of fetal bovine serum) at 4°C for 30 min, -20°C for 2 h, and -80°C overnight.
[0125] 4.2 Detection and analysis of hsa_circ_0012172 in gastric cancer cell lines
[0126] (1) Extraction of total RNA from gastric cancer cells
[0127] Cells were trypsinized and centrifuged at 800 rpm for 5 minutes at room temperature. The supernatant was discarded and the pellet was washed twice with PBS buffer to remove residual media. The PBS was discarded and 1 mL of Trizol was added and mixed thoroughly. The pellet was allowed to stand on ice for 15 minutes. 200 μL of chloroform was added and the pellet was shaken vigorously for 30 seconds before being allowed to stand on ice for 10 minutes. The pellet was centrifuged at 12,000 g for 15 minutes at 4°C (the aqueous phase, protein layer, and organic phase were visible). The aqueous phase was aspirated into another clean imported EP tube and isopropanol was added in a 1:1 ratio. Gently inverted to mix thoroughly and the pellet was allowed to stand at room temperature for 10 minutes. The pellet was centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was discarded and 1 mL of 75% ethanol was added to wash the pellet by pipetting. The pellet was centrifuged at 7,800 g for 5 minutes at 4°C. The supernatant was discarded and air-dried in a clean hood. When the pellet became translucent, 20–30 μL of DEPC water was added depending on the size of the pellet to obtain total RNA and stored at −80°C.
[0128] (2) Detection and analysis of hsa_circ_0012172
[0129] The total RNA was reverse transcribed and qRT-PCR was performed according to the method in Example 2, with β-actin as the internal reference gene, using 2 -ΔΔCt The relative expression levels were calculated and plotted using Graphpad Prism8. Figure 9As shown in the results, hsa_circ_0012172 was downregulated by 63%, 58%, 52%, and 46% in gastric cancer cells MKN-28, AGS, SNU-1, and HGC-27, respectively, compared with gastric mucosal epithelial cells GES-1.
[0130] Example 5
[0131] Effects of hsa_circ_0012172 on gastric cancer cell lines
[0132] 5.1 Cell transfection
[0133] The hsa_circ_0012172 overexpression plasmid was prepared by Suzhou Jima Company for subsequent cell functional experiments. The cloning vector used for the overexpression plasmid was pcDNA3.1(+), and the cloning sites were BamHI and EcoRI.
[0134] SNU-1 cells in the logarithmic growth phase were digested with trypsin and 2×10 5 The cells were seeded at a density of 100 cells / well in a 6-well plate to allow them to adhere to the wall. When the cell density reaches 50%, prepare for transfection. Discard the culture medium in the 6-well plate, wash twice with PBS, and add 1.5 mL of serum-free culture medium to each well. During transfection, 5 μL of transfection reagent lipo2000 and 1.5 μg of overexpression plasmid and control plasmid (pcDNA3.1(+) vector without the hsa_circ_0012172 sequence inserted) were added to 250 μL of Opti-MEM, respectively. After standing for 5 minutes, the two were mixed and then allowed to stand for 20 minutes. 500 μL of the above-mentioned mixed system was added to each group, and the cells were cultured at 37°C and 5% CO2. After 6 hours, 2 mL of complete culture medium was replaced. RNA was extracted 48 hours after transfection to detect the transfection efficiency. The results are shown in the table. Figure 10 .
[0135] 5.2 CCK8 Experiment
[0136] 48 hours after SNU-1 transfection, the cells were digested with trypsin, resuspended in complete culture medium and counted, and 800 cells / well were inoculated into a 96-well cell culture plate with a volume of 100 μL per well (an appropriate amount of PBS was added around the 96-well cell culture plate to avoid excessive evaporation of the culture medium). Each group had 4 replicate wells per day, for a total of 5 days. The test was performed regularly every day. When testing, CCK8 mixed solution (90 μL culture medium + 10 μL CCK8 reagent) was prepared in the dark, the original culture medium was discarded, and 100 μL / well of the above CCK8 mixed solution was added. The cells were cultured at 37°C and 5% CO2 for 2 hours. The absorbance was detected at 450 nm using a microplate reader and the OD value was recorded. The results are shown in the table. Figure 11 and Table 6.
[0137] 5.3 Clone formation assay
[0138] 48 hours after SNU-1 transfection, trypsinize the cells, resuspend them in complete culture medium, and count them. 1000 cells / well are plated in a 1.5 mL dish, with three replicates per group. Culture for 10 days, changing the medium every three days. Observe cell proliferation during this period and stop culturing when cells have grown into single cell clusters visible to the naked eye. Discard the culture medium, wash twice with PBS, fix with 4% paraformaldehyde for at least 30 minutes, stain with crystal violet for 10 minutes, wash off excess dye, and photograph under a microscope (see [see ] for details). Figure 12 ).
[0139] 5.4 Transwell migration assay
[0140] This experiment was performed using a 24-well migration chamber containing an 8 μm membrane. 48 h after SNU-1 transfection, the cells were trypsinized, resuspended in serum-free culture medium, and counted. The density was 5 × 10 4 200 μL of cells were inoculated on the upper side of the chamber, and 600 μL of complete culture medium containing serum was added to the lower side of the chamber. The cells were cultured at 37°C in a 5% CO2 environment for 14 hours. The chamber was then removed and the residual culture medium was gently washed with PBS. The cells were fixed in 4% paraformaldehyde for at least 30 minutes, washed twice with PBS, and stained with crystal violet for 10 minutes. Finally, the cells on the inner membrane of the chamber were carefully wiped off with a cotton swab. After drying, the cells were photographed using an inverted microscope. At least 3 fields of view were recorded for each group (see Figure 13 ).
[0141] 5.5 Transwell invasion assay
[0142] Before conducting this experiment, the Matrigel was diluted with serum-free culture medium at a ratio of 1:4 and evenly spread on the inner membrane of the chamber. Place in a 37°C incubator for at least 30 minutes to allow the Matrigel to solidify before subsequent experiments. 48 hours after SNU-1 transfection, the cells were trypsinized, resuspended in serum-free culture medium, and counted. A density of 9×10 4 200 μL of cells were seeded on the upper side of the chamber covered with Matrigel, and 600 μL of complete culture medium containing serum was added to the lower side of the chamber. The cells were cultured at 37°C in a 5% CO2 environment for 17 h. The subsequent fixation, staining, and recording procedures were the same as those for the migration experiment (see Figure 14 ).
[0143] 5.6 Results Analysis
[0144] The results are as follows Figures 10-14 As shown in Table 6: After SNU-1 was transfected with the hsa_circ_0012172 overexpression plasmid, the expression level of hsa_circ_0012172 increased by 7 times compared with the control group ( Figure 10 ); CCK8 experiment ( Figure 11 and Table 6) and clonal proliferation experiments ( Figure 12 ) showed that overexpression of hsa_circ_0012172 significantly inhibited the proliferation of SNU-1; migration assay ( Figure 13 ) and invasion assays ( Figure 14 ) showed that the migration and invasion abilities of SNU-1 were significantly decreased after overexpression of hsa_circ_0012172.
[0145] Table 6 Absorbance of different groups at 450nm
[0146] Group NC OE-Circ12172 Day 1 0.2525 0.2110 Day 2 0.5005 0.3248 Day 3 0.9635 0.5193 Day 4 1.7308 0.9318 Day 5 2.4568 1.5965
[0147] In summary, the present invention screened and identified the hsa_circ_0012172 molecule from chip sequencing results. Its expression was significantly reduced in plasma exosomes from gastric cancer patients, suggesting its potential as a novel biomarker for gastric cancer diagnosis. Furthermore, CCK8 assays, colony formation assays, and migration and invasion assays revealed that hsa_circ_0012172 significantly inhibited the proliferation, migration, and invasion of gastric cancer cells, suggesting its potential as a therapeutic target for gastric cancer.
[0148] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. Use of a reagent for detecting an exosome marker in the preparation of a kit for diagnosing gastric cancer, wherein the exosome marker is hsa_circ_0012172 having a nucleotide sequence as shown in SEQ ID NO:
1.
2. Use of an exosome marker in the preparation of a drug for treating gastric cancer, wherein the exosome marker is hsa_circ_0012172 with a nucleotide sequence as shown in SEQ ID NO:
1.
3. Use of a primer pair in preparing a kit or reagent for diagnosing gastric cancer; the primer pair consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3.