A coupling enzyme involved in the biosynthesis of bisbenzylisoquinoline alkaloids and its application

Abstract

The present invention discloses a coupling enzyme and its application, and relates to the field of medicinal plant genetic engineering. The amino acid sequence of the coupling enzyme StCYP80A is shown in SEQ ID NO.1, or an amino acid sequence having coupling enzyme function obtained by substitution and / or deletion and / or addition of one or more amino acid residues, or a protein having 90% or more identity with the amino acid sequence and coupling to form a bisbenzylisoquinoline alkaloid (BBI); a recombinant microorganism co-expressing StCYP80A and CYP450 reductase StCPR; application of StCYP80A in catalysis or preparation of BBI; a recombinant expression vector, a recombinant microorganism and its application in the preparation of StCYP80A. The present invention discloses a coupling enzyme StCYP80A and its encoding gene, which can catalyze rugenine to form single-coupled BBI and generate double-coupled BBI.

Description

Technical Field

[0001] The invention relates to the field of medicinal plant genetic engineering, and in particular to a coupling enzyme involved in the biosynthesis of bisbenzylisoquinoline alkaloids and its application. Background Art

[0002] Stephania tetrandra S.Moore is a plant of Menispermaceae family. It has the effects of diuresis, detumescence, wind-dispelling and pain-relieving. Stephania tetrandra is rich in benzylisoquinoline alkaloids (BIAs), especially bisbenzylisoquinoline (BBI). BBI is the main active ingredient in Stephania tetrandra, which has anti-inflammatory, antibacterial, antiviral, antiarrhythmic and antitumor biological activities. Representative ingredients include tetrandrine and fangchinoline. However, Stephania tetrandra is currently scarce in wild resources, with a small scale of artificial cultivation and a long planting cycle. The content of active BBI is low, and it is difficult to synthesize artificially, making it difficult to achieve industrial production, which limits its development and application. Elucidating the biosynthetic pathway of BBI in Stephania tetrandra and its key enzymes can lay the foundation for the production of BBI using biotechnology or increasing the content of target ingredients in plants, and can also provide a theoretical basis for the formation of medicinal material quality.

[0003] It is generally believed that the biosynthesis of BBI begins with the metabolic conversion of L-tyrosine into dopamine and 4-hydroxy-phenylacetaldehyde, followed by the formation of S-norcoclaurine ((S)-norcoclaurine) catalyzed by norcoclaurine synthase (NCS), S-coclaurine ((S)-coclaurine) catalyzed by 6-oxymethyltransferase (6OMT), and SN-methylcoclaurine ((S)-N-methylcoclaurine) catalyzed by nitrogen methyltransferase (CNMT), and then coupled to form its dimer under the action of cytochrome P450 enzyme CYP80A. In the above synthesis process, CYP80A is the key enzyme for synthesizing the skeleton structure of BBI.

[0004] At present, there is no report on the functional CYP80A in Stephania tetrandra. The only other plant with verified function is BsCYP80A1, i.e., berbamunine synthase, found in Berberis stolonifera. BsCYP80A1 can catalyze the CO aryl coupling reaction between (R)- and (S)-N-methylcoclaurine molecules to produce BBI. The product formed by BsCYP80A1 is a single-coupled BBI, and it cannot form a double-coupled BBI. However, many BBIs with significant biological activity in Stephania tetrandra are double-coupled, including stephanine, cephalothin, berbamine, and fangchinoline, of which the first three compounds have been developed into drugs. Therefore, the discovery that CYP80A can catalyze the formation of double-coupled BBI from monobenzylisoquinoline is particularly important for the synthesis of active BBI in Stephania tetrandra, and it also has important theoretical and practical significance for the synthesis of BBI in other plants.

[0005] Therefore, those skilled in the art are committed to developing an enzyme capable of catalyzing the formation of double-coupled BBI from monobenzylisoquinoline and its application. Summary of the invention

[0006] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to develop an enzyme that can catalyze monobenzylisoquinoline to form double-coupled BBI and its application in the production of bisbenzylisoquinoline-type alkaloids.

[0007] To achieve the above object, the present invention provides a coupling enzyme StCYP80A, comprising:

[0008] (a1) a coupling enzyme having an amino acid sequence as shown in SEQ ID NO.1;

[0009] (a2) a protein having a coupling enzyme function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (a1);

[0010] (a3) A protein having an amino acid sequence that is 90% or more identical to that of (a1) and having the ability to couple monobenzylisoquinoline alkaloids to form bisbenzylisoquinoline alkaloids (BBI).

[0011] Furthermore, the coupling enzyme protein of the present invention is derived from Stephania tetrandra and is named StCYP80A.

[0012] Furthermore, the above (a3) ​​is a protein derived from Stephania tetrandra and has the ability to couple with monobenzylisoquinoline alkaloids to form BBI.

[0013] The present invention also provides a gene of coupling enzyme StCYP80A, comprising:

[0014] (b1) the nucleotide sequence is a DNA sequence as shown in SEQ ID NO.2;

[0015] (b2) a DNA sequence obtained by substituting and / or deleting and / or adding one or more nucleotides to the DNA sequence of (b1);

[0016] (b3) a DNA molecule having 90% or more identity with the DNA sequence of (b1) and encoding a CYP80A protein;

[0017] (b4) The DNA sequence of (b1) after codon optimization is the DNA sequence shown in SEQ ID NO.5.

[0018] Furthermore, the above (b3) is a DNA molecule derived from Stephania tetrandra and encoding CYP80A protein.

[0019] The invention also provides a recombinant expression vector of the coupling enzyme StCYP80A gene.

[0020] The invention also provides a recombinant microorganism of the coupling enzyme StCYP80A gene.

[0021] Furthermore, recombinant vectors include subcloning vectors and microbial cell expression vectors such as yeast;

[0022] Furthermore, recombinant microorganisms include microbial cells such as yeast.

[0023] The present invention also provides a co-expression recombinant microorganism, which co-expresses coupling enzyme StCYP80A and CYP450 reductase StCPR; the co-expression recombinant microorganism includes a yeast system, the amino acid sequence of StCPR is shown in SEQ ID NO.3, its encoding gene is shown in SEQ ID NO.4, and the encoding gene after codon optimization is shown in SEQ ID NO.6.

[0024] Furthermore, the above-mentioned CYP450 reductase (CPR) is derived from Stephaniatetrandra and is named StCPR. The yeast system co-expressing StCYP80A and StCPR has a significantly higher conversion rate for the coupling product of benzylisoquinoline alkaloids than the conversion rate of the system expressing only StCYP80A.

[0025] The present invention also provides an application of a coupling enzyme StCYP80A in catalyzing the coupling of two monobenzylisoquinoline alkaloid molecules to form a bisbenzylisoquinoline alkaloid (BBI).

[0026] Furthermore, the coupling enzyme StCYP80A catalyzes the CO aryl coupling between two monobenzylisoquinoline alkaloid molecules to form bisbenzylisoquinoline alkaloids.

[0027] The invention also provides an application of a recombinant expression vector of a coupling enzyme StCYP80A gene in preparing the coupling enzyme StCYP80A.

[0028] The present invention also provides an application of a recombinant microorganism of a coupling enzyme StCYP80A gene in preparing the coupling enzyme StCYP80A.

[0029] The present invention also provides an application of a protein of a coupling enzyme StCYP80A in the preparation of bisbenzylisoquinoline alkaloids.

[0030] The use of the above-mentioned genes, recombinant vectors or recombinant bacteria in the in vitro synthesis of bis-benzylisoquinoline compounds all fall within the protection scope of the present invention.

[0031] In the preferred embodiment 1 of the present invention, the discovery process of a bisbenzylisoquinoline alkaloid synthase (StCYP80A) and its encoding gene in Stephania tetrandra is described in detail;

[0032] In another preferred embodiment 2 of the present invention, the process of verifying the function of StCYP80A derived from Stephania tetrandra in vivo in Saccharomyces cerevisiae is described in detail;

[0033] In another preferred embodiment 3 of the present invention, the process of verifying the function of StCYP80A after codon optimization in Saccharomyces cerevisiae is described in detail;

[0034] In another preferred embodiment 4 of the present invention, the extraction and in vitro catalysis process of StCYP80A microsomal protein after codon optimization are described in detail;

[0035] The beneficial technical effects of the present invention are as follows:

[0036] The present invention discloses a coupling enzyme StCYP80A and a coding gene thereof. StCYP80A can catalyze linalool to form a single coupled BBI and can generate a double coupled BBI, while the reported and clearly functional BsCYP80A can only form a single coupled BBI. The discovery of StCYP80A provides an effective enzymatic tool for coupling monobenzylisoquinoline alkaloids to form a BBI skeleton, which is very important for the synthesis of BBI, especially for the synthesis of active double coupled BBI.

[0037] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a spectrum detected by LC-UV-MS of the formation of coupling products by StCYP80A-1 catalyzed by (R, S)-coclaurine in a yeast system without codon optimization in a preferred embodiment 2 of the present invention;

[0039] Figure 2 LC-UV-MS and LC-MS / MS analysis chromatograms of the formation of coupling products by (R,S)-coclaurine catalyzed by codon-optimized StCYP80A-2 in the yeast system of Example 3;

[0040] Figure 3 is a secondary mass spectrometry fragmentation mechanism diagram of the single coupling product P1 obtained by StCYP80A-2 catalyzing (R, S)-coclaurine in Example 3;

[0041] Figure 4 This is a secondary mass spectrometry fragmentation mechanism diagram of the double coupling product P2 obtained by StCYP80A-2 catalyzing (R,S)-coclaurine in Example 3. DETAILED DESCRIPTION

[0042] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0043] Example 1. Discovery of a bisbenzylisoquinoline alkaloid synthase (StCYP80A) in Stephania tetrandra and its encoding gene

[0044] The transcriptome database of Stephania tetrandra was obtained by sequencing the transcriptome of root and leaf tissues of Stephania tetrandra. After Blast screening and sequence alignment with sequences from public data such as NCBI and KEGG, 19 CYP80A candidate sequences were mined. After heterologous expression in Saccharomyces cerevisiae and substrate feeding, it was determined that one of the proteins had the function of catalyzing the formation of CO coupling between two molecules of monobenzylisoquinoline alkaloids. The protein was named StCYP80A, and its amino acid is shown in SEQ ID NO.1 of the sequence table, consisting of 496 amino acids. The gene encoding the StCYP80A protein was named StCYP80A gene, and its open reading frame cDNA sequence is shown in SEQ ID NO.2 of the sequence table.

[0045] By the same method, a CYP450 reductase was excavated from a powdered tetrandra, and the protein was named StCPR, which consists of 690 amino acids, and its amino acid sequence is shown in SEQ ID NO.3 of Sequence Listing 3. The gene encoding the StCPR protein was named StCPR, and its open reading frame cDNA sequence is shown in SEQ ID NO.4 of the sequence list.

[0046] Example 2: Verification of the function of StCYP80A from Stephania tetrandra in Saccharomyces cerevisiae

[0047] The verification steps are as follows:

[0048] Step 1: Construction of heterologous expression plasmid

[0049] The StCYP80A from Stephania tetrandra was coded as StCYP80A-1. Primers containing homology arms at both ends of the plasmid (StCYP80A-1-F1 and R1) were designed, and the StCYP80A gene with homology arms was amplified by PCR from the cDNA sample of Stephania tetrandra, and the PCR product was recovered and purified. The free plasmid pESC-Leu of Saccharomyces cerevisiae was double-digested with restriction endonucleases NotⅠ and SacⅠ, and the linearized plasmid was recovered by gel.

[0050] The primer sequence StCYP80A-1-F1 is shown in SEQ ID NO.1: TCACTAAAGGGCGGCCGCATGGATCCAATCACACTG; the primer sequence StCYP80A-1-R1 is shown in SEQ ID NO.8: CGAAGAATTGTTAATTAAGAGCTCTTAAACCGCAGTTGCTG.

[0051] The recombinant plasmid pESC-Leu-StCYP80A-1 was constructed by homologous recombination, and Escherichia coli DH10B was transformed by heat shock method. The ampicillin-resistant transformants were picked and amplified in LB medium. After the plasmid was extracted, PCR, restriction digestion and sequencing verification were performed in sequence, and finally the recombinant plasmid pESC-Leu-StCYP80A-1 with correct sequencing was obtained.

[0052] Step 2: Obtaining recombinant yeast strains

[0053] The recombinant plasmid pESC-Leu-StCYP80A-1 obtained in step 1 was transformed into the Saccharomyces cerevisiae YPH499 strain using the Frozen-EZ yeast Transformation II kit. The bacterial solution was spread onto the defective medium SD-Leu plate, and a single colony was picked after culturing at 30°C for 2 days. At the same time, the empty plasmid was transformed into the YPH499 strain to obtain a blank control bacterium.

[0054] Step 3: Yeast whole cell catalysis

[0055] Pick up the recombinant yeast colony grown on the Leu-deficient medium plate in step 2 and transfer it to the liquid-deficient medium. Pick up the monoclonal colony grown on the defective medium plate and transfer it to 15 ml SD-Leu liquid medium. Culture overnight at 30°C and 220 rpm. Control OD 600 To 0.8-1.2, centrifuge (3000rpm, 5min), remove SD-Leu, replace induction medium SG-Leu, centrifuge after 20h of induction culture, and obtain bacterial cell pellet. Wash the pellet once with 50mM PBS and resuspend it to a final volume of 500μl. Feed the substrate (R,S)-coclaurine, and the final concentration of the substrate in the system is 0.25mM. Catalyze the whole cell at 30℃, 220rpm for 24h.

[0056] Step 4: Reaction solution treatment and detection

[0057] The reaction solution in step 3 was added with an equal amount of methanol to terminate the reaction. After ultrasonic extraction for 15 min, the solution was centrifuged (12000 rpm, 5 min) to remove the precipitate. After filtration through a 0.22 μm organic filter membrane, LC-UV-MS analysis was performed.

[0058] The LC-UV-MS detection conditions are as follows: the liquid phase system is Shimadzu LCMS-2020; the chromatographic column is Shim-pack XR-ODSⅢ (2.0mm×75mm, 1.6μm); the column temperature is room temperature (about 25°C); the flow rate is 0.2ml / min; the mobile phase is A (0.1% formic acid aqueous solution)-B (methanol) for gradient elution, and the time program is: 0min, 10% (v / v) B%; 12min, 100% (v / v) B%; 13min, 100% (v / v) B%; PDA detection, the monitoring wavelength is 282nm; mass spectrometry detection uses an electrospray ionization ion source (ESI) to collect positive ions, and the scanning range is 100-800m / z; the interface voltage is 4.5kv.

[0059] The results of the experiment on (R,S)-coclaurine catalyzed by pESC-Leu-StCYP80A-1 transformation in yeast are shown in Figure 1 . Figure 1 This is the LC-UV-MS of the coupling product formed by (R,S)-coclaurine catalyzed by StCYP80A-1 without codon optimization in the yeast system. In the figure, part 1A is the LC-UV spectrum of the culture medium blank control and the enzyme reaction solution. Figure 1Part B is the LC-MS extracted ion chromatogram of the culture medium blank control and the enzymatic reaction solution. The culture medium blank control is the culture medium with substrate added but without StCYP80A-1, and the enzymatic reaction solution is a sample of the substrate catalyzed by the whole cell of recombinant Saccharomyces cerevisiae expressing StCYP80A-1. The results show that Saccharomyces cerevisiae heterologously expressing StCYP80A-1 can catalyze (R,S)-coclaurine to produce a single coupling product P1 with a mass-to-charge ratio of 569.25.

[0060] Example 3: Verification of the function of StCYP80A after codon optimization in Saccharomyces cerevisiae

[0061] 1. Construction of heterologous expression plasmid

[0062] The StCYP80A gene derived from Stephania tetrandra in Example 2 was codon optimized and then fully synthesized to obtain a codon-optimized gene fragment, the base sequence of which is shown in Sequence 5 of the sequence table and is named StCYP80A-2. Primers of the target gene containing homologous arms at both ends of the plasmid (StCYP80A-2-F2 and R2) were designed. The free plasmid pESC-Leu of Saccharomyces cerevisiae was double-digested with restriction endonucleases NotⅠ and SacⅠ, and the linearized plasmid was recovered by gel.

[0063] The primer sequence StCYP80A-2-F2 is shown in SEQ ID NO.9: CCTCACTAAAGGGCGGCCGCATGGACCCAATCACTTTG; the primer sequence StCYP80A-2-R2 is shown in SEQ ID NO.10: AATTGTTAATTAAGAGCTCTTAAACAGCAGTAGCAGAAG.

[0064] The recombinant plasmid pESC-Leu-StCYP80A-2 was constructed in the same manner as step 1 in Example 2.

[0065] The pESC-Leu-StCYP80A-2 recombinant plasmid was double digested with restriction endonucleases XhoⅠ and NheⅠ, and the linearized plasmid was recovered by gel. The StCPR gene (sequence 4, coded as StCPR-1) derived from Stephania tetrandra was codon-optimized and then fully synthesized to obtain a codon-optimized gene fragment (coded as StCPR-2), the base sequence of which is shown in the sequence table SEQ ID NO.6, and target gene primers (StCPR-2-F and R) containing homologous arms at both ends of the plasmid were designed.

[0066] The primer sequence StCPR-2-F is shown in SEQ ID NO.11: TTTCCGAAGAAGACCTCGAGATGGCTTCTAAATACGCTAA; the primer sequence StCPR-2-R is shown in SEQ ID NO.12: TAGAGCGGATCTTAGCTAGCTTACCAAACATCTCTCAAAT.

[0067] The same method as step 1 of Example 2 above was used to construct a recombinant plasmid to obtain the correctly sequenced recombinant plasmid pESC-Leu-StCYP80A-2-StCPR-2.

[0068] 2. Obtaining recombinant yeast strains

[0069] The same Saccharomyces cerevisiae transformation method as in step 2 of Example 2 was used to obtain the Saccharomyces cerevisiae YPH499 strain transformed with the recombinant plasmid pESC-Leu-StCYP80A-2-StCPR-2, and an empty plasmid was transformed as a blank control strain.

[0070] 3. Yeast Whole Cell Catalysis

[0071] The yeast whole cell catalysis method is the same as step 3 of Example 2.

[0072] 4. Reaction Solution Treatment and Detection

[0073] The reaction solution treatment method is the same as step 4 of Example 2, and the treated sample is subjected to LC-UV-MS, LC-QTOF-MS and LC-MS / MS analysis.

[0074] The LC-UV-MS detection conditions are as follows: the liquid phase system is Shimadzu LCMS-2020; the chromatographic column is Shim-pack XR-ODSⅢ (2.0mm×75mm, 1.6μm); the column temperature is room temperature (about 25°C); the flow rate is 0.2ml / min; the mobile phase is A (0.1% formic acid aqueous solution)-B (methanol) for gradient elution, and the time program is: 0min, 5% (v / v) B%; 10min, 45% (v / v) B%; 11min, 95% (v / v) B%; 12min, 95% (v / v) B%; PDA detection, the monitoring wavelength is 282nm; mass spectrometry detection uses an electrospray ionization ion source (ESI) to collect positive ions, and the scanning range is m / z 100-800; the interface voltage is 4.5kv.

[0075] The LC-QTOF-MS detection conditions are as follows: the liquid phase system is an Agilent 1290 ultra high performance liquid chromatograph; the mass spectrometry system is an AB 5600+QTOF; the chromatographic column is a Venusil XBP PH (2.1×100mm, 5μm); the column temperature is 40°C; the flow rate is 0.5ml / min; the mobile phase is A (0.1% formic acid aqueous solution)-B (acetonitrile), and the time program is: 0min, 10% (v / v) B%; 13min, 75% (v / v) B%; 13.01min, 95% (v / v) B%; 15min, 95% (v / v) B%; MS detection uses ESI to collect positive ions, and the scanning range is m / z 50-1000.

[0076] The LC-MS / MS detection conditions were as follows: the liquid phase system was Shimadzu LCMS-8060; the chromatographic column was Venusil XBP PH (2.1×100 mm, 5 μm); the column temperature was 40°C; the flow rate was 0.5 ml / min; the mobile phase was A (0.1% formic acid aqueous solution)-B (acetonitrile), and the time program was: 0 min, 5% (v / v) B%; 5 min, 25% (v / v) B%; 7 min, 95% (v / v) B%; 9 min, 95% (v / v) B%; the mass spectrometry detection used ESI to collect positive ions, and the interface voltage was 4.0 kV; the scanning mode was full scan m / z 50-1000, and the following ion pairs were selected for multiple reaction monitoring (MRM) for detection: substrate rutinine m / z 286.25→107.15, rutinine single coupling product P1 m / z 569.35→178.25; 569.35→213.10, double coupling product P2 m / z 567.35→178.25; 567.35→194.25; 567.35→213.10; 567.35→354.25.

[0077] The results of the experiment on (R,S)-coclaurine catalyzed by yeast transformed with pESC-Leu-StCYP80A-2-StCPR are shown in Figure 2. Part 2A in the figure is the LC-UV spectrum of the culture medium blank control and the enzymatic reaction solution, Part 2B is the LC-MS extracted ion chromatogram of the culture medium blank control and the enzymatic reaction solution, and Part 2C is the LC-MS / MS chromatogram of the culture medium blank control and the enzymatic reaction solution. The culture medium blank control is the culture medium with substrate added but without StCYP80A-2 and StCPR-2, and the enzymatic reaction solution is a sample of the substrate catalyzed by the whole cell of recombinant Saccharomyces cerevisiae co-expressing StCYP80A-2 and StCPR-2. The results showed that Saccharomyces cerevisiae co-expressing StCYP80A-2 and StCPR-2 can catalyze (R,S)-coclaurine to produce products P1 and P2. The two products have similar chemical properties, small retention time difference, adhesion and approximate single peak on the UV detector, and two peaks can be seen in the MS detector extracted ion chromatogram. The two peaks were accurately measured by LC-QTOF-MS and the molecular formula was given: P1 HRESIMS m / z569.2626[M+H] + (Calculated value 569.2646, C 34 H 37 N 2 O 6 + ), P2 HRESIMS m / z 567.2472[M+H] + (Calculated value 567.2490, C 34 H 35 N 2 O 6 + ).

[0078] The mass spectrometry fragmentation mechanisms of products P1 and P2 inferred from the MS / MS signals are shown in the attached Figure 3 and 4 . Figure 3 In the above example, the parent ion of P1 measured by the primary mass spectrometer is [M+H] + m / z 569.25, with a diphenyl ether fragment m / z 213.10, indicating that it is a single coupling product of two monoisoquinolines connected by a diether bond, combined with m / z 552.25 [M+H-NH 3 ] + , 178.10, 175.10, and 143.10, etc., identified P1 as the single coupling product lindoldhamine. Figure 4 In the above equation, the parent ion of P2 is [M+H] +m / z 567.25, its dibenzyl group breaks to form a diphenyl ether fragment m / z 213.25 and an isoquinoline dimer fragment m / z 354.25, and the isoquinoline dimer further breaks down to form monoisoquinoline fragments m / z 178.25 and 194.25. Therefore, P2 is a double coupling product connected by a diether bond and two isoquinoline groups, and is identified as N,N′-dimethylobamegine.

[0079] The activity of StCYP80A-2 before and after co-expression of StCPR-2 was compared by catalyzing (R,S)-coclaurine activity in yeast. It was found that the bacterial conversion rate increased by 1-100 times after co-expression of StCYP80A-2 with StCPR-2, indicating that StCPR can significantly improve the conversion efficiency of StCYP80A in yeast and enhance enzyme activity.

[0080] Compared with the non-codon-optimized StCYP80A-1 in Example 2, the codon-optimized StCYP80A-2 had an activity of catalyzing (R,S)-coclaurine that was 2-10 times higher.

[0081] Example 4. Extraction of StCYP80A microsomal protein after codon optimization and in vitro catalysis

[0082] 1. Microsomal Protein Extraction

[0083] Take pESC-Leu-StCYP80A-2-StCPR-2 to transform yeast, shake the bacteria in SD-Leu defective medium, and culture for 24 hours until OD 600 0.8-1.0, replaced with SD-Leu deficient medium containing 2% galactose, and induced expression for 24 h.

[0084] The culture medium was removed by centrifugation of the bacterial solution, 1 ml of TESB buffer was added per gram of bacterial cells, 0.2 ml of glass beads and 1 ml of bacterial solution were added to each tube, and the bacterial cells were broken by an oscillating cell disruptor at a speed of 6 m / s for 10 s / time, placed on ice for 3 min, and repeated 6 times. Centrifuge (10,000 g, 4 ° C) for 20 min and take the supernatant. Ultracentrifuge (100,000 g, 4 ° C) for 1 h to obtain microsomal precipitates, which were dissolved in an appropriate amount of TEG buffer. The microsomal protein concentration was determined using the Bio-Tech modified Bradford protein assay kit.

[0085] 2. Reaction system preparation

[0086] Take the microsomal precipitate and prepare the enzymatic reaction system. The reaction system volume is 0.5 ml, containing 400 μg of microsomal protein, 0.05 mM FAD, 0.05 mM FMN, 1 mM NADPH, 0.05 mM substrate (R, S)-coclaurine, and TEG buffer (PH: 7.5) to 0.5 ml. React at 30°C, 220 rpm for 12 hours to obtain the enzymatic reaction solution.

[0087] 3. Reaction Solution Treatment and Detection

[0088] React at 30℃, 220rpm for 12h, add an equal volume of ethyl acetate, shake and extract for 30s, ultrasonicate for 15min, centrifuge (12000rpm, 4℃, 5min), take the upper ethyl acetate phase. After evaporating the ethyl acetate, add 500μl chromatographic grade methanol to dissolve. Centrifuge (12000rpm, 4℃, 5min), take the supernatant for LC-UV-MS detection.

[0089] The LC-UV-MS detection conditions were the same as those in step 4 of Example 2. The results showed that the StCYP80A-2 protein could catalyze (R, S)-coclaurine to generate a single coupling product P1 (R, S)-coclaurine and a double coupling product P2 (R, S)-N, N′-demethylcoclaurine.

[0090] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A coupling enzyme StCYP80A, characterized in that The amino acid sequence of the coupling enzyme StCYP80A is shown in SEQ ID NO.

1.

2. The gene encoding the coupling enzyme StCYP80A according to claim 1, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. A recombinant expression vector containing the gene according to claim 2.

4. A recombinant microorganism containing the gene according to claim 2.

5. A co-expression recombinant microorganism, characterized in that: The co-expression recombinant microorganism co-expresses the coupling enzyme StCYP80A and the CYP450 reductase StCPR; the co-expression recombinant microorganism includes a yeast system, the amino acid sequence of the coupling enzyme StCYP80A is shown in SEQ ID NO.1, the amino acid sequence of the StCPR is shown in SEQ ID NO.3, its encoding gene is shown in SEQ ID NO.4, and the encoding gene after codon optimization is shown in SEQ ID NO.

6.

6. Use of the coupling enzyme StCYP80A as claimed in claim 1 in catalyzing the coupling of two monobenzylisoquinoline alkaloid molecules to form a bisbenzylisoquinoline alkaloid (BBI).

7. The use according to claim 6, characterized in that The coupling enzyme StCYP80A catalyzes the CO aryl coupling between two monobenzylisoquinoline alkaloid molecules to form the bisbenzylisoquinoline alkaloid.

8. Use of the recombinant expression vector according to claim 3 in the preparation of coupling enzyme StCYP80A.

9. Use of the recombinant microorganism according to claim 4 in the preparation of coupling enzyme StCYP80A.

10. Use of a protein containing the coupling enzyme StCYP80A as claimed in claim 1 in the preparation of bisbenzylisoquinoline alkaloids.

Images