Antibacterial and anti-inflammatory dual-activity polypeptide and application thereof
By synthesizing the antibacterial and anti-inflammatory dual-active polypeptide LL37-C15, the problem of antibacterial and anti-inflammatory effects in the treatment of periodontitis has been solved, achieving effective dual efficacy without easily inducing drug resistance, and is suitable for the treatment and prevention of periodontitis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-23
- Publication Date
- 2026-03-03
AI Technical Summary
Existing periodontitis treatments are difficult to effectively combine antibacterial and anti-inflammatory effects, and commonly used antibiotics are prone to drug resistance and cannot effectively repair the damage caused by inflammation.
A dual-activity antibacterial and anti-inflammatory polypeptide LL37-C15 was synthesized via solid-phase synthesis. Combined with the amino acid sequence of the anti-inflammatory peptide Chemerin, it possesses both antibacterial and anti-inflammatory functions and can be used for the treatment of periodontitis.
This peptide can inhibit the growth of Gram-negative bacteria, reduce the inflammatory phenotype of macrophages, increase the release of anti-inflammatory cytokines, relieve periodontitis symptoms, and is less likely to induce drug resistance.
Smart Images

Figure CN116120422B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to an antibacterial and anti-inflammatory dual-activity polypeptide and its applications. Background Technology
[0002] Severe periodontitis is the sixth most prevalent disease in humans, one of the most common clinical oral diseases, and the leading cause of tooth loss, affecting 10-15% of the global population. Furthermore, periodontal inflammation is closely related to systemic diseases such as diabetes, heart disease, Alzheimer's disease, and osteoporosis. After mechanical treatment, many patients with periodontitis experience poor oral hygiene and fail to attend follow-up appointments, leading to poor prognosis and a high relapse rate. Drug therapy, as an important adjunct to mechanical treatment of periodontitis, has drawbacks, including the inability to organically combine antibacterial and anti-inflammatory effects with single-drug therapy, and the potential for antibiotic resistance. Therefore, the current research need is to find a drug that organically combines antibacterial and anti-inflammatory effects without easily inducing drug resistance for the treatment of periodontitis.
[0003] Antimicrobial peptides are a natural defense mechanism of the host against exogenous pathogenic microorganisms. Their basic mechanism of action is to disrupt the bacterial plasma membrane structure, causing a large outflow of cell contents, ultimately leading to the death of the pathogenic microorganism; therefore, there is no significant drug resistance. Furthermore, antimicrobial peptides have advantages such as being colorless, odorless, non-irritating, and stain-free, and possess broad-spectrum antimicrobial properties. In recent years, they have become a hot topic in clinical medicine, molecular immunology, and molecular biology research. LL-37 is derived from hCAP-18, which is currently the only known antimicrobial peptide derived from human tissue protein. LL-37 is an active small molecule polypeptide maintained at the C-terminus of hCAP-18. LL-37 is sensitive to periodontal pathogens such as *Porphyromonas gingivalis*, *Actinomyces*, *Prevotella intermedius*, and *Fusobacterium nucleatum*. LL-37 disrupts the bacterial cell membrane by forming ion channels. In addition, LL-37 can rapidly bind to the endotoxin LPS on the bacterial membrane, thereby neutralizing the bacteria. Despite its remarkable antibacterial properties, LL-37 suffers from cytotoxicity and an inability to effectively repair inflammation-induced damage. C15, an anti-inflammatory peptide derived from chemerin, offers these advantages. Chemerin is a chemokine present in a range of human inflammatory secretions. It exhibits good biocompatibility. ChemR23, a G protein-coupled receptor, effectively recognizes and binds to chemerin and is primarily expressed by monocytes, macrophages, and plasma dendritic cells. It inhibits the recruitment of neutrophils and monocytes, suppresses the release of pro-inflammatory cytokines, and promotes the release of anti-inflammatory cytokines. Chemokines can be cleaved through proteolysis to produce potent anti-inflammatory products, exhibiting strong anti-inflammatory effects even at low molar concentrations. Previous studies have shown that chemerin, in addition to effectively inhibiting pro-inflammatory cytokines such as TNF-α, also limits the accumulation of inflammatory cells at wound sites, directly inducing early wound healing. Chemerin can also reverse the inflammatory phenotype of macrophages, and the reversed M2 macrophage phenotype is often associated with improved wound healing.
[0004] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention
[0005] The purpose of this invention is to solve the problem of how to prepare a drug with organic combination of antibacterial and anti-inflammatory effects that is not prone to drug resistance for the treatment of periodontitis, and to provide an antibacterial and anti-inflammatory dual-active polypeptide and its application.
[0006] To achieve the above objectives, the present invention discloses an antibacterial and anti-inflammatory dual-activity polypeptide, the amino acid sequence of which is shown in SEQ ID NO.1.
[0007] The antibacterial and anti-inflammatory dual-active polypeptide was synthesized by solid-phase synthesis. 2Cl resin was selected as the starting carrier, and Fmoc-protected amino acids were used as condensation raw materials. The corresponding amino acids in the amino acid sequence of the dual-active polypeptide were condensed sequentially. The polypeptide was then subjected to a cleavage and precipitation reaction, purified, and freeze-dried.
[0008] The peptide has anti-inflammatory effects, can regulate macrophage differentiation, reverse and reduce the inflammatory phenotype of macrophages, reduce the release of pro-inflammatory cytokines, and increase the release of anti-inflammatory cytokines, thereby alleviating the inflammatory state of periodontal supporting tissues and can be used for the treatment of related inflammatory diseases.
[0009] The polypeptide has antibacterial activity, particularly against Gram-negative bacteria. For example, it can act on the dominant periodontal bacteria, such as Porphyromonas gingivalis or Aggregates actinomycetes, but is not limited to these bacteria. It can also be used to treat infectious diseases caused by related bacteria.
[0010] The present invention also discloses the application of the above-mentioned antibacterial and anti-inflammatory dual-active polypeptide in the treatment of Gram-negative bacteria, wherein the Gram-negative bacteria are Porphyromonas gingivalis or Aggregates actinomycetes.
[0011] The present invention also discloses the application of an antibacterial and anti-inflammatory dual-active polypeptide in the prevention and / or treatment of periodontitis. The antibacterial and anti-inflammatory dual-active polypeptide alleviates the inflammatory state of periodontal supporting tissues by reversing and reducing the inflammatory phenotype of macrophages, reducing the release of pro-inflammatory cytokines, and increasing the release of anti-inflammatory cytokines.
[0012] The present invention also discloses a topical periodontal adjuvant therapy drug, comprising the above-mentioned antibacterial and anti-inflammatory dual-active polypeptide, wherein the drug comprises one or more pharmaceutically acceptable excipients, wherein the excipients are stabilizers, diluents, thickeners, gelling agents or excipients.
[0013] This invention also discloses the application of the above-mentioned antibacterial and anti-inflammatory dual-active polypeptide in the treatment of infectious and inflammatory diseases caused by sensitive bacteria. The polypeptide can be effectively loaded into drug carrier molecules and made into liquids or ointments for local application at the lesion site.
[0014] This invention also discloses the application of the above-mentioned antibacterial and anti-inflammatory dual-active polypeptide in the surface modification of dental implants and related catheters. The polypeptide, as a biomolecule, serves as a surface coating for implantable devices, endowing the devices with antibacterial and anti-inflammatory functions.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0016] 1. This antibacterial and anti-inflammatory dual-active polypeptide can inhibit the growth and adhesion of Gram-negative bacteria to a plane, and disrupt the biofilm formed by bacteria;
[0017] 2. This dual-activity antibacterial and anti-inflammatory polypeptide can reduce and reverse the inflammatory phenotype of macrophages, thereby reducing the release of pro-inflammatory cytokines and increasing the release of anti-inflammatory cytokines. It can be used as a topical medication for periodontitis. Attached Figure Description
[0018] Figure 1 The reversed-phase high-performance liquid chromatogram (HPLC) of the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 1;
[0019] Figure 2 The mass spectrum (MS) of the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 1 is shown.
[0020] Figure 3 A statistical graph showing the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 2 against the growth of Porphyromonas gingivalis;
[0021] Figure 4 The image shows the results of the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 2 inhibiting the colony proliferation of Porphyromonas gingivalis on blood agar plates.
[0022] Figure 5 The CCK-8 results for the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 3 after 1 day;
[0023] Figure 6 The 3-day CCK-8 results for the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 3;
[0024] Figure 7 The 5-day CCK-8 results for the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 3;
[0025] Figure 8 CCK-8 results of the antibacterial and anti-inflammatory dual-activity peptide LL37-C15 constructed in Example 3 over 7 days
[0026] Figure 9 The effect of the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 4 on the expression level of pro-inflammatory cytokine mRNA in mouse macrophages RAW264.7;
[0027] Figure 10 The effect of the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 4 on the expression level of anti-inflammatory cytokine mRNA in mouse macrophages RAW264.7;
[0028] Figure 11The effect of the antibacterial and anti-inflammatory dual-activity polypeptide LL37-C15 constructed in Example 5 on the expression level of the anti-inflammatory cytokine IL-10 protein in mouse macrophages RAW264.7. Detailed Implementation
[0029] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.
[0030] Example 1
[0031] The antibacterial and anti-inflammatory dual-activity peptide LL37-C15 was synthesized from the C-terminus to the N-terminus using a solid-phase synthesis method.
[0032] (1) Weigh 3g of Wang resin (degree of substitution 0.3mmol / g) into a 150ml reactor and soak it in 50mL of dichloromethane (DCM).
[0033] (2) After 2 hours, wash the resin with 3 times the volume of nitrogen-dimethylformamide (DMF), then dry it. Repeat this process four times until the resin is completely dry and ready for use.
[0034] (3) Weigh an appropriate amount of the first C-terminal amino acid, serine (Ser), and an appropriate amount of 1-hydroxy-benzotriazole (HOBT) into a 50 mL centrifuge tube, add 20 mL of DMF to dissolve them, then add 3 mL of N,N-diisopropylcarbodiimide (DIC) and shake for 1 min. After the solution is clear, add it to the reactor, then add 3 times the molar amount of DMAP to the reactor, and then place the reactor in a shaker at 30 °C to react.
[0035] (4) After 4 hours, use a certain amount of acetic anhydride to seal the head (acetic anhydride: DIEA: DCM = 1:1:2) for half an hour, then wash four times with 3 times the volume of DMF, and dry it for later use.
[0036] (5) Add a certain amount of 20% piperidine (piperidine / DMF = 1:4) to the reactor and shake it on a decolorizing shaker for 20 minutes to remove the Fmoc protecting groups on the resin. After deprotection, wash with DMF four times and then dry.
[0037] (6) Take a small amount of resin and test it using the ninhydrin (Ninhydrin hydrate) method (two drops of test A and two drops of test B, react at 100℃ for 1 min). If the resin is colored, it indicates that the deprotection was successful.
[0038] (7) Weigh an appropriate amount of the second amino acid glutamic acid (Glu) and an appropriate amount of HOBT into a 50 mL centrifuge tube, add 25 mL of DMF to dissolve them, then add 2.5 mL of DIC and shake for 1 min. After the solution is clear, add it to the reactor and then place the reactor in a shaker at 30 °C to react.
[0039] (8) After 1 hour, take a small amount of resin for testing. Use the ninhydrin method to test (two drops of test A and two drops of test B, react at 100℃ for 1 min). If the resin is colorless, it means the reaction is complete; if the resin is colored, it means the condensation is incomplete, and continue the reaction.
[0040] (9) After the reaction is complete, wash the resin four times with DMF, then dry it under vacuum. Add a certain amount of 20% piperidine (piperidine / DMF = 1:4) to the reactor and shake it on a decolorizing shaker for 20 minutes to remove the Fmoc protecting group on the resin. After deprotection, wash the resin four times with DMF, then dry it under vacuum to check whether the protection has been removed.
[0041] (10) Follow steps (7) to (9) to attach the amino acid sequence shown in SEQ ID NO:1 in sequence.
[0042] (11) After removing the Fmoc from Ala, the peptide was washed four times with DMF, and then the resin was dried with methanol. The peptide was then cleaved from the resin using a 95% cleavage buffer (trifluoroacetic acid: 1,2-ethylenedithiol: 3-isopropylsilane: water = 95:2:2:1) (10 ml of cleavage buffer per gram of resin), and precipitated four times by centrifugation with ice-cold ether (cleavage buffer: ether = 1:9). Finally, the peptide was purified by HPLC and then lyophilized to obtain a peptide of a certain purity.
[0043] Reversed-phase high-performance liquid chromatography (RP-HPLC) was used. Figure 1 Sequence purity and authenticity were determined using a mass spectrometer. Figure 2 Molecular weight was determined. The peptides were lyophilized and stored at -80°C. Figure 1 HPLC showed sequence purity >95%. Figure 2 MS analysis showed that the molecular weight of LL37-C15 was 6195.07.
[0044] Example 2
[0045] Take 2 mg of lyophilized peptide powder and add 3.23 mL of phosphate-balanced saline (PBS) to prepare a 100 μM solution.
[0046] A PBS solution containing 0.12% chlorhexidine and 25 μM minocycline was used as the positive control group, and a PBS medium containing 50% brain heart infusion (BHI) broth was used as the negative control group.
[0047] LL37-C15 and LL-37 (PBS diluted to a final concentration of 10 / 20 μM) were transferred to 96-well cell culture plates (200 μL / well). 10 μL of *Porphyromonas gingivalis* P. g. culture, which had been cultured as single colonies for 48 h, was diluted with BHI broth. -3 The volume ratio of peptides to BHI broth culture medium was 1:1. After co-culturing for 1 / 2 / 3 / 4 / 7 days, the absorbance at 600 nm was measured using a microplate reader to reflect the inhibition of bacteria.
[0048] Figure 3 The results showed that the dual-active peptide LL37-C15 inhibited the proliferation of *Porphyromonas gingivalis*, a major pathogen of periodontitis. As shown in the figure, in the blue control group without drug intervention, bacteria grew normally. The black and brown groups, treated with 10 / 20 μM dual-active peptide LL37-C15, effectively inhibited the growth of *Porphyromonas gingivalis* in both short-term and long-term co-culture. Furthermore, the long-term antibacterial results showed that the dual-active peptide LL37-C15 improved the drawback of the inherent weakening of the long-term antibacterial effect of the antimicrobial peptide LL-37 itself.
[0049] Sterile filter paper (6 mm in diameter) was placed on Columbia blood agar plates coated with Pg bacterial suspension. 20 μL of 20 μL of 20 μL of L-37, C15, L-37-C15, 0.12% chlorhexidine solution, and 25 μM minocycline hydrochloride were added to each filter paper. The plates were incubated anaerobicly at 37°C for 48 h. The inhibitory effect of the peptide on the growth of *Porphyromonas gingivalis* colonies was qualitatively analyzed by measuring the area without bacterial growth using a ruler.
[0050] Figure 4 The figure shows the inhibition of *Porphyromonas gingivalis* colonies by the dual-active polypeptide LL37-C15 on blood agar plates. As can be seen from the figure, C15(iv) has no antibacterial properties. Compared to LL-37(v), LL37-C15(iii) inhibits colonies over a larger area, indicating that it enhances the antibacterial properties of LL-37.
[0051] Example 3
[0052] The biocompatibility of the constructed peptides in mouse embryonic osteoblasts (MC-3T3) was evaluated using a CCK-8 assay kit. After passage, mouse embryonic osteoblasts were seeded at 8000 cells per well in 96-well plates. After 24 hours of cell attachment, the drug was added and the cells were divided into groups: cell group; 0.12% chlorhexidine; 25 μM minocycline hydrochloride; and LL-37, C15, and LL37-C15 at final concentrations of 5 μM / 10 μM / 20 μM / 40 μM, with three auxiliary wells per well. Cells were cultured for 1, 3, 5, and 7 days, respectively. The medium was replaced in the 5-day and 7-day wells on day 3. The CCK-8 assay kit and serum-free α-MEM were mixed at a 1:9 ratio, the medium in the wells was discarded, and 100 μL of the mixed CCK-8 reagent was added to each well. The cells were incubated in the dark for 3 hours. The biocompatibility of the peptide drug was assessed by measuring the absorbance at 450 nm using a microplate reader.
[0053] Figures 5-8 The CCK-8 results showed that 20 μM L-37 was effective at 1 day ( Figure 5 The absorbance at 3 days was significantly lower than that of the control group, but the absorbance of 20 μL LL37-C15 was significantly improved compared to LL-37. Figure 6 The absorbance value of 20 μL LL37-C15 was significantly improved compared to LL-37, indicating improved biocompatibility. (5 days) Figure 7 ) and 7 days ( Figure 8 The long-term results were consistent with those at 1 day and 3 days. Overall, 10 / 20μMLL37-C15 showed better biocompatibility than 10 / 20μMLL-37 at 1, 3, 5 and 7 days.
[0054] Example 4
[0055] Five groups were set up: blank cell group; LPS group; LPS+LL-37 group; LPS+C15 group; LPS+LL37-C15 group.
[0056] RAW264.7 macrophages were 1×10 6 Cells were seeded in 6-well plates (M0). After 24 h, cells were exposed to peptide solutions (LL-37, C15, LL37-C15) at a final concentration of 10 μM for 6 h. Cells were then stimulated with 1 μg / mL lipopolysaccharide (Pg-LPS) of Porphyromonas gingivalis for 24 h (M1).
[0057] Discard the supernatant and wash the 6-well plate once with PBS. Extract total RNA using a rapid RNA extraction kit. The RT kit uses gDNAEraser to reverse transcribe RNA into cDNA. Then, it uses... PremixExTaq TMII. Real-time PCR was performed. Analysis was conducted using the LightCycler96 Real-Time PCR system. The primers used in this study are as follows:
[0058] β-actin CATCCGTAAAGACCTCTAGCCAAC ATGGAGCCACCGATCCACA IL-6 CCACTTCACAAGTCGGAGGCTTA CCAGTTTGGTAGCATCCATCATTTC IL-10 ATGCTGCCTGCTCTTACTGACTG CCCAAGTAACCCTTAAAGTCCTGC
[0059] Figure 9 The effect of 10 μM dual-activity peptide LL37-C15 on the release level of the pro-inflammatory cytokine IL-6 from macrophages was shown. As can be seen from the figure, the addition of Pg-LPS significantly increased IL-6 release in the LPS group. Among the three peptides added, the dual-activity peptide LL37-C15 showed the strongest inhibitory effect on the release of the pro-inflammatory cytokine IL-6.
[0060] Figure 10 The results show the effect of 10 μM dual-activity peptide LL37-C15 on the release level of the anti-inflammatory cytokine IL-10 in macrophages. Due to the excellent properties of C15 in inflammation repair, the dual-activity peptide LL37-C15 significantly improved the drawbacks of the antimicrobial peptide LL-37 in inflammation repair.
[0061] Example 5
[0062] Five groups were set up: blank cell group; LPS group; LPS+LL-37 group; LPS+C15 group; LPS+LL37-C15 group.
[0063] RAW264.7 macrophages were 1×10 6 Cells were seeded in 6-well plates (M0). After 24 h, cells were exposed to peptide solutions (LL-37, C15, LL37-C15) at a final concentration of 10 μM for 6 h. Cells were then stimulated with 1 μg / mL lipopolysaccharide (Pg-LPS) of Porphyromonas gingivalis for 24 h (M1).
[0064] Collect macrophage supernatant at 24 h and transfer it to a 1.5 mL EP tube. Centrifuge the sample at 300-400 x g for 5 min at room temperature, and collect the supernatant again. Add 100 μL / well of the supernatant to the ELISA plate and incubate at 37 °C for 40 min. Then wash the plate 5 times with Wash Buffer from the ELISA kit, firmly tapping it dry on filter paper after each wash. Add 50 μL of antibody to each well and incubate at 37 °C for 20 min. Wash 5 times with Wash Buffer, firmly tapping it dry on filter paper after each wash. After tapping, add 100 μL of enzyme conjugate to each well and incubate at 37 °C for 10 min. Then add 100 μL of chromogenic solution and incubate in the dark at 37°C for 15 min. After thoroughly rinsing with Wash Buffer and drying by inverting the container, add 100 μL of chromogenic stop solution. Measure the absorbance at 450 nm and a reference wavelength of 620 nm using a microplate reader within 30 min. Establish a standard curve based on the concentration and absorbance of the IL-10 standard. Then quantify the expression level of IL-10 protein in the cell supernatant and express the concentration as pg / mL.
[0065] Figure 11 This is the quantitative analysis result of IL-10 protein content in cell supernatant. As shown in the figure, the dual-activity peptide LL37-C15 significantly increased IL-10 secretion, exhibiting the best effect in promoting IL-10 release among the three peptides tested. IL-10 is a potent anti-inflammatory cytokine. Recent studies have shown that IL-10 can maintain bone mass by inhibiting osteoclast bone resorption and regulating osteoblast bone formation. Notably, IL-10 inhibits the synthesis of pro-inflammatory cytokines (IL-1, IL-6, and TNF-α) by Th1 cells. IL-10 acts on osteoclast precursor cells produced in the bone marrow, inhibiting the first stage of osteoclastogenesis and blocking the differentiation of mature osteoclasts. This is crucial for the blocking and treatment of the development and progression of periodontitis.
[0066] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.
Claims
1. A dual-activity polypeptide with antibacterial and anti-inflammatory properties, characterized in that, The amino acid sequence of the antibacterial and anti-inflammatory dual-active polypeptide is shown in SEQ ID NO.
1.
2. The antibacterial and anti-inflammatory dual-active polypeptide as described in claim 1, wherein the antibacterial and anti-inflammatory dual-active polypeptide is synthesized by solid-phase synthesis.
3. The use of the antibacterial and anti-inflammatory dual-activity polypeptide as described in claim 1 in the preparation of a drug against Gram-negative bacteria, characterized in that, The Gram-negative bacteria are Porphyromonas gingivalis or Aggregates actinomycetes.
4. The use of the antibacterial and anti-inflammatory dual-active polypeptide as described in claim 1 in the preparation of a medicament for treating periodontitis.
5. The application of the antibacterial and anti-inflammatory dual-active polypeptide as described in claim 4 in the preparation of a medicament for treating periodontitis, characterized in that... The antibacterial and anti-inflammatory dual-active peptides alleviate the inflammatory state of periodontal supporting tissues by reversing and reducing the inflammatory phenotype of macrophages, reducing the release of pro-inflammatory cytokines, and increasing the release of anti-inflammatory cytokines.
6. A topical periodontal adjuvant therapy drug, characterized in that, It includes the antibacterial and anti-inflammatory dual-activity polypeptide as described in claim 1.
7. A topical periodontal adjuvant therapy drug as described in claim 6, characterized in that, The drug includes one or more pharmaceutically acceptable excipients, which are stabilizers, diluents, thickeners, gelling agents, or excipients.
8. The application of the antibacterial and anti-inflammatory dual-active polypeptide as described in claim 1 in the preparation of a surface-modified coating for dental implants or a surface-modified coating for conduits, characterized in that, The polypeptide, as a bioactive component, is coated onto the surface of implantable devices, giving the devices antibacterial and anti-inflammatory functions.
Citation Information
Patent Citations
Treatment of inflammation and / or endotoxic shock
CN101641114A
Recombinant human-derived antimicrobial peptide C16LL-37 and application method thereof in streptococcus mutans bioactivity role
CN106008718A