A nitrification-denitrification composite bacterial agent and its preparation method and application

Abstract

The present invention relates to the field of microbial application technology, and in particular to a nitrification-denitrification composite bacterial agent and its preparation method and application. The composite bacterial agent includes Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4; the Glutamicibacter sp. CYN-C5 was deposited in Guangdong Microbial Culture Collection Center on September 19, 2022, with a deposit number of GDMCCNO.62811; the Glutamicibacter sp. NFB2-4 was deposited in Guangdong Microbial Culture Collection Center on September 19, 2022, with a deposit number of GDMCC NO.62810. The composite bacterial agent provided by the present invention can accelerate the conversion of inorganic nitrogen in water bodies, reduce the damage caused to aquaculture animals due to excessive nitrite, thereby realizing the virtuous cycle of factory-based high-density farming and promoting the ecological sustainable development of the aquaculture industry. The invention has remarkable effects in practical applications, and its application effects are better than similar products on the market. The composite bacterial agent of the invention has low cost, no chemical agent is added, is harmless to aquatic organisms, and has good and extensive application prospects in aquaculture.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial application, and in particular to a nitrification-denitrification composite bacterial agent and a preparation method and application thereof. Background Art

[0002] In the process of intensive aquaculture of aquatic animals, the source of inorganic nitrogen in the water body mainly comes from artificial compound feed. The crude protein content in artificial compound feed of grass carp is >28%, and the crude protein content in artificial compound feed of special fish such as California bass and yellow catfish is >40%. After a large amount of artificial compound feed is continuously put into the pond every day, the inorganic nitrogen in the pond continues to increase, far exceeding its own purification capacity. In actual aquaculture production, when the nitrite content in the aquaculture pond is >0.02mg / L, it will affect the growth and feeding of fish. Long-term high ammonia nitrogen and nitrite will also cause irreversible damage to fish farming. Practice shows that: when the nitrite in the aquaculture water of California bass is >0.02mg / L, California bass eats poorly. In the aquaculture process of white shrimp, when the nitrite content is >0.6mg / L, white shrimp will suffer from chronic poisoning, and when the nitrite content is >1.5mg / L, acute poisoning will occur. Therefore, how to regulate the content of nitrite in aquaculture water has become an important issue in the process of sustainable and healthy aquaculture.

[0003] At present, the main method for regulating the nitrite content in aquaculture water in China is biological method, which includes plant denitrification and microbial denitrification. Plant denitrification utilizes the absorption of inorganic nitrogen by aquatic plants, that is, the aquaculture wastewater is concentrated and discharged into the waters where aquatic plants are planted. Through the growth of aquatic plants, nitrogen-containing substances such as ammonia nitrogen, nitrite and nitrate in the water are absorbed. However, this method occupies a large area and is not suitable for use in aquaculture. Microbial denitrification is a process in which ammonia nitrogen is finally converted into N2 and nitrate under the action of nitrification-denitrification. This method is currently a commonly used method in aquaculture production.

[0004] Chinese invention patent CN110656066A discloses a short-term nitrification and denitrification variant Acinetobacter strain and its application. The short-term nitrification and denitrification variant Acinetobacter of the invention has high efficiency in removing total nitrogen, ammonia nitrogen, nitrate nitrogen and nitrite nitrogen, and can be used in the denitrification treatment of freshwater aquaculture water bodies. However, the microbial environment in aquaculture water bodies is complicated, and a single strain is difficult to compete with indigenous strains. Chinese invention patent CN107988125A discloses a low-temperature resistant nitrifying bacteria and its application. The nitrifying bacteria of the invention can tolerate low temperatures and can grow at 2 to 35°C, but the strain mainly removes ammonia nitrogen and has no improvement on nitrite biodegradation. Summary of the invention

[0005] In view of this, it is necessary to provide a nitrification-denitrification composite bacterial agent and its preparation method and application for the above-mentioned problems. The present invention separates nitrifying bacteria and denitrifying bacteria from aquaculture ponds and cow dung, and screens strains with the ability to degrade nitrite after screening with nitrification medium and denitrification medium; further optimizes and compounds to obtain nitrification-denitrification composite bacteria that can reduce the nitrite content in water. The composite bacterial agent has strong adaptability to the environment, is safe for aquatic animals, can significantly degrade the nitrite content in aquaculture water, and is suitable for various freshwater aquaculture waters.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention provides a nitrification-denitrification composite bacterial agent, comprising Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4; the Glutamicibacter sp. CYN-C5 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 19, 2022, with a preservation number of GDMCC NO.62811; the Glutamicibacter sp. NFB2-4 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 19, 2022, with a preservation number of GDMCC NO.62810.

[0008] In a second aspect, the present invention provides a method for preparing the above-mentioned nitrification-denitrification composite bacterial agent, wherein a seed solution of Glutamicibacter sp. CYN-C5 and a seed solution of Glutamicibacter sp. NFB2-4 are mixed and then cultured.

[0009] Further, Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 were cultured in nutrient broth liquid medium NB to prepare seed liquids.

[0010] Furthermore, the mixing ratio of the Glutamicibacter sp. CYN-C5 seed solution and the Glutamicibacter sp. NFB2-4 seed solution is 1-2:1-3 by volume.

[0011] Furthermore, the culture condition is that the mixed seed solution is inoculated into the nutrient broth liquid culture medium NB at a volume ratio of 1% to 3%, and cultured at 25 to 30° C. and a rotation speed of 150 to 200 r / min for 12 to 24 hours.

[0012] Preferably, the culture condition is that the mixed seed solution is inoculated into the nutrient broth liquid medium NB at a 1% inoculation ratio, and cultured at 30° C. and a rotation speed of 150 r / min for 24 hours.

[0013] Furthermore, the composition of the nutrient broth liquid culture medium NB is 3.0 g beef extract, 5.0 g NaCl, 10.0 g peptone, and 1.0 L distilled water; the pH value of the nutrient broth liquid culture medium NB is 7.0-7.2.

[0014] In a third aspect, the present invention provides the use of the above-mentioned nitrification-denitrification composite bacterial agent and the preparation method of the nitrification-denitrification composite bacterial agent in reducing the nitrite content in aquaculture water.

[0015] Furthermore, the application is to expand the culture of the nitrification-denitrification composite bacterial agent and then release it into the aquaculture water body, with the initial release amount being 0.15-0.2L / m 3 , and the subsequent dosage is 0.075~0.1L / m 3 ; once every seven days.

[0016] Furthermore, the dissolved oxygen content of the aquaculture water is 4-6 mg / L.

[0017] The beneficial effects of the present invention are:

[0018] The present invention separates nitrifying and denitrifying bacteria from aquaculture sediment and cow dung, and then separates, purifies, screens and compounds to develop a microbial composite agent that can reduce the nitrite content in aquaculture water. The composite agent can accelerate the conversion of inorganic nitrogen in the water body, reduce the damage to aquaculture animals caused by excessive nitrite, thereby achieving a virtuous cycle of factory-based high-density farming and promoting the ecological sustainable development of the aquaculture industry. The present invention has significant effects in practical applications, and the application effect is better than similar commercial products. The composite agent of the present invention has low cost, no chemical agent is added, is harmless to aquatic organisms, and has good and broad application prospects in aquaculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The colony morphology of Arthrobacter CYN-C5 in the composite bacterial agent of the embodiment of the present invention;

[0020] Figure 2 The bacterial morphology of Arthrobacter CYN-C5 in the composite bacterial agent of the embodiment of the present invention;

[0021] Figure 3 The colony morphology of Arthrobacter NFB2-4 in the composite bacterial agent of the embodiment of the present invention;

[0022] Figure 4 The bacterial morphology of Arthrobacter NFB2-4 in the composite bacterial agent of the embodiment of the present invention;

[0023] Figure 5 This is a comparison chart of the percentage change of nitrite residue in aquaculture water after using the composite bacterial agent in the embodiment of the present invention;

[0024] Figure 6 This is a comparison chart of the change in nitrite content in aquaculture water after using the composite bacterial agent in an embodiment of the present invention;

[0025] Figure 7 This is a comparison chart of the percentage change of nitrite residue in the aquaculture water of a factory aquaculture workshop after using different bacterial agents in an embodiment of the present invention. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be further clearly and completely described below in combination with the embodiments of the present invention. It should be noted that the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0027] The raw materials used in the embodiments of the present invention are all commercially available conventional raw materials, and the present invention is not particularly limited thereto.

[0028] Example 1 Screening of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4

[0029] 1. Strain enrichment: 10 mL of the collected fresh sample was added to 190 mL of nitrification medium and denitrification medium respectively, and enriched and cultured at 30 ° C and 150 r / min for 72 h; the components of nitrification medium (BM) include: K2HPO4 7g, KH2PO4 3g, MgSO4·7H2O 0.1g, HN4Cl 0.573g, FeSO4·7H2O 0.05g, CH3COONa 7.68g, H2O 1L, C / N=15; the components of denitrification medium (DM-1) include: K2HPO4 7g, KH2PO4 3g, MgSO4·7H2O 0.1g, NaNO20.739g, FeSO4·7H2O 0.05g, CH3COONa 7.68g, H2O 1L, C / N=15;

[0030] 2. Initial screening of strains: Take 10 mL of enrichment solution and add it to 90 mL of normal saline, shake well for 15 minutes, and dilute it to 10 by 10-fold dilution method. -1 ~10 -8, take 0.1mL of bacterial suspension with different gradients and spread them on nitrification medium and denitrification solid medium plates respectively, invert them and culture them in a 30℃ constant temperature incubator. After single colonies grow on the solid plates, pick different single colonies for separation and purification (3 times) and number them;

[0031] 3. Strain rescreening: The isolated and purified strains were inoculated into nutrient broth NB medium respectively, and cultured at 30°C and 150r / min for 24h. Then, the seed liquid was inoculated into nitrification medium and denitrification liquid medium at a volume ratio of 1%, and placed in a shaker at 30°C and 150r / min for 48h. The contents of ammonia nitrogen and nitrite were determined. Under the same conditions, the strains with the least residual ammonia nitrogen in the nitrification medium and the least residual nitrite in the denitrification medium were the two strains screened this time.

[0032] Example 2

[0033] Morphological characteristics and molecular biological identification of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4

[0034] 1) Morphological characteristics of Arthrobacter CYN-C5: Colony morphology (such as Figure 1 The cells are round, yellow, with smooth outer edges, a raised middle, and a smooth surface. Under an optical microscope, the cells appear as short rods (as shown in Figure 2 shown).

[0035] 2) Morphological characteristics of Arthrobacter NFB2-4: Colony morphology (e.g. Figure 3 The cells are round, light yellow, with smooth outer edges and smooth surfaces; under an optical microscope, the cells are spherical (as shown in Figure 4 shown).

[0036] 3) The genomic DNA of strains CYN-C5 and NFB2-4 was extracted using the Tiangen Bacteria Genome Extraction Kit, and the 16S rDNA fragments of strains CYN-C5 and NFB2-4 were amplified using the bacterial universal primers 27F and 1492R. The PCR products were sent to a sequencing company for sequencing, and the sequencing results were analyzed. The obtained sequences were submitted to the NCBI database for BLAST search analysis. The primer pair sequences used were:

[0037] 27F:AGAGTTTGATCCTGGCTCAG;

[0038] 1492R:TACCTTGTTACGACTT.

[0039] 4) The 16S rRNA sequence result of strain CYN-C5 is as shown in SEQ ID No. 1, and sequence homology analysis shows that it is Glutamicibacter sp.; the 16S rRNA sequence result of strain NFB2-4 is as shown in SEQ ID No. 2, and sequence homology analysis shows that it is Glutamicibacter sp.

[0040] SEQ ID No.1

[0041]

[0042] SEQ ID No.2

[0043]

[0044] Example 3

[0045] Safety Study on Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 in Compound Bacteria

[0046] Before the strain is used, it is necessary to investigate its safety. Hemolysis test is a simple and quick investigation method. Hemolysis is a manifestation of the damage of blood cells by the test sample. If the strain fermentation liquid causes the blood cells of aquatic animals to rupture (hemolysis rate > 5%), it indicates that the bacteria can easily cause animal death and cannot be used in aquaculture. Otherwise, it indicates that the bacteria is safe and can be used in aquaculture water treatment.

[0047] 1. Experimental process:

[0048] Prepare red blood cell suspension → incubate → observe the hemolysis of red blood cells → measure absorbance → calculate the hemolysis rate.

[0049] 1) Preparation of red blood cell suspension: 1 mL of sterile California sea bass blood was taken, washed with physiological saline and centrifuged (1000 rpm for 15 min, 3 to 5 times in total) until the supernatant no longer showed red color, and the blood cells were resuspended in 50 mL of physiological saline to prepare a 2% red blood cell suspension.

[0050] 2) Incubation: The supernatants of the culture solutions of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 were used as experimental groups, 1% Trion 100 was used as a positive control, NB medium was used as a negative control, and a blank control group was set up. The amount of red blood cells was added according to the hemolysis experiment design in Table 1, mixed well, and placed at 37°C for 30 minutes.

[0051] 3) Observe the hemolysis of red blood cells: centrifuge the incubated solution at high speed (10000 rpm, 3 min) and take the supernatant for observation.

[0052] 4) Determine absorbance: Measure absorbance at 570 nm.

[0053] 5) Calculate the hemolysis rate:

[0054]

[0055] Table 1 Hemolysis experiment design

[0056]

[0057] 2. Experimental results:

[0058] Table 2 Hemolysis rate of CYN-C5 and NFB2-4

[0059]

[0060] As shown in Table 2, the hemolysis rates of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 strains were less than 5%, indicating that these two strains were safe for aquaculture animals and could be used in aquaculture water.

[0061] Example 4

[0062] Test on the ability of nitrification-denitrification composite bacteria to degrade nitrite

[0063] 1. Experimental groups:

[0064] Composite bacterial agent group: prepared by the following method:

[0065] Single colonies of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 strains were picked from NB solid culture plates, activated and cultured in NB liquid culture medium, and then transferred to fresh culture medium to be cultured to mid-logarithmic phase, and mixed at a volume ratio of 1:1 to prepare composite bacterial agent seed solution;

[0066] Single strain group: single Glutamicibacter sp. CYN-C5 and single Glutamicibacter sp. NFB2-4 were used as controls;

[0067] Blank group: no strains were added.

[0068] 2. Experimental methods:

[0069] 2.1 The bacterial liquid of each group was inoculated into a nitrification medium at a volume ratio of 1%, wherein the nitrification medium (BM) components included: K2HPO4 7g, KH2PO4 3g, MgSO4·7H2O 0.1g, HN4Cl 0.573g, FeSO4·7H2O 0.05g, CH3COONa 7.68g, H2O 1L, C / N=15; the initial value of ammonia nitrogen was 5.0mg / L, and the pH value was about 7.2; the culture was carried out at 30°C, 150r / min shaking incubator for 24h;

[0070] 2.2 The bacterial liquid of each group was inoculated into the denitrification medium at a volume ratio of 1%, wherein the denitrification medium (DM-1) components included: K2HPO4 7g, KH2PO4 3g, MgSO4·7H2O 0.1g, NaNO2 0.739g, FeSO4·7H2O 0.05g, CH3COONa 7.68g, H2O 1L, C / N=15; nitrite concentration was 5.0mg / L, pH value was about 7.2; 30°C, 150r / min shaking incubator culture, culture for 24h;

[0071] 2.3 Use commercially available ammonia nitrogen and nitrite detection kits to determine the residual amount of ammonia nitrogen and nitrite for 24 hours: take a small amount of nitrification and denitrification culture fluid from each group and centrifuge at 12000rpm for 2min. After centrifugation, take 5mL of the supernatant of the culture fluid of the single strain group (dilute according to actual conditions), the supernatant of the culture fluid of the composite bacterial agent group and the blank culture medium respectively, add the determination reagent according to the instructions of the ammonia nitrogen or nitrite nitrogen detection kit, mix well, let stand for 5min, observe the color change, and refer to the color comparison card for reading (the detection limit of nitrite nitrogen is 0.01~0.30mg / L, and the detection limit of ammonia nitrogen is 0.20~1.50mg / L).

[0072] 3. Experimental results:

[0073] The residual concentrations of nitrite and ammonia nitrogen in the supernatant of the culture medium after culturing Glutamicibacter sp. CYN-C5 single strain, Glutamicibacter sp. NFB2-4 single strain and composite bacterial agent in nitrification medium and denitrification medium for 24 hours are shown in Table 3.

[0074] Table 3

[0075]

[0076] As shown in Table 3, after 24 hours of cultivation in the nitrification and denitrification medium, the composite bacterial agent group degraded ammonia nitrogen and nitrite the fastest.

[0077] Example 5

[0078] Verification of the effect of nitrification-denitrification composite bacteria in indoor fish tanks

[0079] 1. Preparation of composite bacterial agent: Mix the seed liquid of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 in a volume ratio of 1:1, inoculate the mixed seed liquid into NB medium at a 1% inoculum amount, culture 20 mL in a conical flask for later use, and culture conditions are a constant temperature shaker at 30°C, a rotation speed of 150 rpm, and a culture time of 24 h.

[0080] 2. Experimental preparation: The indoor fish pond is a 200L PV barrel, each barrel contains 100L of tap water. After aeration by an oxygen pump for 48 hours, 18 small grass carps weighing about 40-50g each are placed in each barrel. After 5 days of temporary storage, the health status of the grass carps was checked. The grass carps in each experimental group were healthy and free of disease.

[0081] 3. Experimental design: Set up one experimental group and one blank group, with two parallel groups in each group; the blank group was not treated; the experimental group added a composite bacterial agent, the first addition concentration was 0.16mL / L, and the composite bacterial agent was added again after 7 days, with an addition concentration of 0.08mL / L (first add the composite bacterial solution to a 5L container, add a small amount of polyurethane hydrophilic sponge, add 5L fish pond water, soak for 4-5h, and then pour into the fish tank to allow the composite bacterial agent to adhere to the sponge), and the experimental period is 15 days in total. During the blank group experiment, the total daily feeding rate was calculated as 3%, and 2 meals were fed per day, with the feeding time at 9:00 in the morning and 15:00 in the afternoon. The nitrite content of each group was monitored before the experiment began, and once a day after the experiment began. The detection method used a commercially available nitrite rapid test kit for detection.

[0082] 4. Experimental results: The results are as follows Figure 5-6 As shown. The increase in nitrite content in the experimental group in the early stage was mainly due to the continuous conversion of protein in the feed before the experiment into inorganic nitrogen sources. Although the amount of feed input was the same, the final conversion into inorganic nitrogen in each group was different, but it did not affect the experimental effect. On the 8th day after the compound bacterial agent was added, the nitrite content was significantly reduced, and the residual content was only 0.11%, with no rebound in the later period. The residual content of the blank group in the same period was 216.98%, which was significantly higher than that of the experimental group.

[0083] Example 6

[0084] Application of nitrification-denitrification compound bacteria in factory breeding workshop

[0085] 1. Experimental preparation: This field experiment was conducted at a grass carp breeding base of a large breeding company in Guangzhou. The breeding system in the workshop is an internal circulation mode of primary filtration, secondary sedimentation, and tertiary breeding. That is, the breeding pond water flows from the breeding pond to the filter pond through internal circulation to filter the residual bait and feces, and then flows through the sedimentation tank for denitrification. The sedimentation tank is equipped with coral stones to provide a place for the growth and reproduction of microorganisms, and finally flows back into the breeding pond. Each filter pool and sedimentation tank is equipped with 5 breeding pools, and the volume of the breeding pool is 5m 3 Water / pond. The temporary stocking density of each circulation system is 5500 jin, and the size of grass carp is 2-3 jin / tail.

[0086] 2. Experimental design: The experiment was divided into 4 groups, namely, the blank group, the nitrification-denitrification composite bacteria group, the commercial product group 1 and the commercial product group 2 (the main component of commercial product 1 is Bacillus, and the main component of commercial product 2 is nitrification-denitrification bacteria, both products are from Xinhai Lisheng Biotechnology Co., Ltd.), and each group was set up with two parallels. The blank group was not treated. The nitrification-denitrification composite bacteria group was first added with 5L of fermentation liquid in a circulation system. The fermentation liquid was obtained by mixing the seed liquid of Glutamicibacter sp. CYN-C5 and Glutamicibacter sp. NFB2-4 in a ratio of 1:1 and fermenting and culturing in a fermenter for 24 hours. The amount of bacterial liquid added later was 2.5L. The commercial product group 1 and the commercial product group 2 were powdered bacteria, and the amount used in each circulation system was 400g. Each time it was used, 400g of bacterial powder, a small amount of molasses and 15L of pool water were fermented for 24 hours and then splashed for use. Each group of bacterial agents was put into the sedimentation tank and used once every 7 days. Each experimental group was used 4 times, and the experimental period was 25 days. During the experiment, the changes in the nitrite content in the pool water of each group were monitored every 2 days. The monitoring method was naphthylethylenediamine hydrochloride spectrophotometry.

[0087] 3. Experimental results: The results are as follows Figure 7 As shown in the figure, after the first bacterial solution was added to each experimental group, the nitrite degradation rate of the nitrification-denitrification composite bacteria group was the fastest. The nitrite content of the blank group and the commercial product group 2 increased sharply on the 4th day due to the addition of grass carp. On the 6th day after the introduction, the residual nitrite of the nitrification-denitrification composite bacteria group was 51.09%, the control group was 94.29%, the commercial product group 1 was 89.47%, and the commercial product group 2 was 80%. The nitrification-denitrification composite bacteria group was significantly lower than the blank group, the commercial product group 1, and the commercial product group 2. On the 18th day of the experiment, the residual nitrite content of the nitrification-denitrification composite bacteria group began to be significantly lower than that of the other experimental groups and the blank group, and there was no rebound. After 24 days of the experiment, the residual nitrite content of the nitrification-denitrification composite bacteria group was only 23%, which was significantly lower than that of the blank group and other experimental groups.

[0088] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nitrification-denitrification composite bacterial agent, characterized in that: The composite bacterial agent includes Glutamicibacter sp.CYN-C5 and Glutamicibacter sp.NFB2-4; the Glutamicibacter sp.CYN-C5 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 19, 2022, with a preservation number of GDMCC NO.62811; the Glutamicibacter sp.NFB2-4 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 19, 2022, with a preservation number of GDMCC NO.62810.

2. The method for preparing the nitrification-denitrification composite bacterial agent according to claim 1, characterized in that: The seed solution of Glutamicibacter sp.CYN-C5 and the seed solution of Glutamicibacter sp.NFB2-4 were mixed and cultured.

3. The method for preparing the nitrification-denitrification composite bacterial agent according to claim 2, characterized in that: Glutamicibacter sp.CYN-C5 and Glutamicibacter sp.NFB2-4 were cultured in nutrient broth liquid medium NB to prepare seed liquid.

4. The method for preparing the nitrification-denitrification composite bacterial agent according to claim 3, characterized in that: In terms of volume ratio, the mixing ratio of the seed solution of Glutamicibacter sp.CYN-C5 and the seed solution of Glutamicibacter sp.NFB2-4 is 1-2:1-3.

5. The method for preparing the nitrification-denitrification composite bacterial agent according to claim 2, characterized in that: The culture condition is that the mixed seed liquid is inoculated into the nutrient broth liquid culture medium NB at a volume ratio of 1% to 3%, and cultured at 25 to 30° C. and a rotation speed of 150 to 200 r / min for 12 to 24 hours.

6. The method for preparing the nitrification-denitrification composite bacterial agent according to claim 5, characterized in that: The culture conditions are as follows: the mixed seed solution is inoculated into a nutrient broth liquid medium NB at a 1% inoculation ratio, and cultured at 30° C. and a rotation speed of 150 r / min for 24 hours.

7. The method for preparing the nitrification-denitrification composite bacterial agent according to claim 3, characterized in that: The composition of the nutrient broth liquid culture medium NB is 3.0 g of beef extract, 5.0 g of NaCl, 10.0 g of peptone, and 1.0 L of distilled water; the pH value of the nutrient broth liquid culture medium NB is 7.0-7.

2.

8. Use of the nitrification-denitrification composite bacterial agent described in claim 1 or the preparation method of the nitrification-denitrification composite bacterial agent described in any one of claims 2 to 7 in reducing the nitrite content in aquaculture water.

9. The use according to claim 8, characterized in that: After expanding the culture of nitrification-denitrification compound bacteria, add them to the aquaculture water body. The initial addition amount is 0.15-0.2L / m 3 , and the subsequent dosage is 0.075~0.1L / m 3 ; once every seven days.

10. The use according to claim 8, characterized in that: The dissolved oxygen content of the aquaculture water is 4-6 mg / L.

Images