Application of CsLB1 gene or its encoded protein in regulating the wax powder content of cucumber peel

Abstract

The invention discloses the application of CsLB1 gene or its encoded protein in regulating the wax powder content of cucumber peel, and relates to the field of agricultural biotechnology. The invention finds through screening that the cucumber CsLB1 gene is related to the wax powder content of cucumber peel, and the wax powder content of cucumber mutant peel is significantly reduced compared with the wild type '649'. The gene can be used to screen cucumber fruits with less wax powder and improve the commercial quality traits of cucumber fruits.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology, and in particular to application of a CsLB1 gene or a protein encoded by the gene in regulating the wax powder content of cucumber peel. Background Art

[0002] Cucumber (cucumis sativus L.) is an annual creeping herbaceous plant of the Cucurbitaceae family. Cucumber has the characteristics of high yield and good benefits. It is one of the world's top ten important vegetable crops and one of the main vegetable crops in my country, accounting for about 10% of the country's vegetable area. Cucumber peel wax powder is formed by the trichome cells on the surface of the cucumber fruit, which further divide into the stalk and the granule. After that, the granule cells divide into spherical bodies composed of 6-8 cells full of inclusions (cucumber I type epidermal hairs). When the fruit matures, the inclusions precipitate from the spherical cells and spread on the surface of the peel to form wax powder. Studies have found that the wax powder of cucumber grafted onto high-wax stock easily precipitates inclusions on the surface of the spherical body, while the wax powder of cucumber grafted onto low-wax stock does not precipitate or precipitates less inclusions on the spherical body. There is no silicification layer or the silicification layer is thin. The wax powder is composed of lipophilic compounds and appears as a white frost on the fruit surface ([1] Zhang Xi. Fine positioning and expression analysis of the wax powder gene in Chinese cabbage [D]. Doctoral dissertation of Shenyang Agricultural University, 2013. [2] Hao Jinyu, Luo Feng, Xie Xiaodong, et al. Study on the variation law of wax powder content in different types of sorghum stems [J]. Acta Agriculturae Boreali-Sinica, 2017, 32(2): 157-163.). By analyzing the composition of the wax powder on the surface of cucumber peel, it was found that the main substance of the wax powder layer is SiO2, and the organic components are mainly long-chain fatty acids and their derivatives ([1] Samuels AL, Glass ADM, Ehret DL, et al. The effects of silicon supplementation on cucumber fruit: Changes in surface characteristics [J]. Annals of Botany, 1993, (72): 433-440. [2] Li Zhihong. Effects of environmental conditions on cucumber silicon absorption and distribution and fruit surface wax powder formation [D]. Shandong Agricultural University, 2018.).

[0003] The main factors affecting the wax powder content of cucumber peel are as follows:

[0004] (1) Genetic factors are the main factor affecting the wax content of cucumber peel. The inheritance of wax is a quality trait. The formation of wax and its subsequent retention may be regulated by different genes. The wax-free mutant in the peel may be caused by the blockage of the gene regulating wax synthesis, which in turn leads to the blockage of the pathway for wax synthesis. However, a small amount of wax is still produced.

[0005] (2) The influence of environmental factors on the wax powder content of cucumber peel. The formation of wax powder is closely related to environmental conditions. The amount of wax powder in cucumber peel is high in the high temperature period in summer and low in the low temperature period in spring and autumn.

[0006] (3) Effect of grafted rootstock on wax powder content. The formation of wax powder on cucumber peel is closely related to cucumber variety and grafted rootstock. There are great differences in the occurrence of wax powder on cucumber peel when grafted with different rootstocks. When high-wax cucumber varieties are grafted onto low-wax rootstocks, the amount of wax powder on the cucumber peel surface is significantly reduced, while when grafted onto high-wax rootstocks, the amount of wax powder on the fruit surface is significantly increased. Summary of the invention

[0007] The present invention aims at the above-mentioned deficiencies in the prior art and provides the application of CsLB1 gene or its encoded protein in regulating the wax powder content of cucumber peel and improving the commercial quality traits of cucumber fruit. The wax powder-less mutant cucumber Cslb1 of the present invention is obtained by 2% EMS mutagenesis, and the wax powder content of the peel is significantly less than that of the wild-type cucumber plant.

[0008] The technical solution of the present invention is as follows:

[0009] The invention provides application of a CsLB1 gene or a protein encoded by the gene in regulating the wax powder content of cucumber peel.

[0010] Preferably, the regulating the cucumber peel wax powder content is embodied in reducing the cucumber peel wax powder content.

[0011] Preferably, the nucleotide sequence of the CsLB1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the CsLB1 gene is shown as SEQ ID NO.2.

[0012] The invention also provides a method for cultivating transgenic cucumber plants, and knocking out or silencing the CsLB1 gene in cucumbers.

[0013] Preferably, the nucleotide sequence of the CsLB1 gene is as shown in SEQ ID NO.1.

[0014] A method for cultivating transgenic cucumber plants comprises the following steps:

[0015] (1) constructing a gene knockout or silencing vector, wherein the gene knockout or silencing vector is a plant expression vector having a sequence for knocking out the CsLB1 gene whose base sequence is shown in SEQ ID NO.1;

[0016] (2) Introducing the gene knockout vector of step (1) into cucumber cells, knocking out or silencing the CsLB1 gene with a base sequence as shown in SEQ ID NO.1, and obtaining transgenic cucumber plants after culturing.

[0017] Preferably, the plant expression vector is pCBSG015 (Basta).

[0018] Preferably, the target for gene knockout is a dual target, the sequence is:

[0019] (1)CCAATGTTAAGAAAGGGCCATGG;

[0020] (2)TGTAGTCTCTATGTTAGTATTGG.

[0021] The present invention has found through screening that the cucumber CsLB1 gene is related to the wax content of cucumber peel, and the wax content of cucumber mutant peel is significantly reduced compared with the wild type '649'. The gene can be used to screen cucumber fruits with less wax and improve the commercial quality traits of cucumber fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The figures are the wax powder status of cucumber fruit peel of wild-type plant '649' and mutant 'Cslb1'; a is the wax powder status of cucumber fruit of advanced inbred line plant '649' (WT) and mutant 'Cslb1' 0 days after flowering, b is the wax powder status of cucumber fruit of advanced inbred line plant '649' (WT) and mutant 'Cslb1' 10 days after flowering, and the bar chart shows the relative content of wax powder in fruit peel 10 days after flowering; **p < 0.01.

[0023] Figure 2 These are scanning electron micrographs of WT and Cslb1 mutants; a and b are scanning electron micrographs of wax powder of WT fruit at 0 days after flowering, and c and d are scanning electron micrographs of wax powder of Cslb1 mutant fruit at 0 days after flowering.

[0024] Figure 3 Schematic diagram of gene knockout of CsLB1 gene target and schematic diagram of sequencing detection of Target1 and Target2 in knockout of CsLB1 gene.

[0025] Figure 4The wax powder status of cucumber 'Kate' and cucumber CsLB1#2 strains with different targets of CsLB1 knockout gene. a is the wax powder status of cucumber 'Kate' (KT) and CRISPR knockout 2# strain (CR-KT) fruit 0d flowering, b is the wax powder status of cucumber 'Kate' (KT) and CRISPR knockout 2# strain (CR-KT) fruit 10d flowering, the bar chart shows the relative wax powder content of the two fruits 10d flowering; **p < 0.01.

[0026] Figure 5 These are scanning electron micrographs of cucumber 'Kate' (KT) and CRISPR knockout 2# strain (CR-KT), a and b are KT, and c and d are CR-KT.

[0027] Figure 6 The map of vector pCBSG015 (Basta). DETAILED DESCRIPTION

[0028] Example 1: Discovery of SNP loci related to the wax-less trait in cucumber fruit and phenotypic observation

[0029] The cucumber high-generation inbred line '649' (WT) was induced with 2% EMS mutagen (v / v, ethyl methanesulfonate), and a stable inherited cucumber wax powder less mutant less bloom1 (Cslb1) was obtained from the mutant library ( Figure 1 ). Through multiple generations of self-pollination and obtaining stable inherited mutants, the stable inherited cucumber wax powder mutant 'Cslb1' was crossed with the high-generation inbred wild type '649' (WT) to obtain F1. The F1 generation cucumber plants were self-pollinated and seeds were kept to obtain F2. There were 10 plants in the F1 generation of positive and negative crosses, and 92 plants in the F2 generation segregation population. The phenotype of F1 plants was all wild-type. Among the F2 segregation populations, 21 plants had a wax powder phenotype and 71 plants had a WT wax powder phenotype. According to the chi-square test, the segregation ratio of the wax powder phenotype of WT cucumber fruit and the wax powder phenotype of the wax powder mutant fruit was 3:1 (χ 2=0.1298, P>0.05), indicating that the cucumber wax powder trait is a single gene recessive inheritance (Table 1). The CsLB1 gene on chromosome 2 was located by MutMap and KASP genotyping methods, and the gene sequence is shown in SEQ ID NO.1. The wax powder phenotype of the peel of the wax powder mutant and "649" (WT) plants at 0d and 10d of flowering was observed and photographed. The wax powder amount of the fruit peel of the commercial melon (10d of flowering) on ​​each individual plant was quantitatively measured using a colorimeter (CR-400 / 410) with the wax powder and WT fruits as materials. Measurement method: First, the lightness of the transparent tape was measured as the basic value with a colorimeter, and then the tape was lightly pressed on 5 places of the fruit peel to make the wax powder adhere to the same area of ​​the tape. The tape was removed and pasted on a black board, and the lightness of the wax powder adhesion area was measured. Finally, the lightness difference ΔL (measured value-basic value) was calculated, and the wax powder amount was measured according to the lightness difference. PowerPoint 2010 software was used to perform statistical analysis on the data, and a frequency distribution bar graph was drawn. SPSS statistical software was used to perform significant difference analysis on the measured data. The results are shown in the figure. The wax powder content of the cucumber peel of the mutant 'Cslb1' was significantly less than that of the wild type ( Figure 1 , Figure 2 ).

[0030] Table 1

[0031] Material Total number of plants WT wax powder phenotype Cslbl wax powder phenotype Separation ratio χ2 WT 30 30 Cslb1 30 30 <![CDATA[F1]]> 10 10 <![CDATA[F2]]> 92 71 21 3：1 0.1298

[0032] Example 2: Scanning electron microscopy observation of wax powder in Cslb1 mutant and WT fruits

[0033] The peels of WT and Cslb1 fruits at 0 days after flowering were used as materials, rinsed with tap water, and cut into small pieces of about 0.5-1 cm long with a thin blade. The above materials were placed in a special fixative for electron microscopy for 12 hours, then taken out and dried, and after high-pressure vacuum and gold spraying on the peels, the peel wax powder content and morphology were observed under a JSM-6380LV scanning electron microscope. The results showed that the surface of WT peel contained an obvious wax powder layer, most of which was attached to the surface of cucumber type I trichomes, while the surface of mutant peel type I trichomes was smooth and had no wax powder layer ( Figure 2 ).

[0034] Example 3: CsLB1 gene CRISPR vector transformation of cucumber

[0035] We commissioned Weimi Biotechnology (Jiangsu) Co., Ltd. to design dual targets for CsLB1 gene knockout.

[0036] One: CCAATGTTAAGAAAGGGCCATGG;

[0037] Second: TGTAGTCTCTATGTTAGTATTGG;

[0038] and transferred into the vector pCBSG015 (Basta) (see the map for details) Figure 6 ) to construct the CsLB1-CRISPR vector. The successfully constructed vector was selected and genetically transformed into cucumber variety 'Kate' (KT) (Shouguang Kate Seed Co., Ltd.). The successfully transformed plants had a mutation at the CsLB1 gene target site ( Figure 3 After the above gene-edited cucumber plants were planted, the wax powder phenotypes of the fruit peel of the edited plants and the control plants KT at 0d and 10d after flowering were observed and photographed ( Figure 4 ), using gene-edited plants and KT plants as materials, a colorimeter (CR-400 / 410) was used to quantitatively measure the amount of wax powder on commercial melons (10 days after flowering) on ​​each individual plant. First, the lightness of the transparent tape was measured as the basic value using a colorimeter, and then the tape was used to lightly press 5 locations on the surface of the fruit peel to be tested so that the wax powder adhered to the same area of ​​the tape. The tape was removed and pasted on a black board, and the lightness of the wax powder adhesion area was measured. Finally, the lightness difference ΔL (measured value-basic value) was calculated, and the amount of wax powder was measured based on the lightness difference. PowerPoint 2010 software was used to perform statistical analysis on the data, and a frequency distribution bar graph was drawn. SPSS data statistical software was used to perform a significant difference analysis on the measured data. A Hitachi JSM-6380LV scanning electron microscope was used to take pictures of the fruit surface at 0 days after flowering. The results showed that the wax powder content in the fruit peel of cucumbers (CR-KT) after CsLB1 gene knockout was significantly less than that of the control (KT) ( Figure 4 , Figure 5 ).

Claims

1. Application of knocking out or silencing the CsLB1 gene or the protein encoded by it in reducing the wax powder content of cucumber peel, wherein the nucleotide sequence of the CsLB1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the CsLB1 gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The method for reducing the wax powder content of cucumber peel comprises the following steps: (1) constructing a gene knockout or silencing vector, wherein the gene knockout or silencing vector is a plant expression vector having a sequence for knocking out the CsLB1 gene whose base sequence is shown in SEQ ID NO.1; (2) Introducing the gene knockout vector of step (1) into cucumber cells, knocking out or silencing the CsLB1 gene with a base sequence as shown in SEQ ID NO.1, and obtaining transgenic cucumber plants after culturing.

3. The use according to claim 2, characterized in that The plant expression vector is pCBSG015 (Basta).

4. The method according to claim 2, characterized in that The target of gene knockout is dual target, the sequence is: (1)CCAATGTTAAGAAAGGGCCATGG; (2)TGTAGTCTCTATGTTAGTATTGG.

Images