A fluorescent probe primer for pig five bodies, a kit and application thereof

Abstract

The application discloses a fluorescent probe primer, a kit and application of the fluorescent probe primer for five bodies of pigs, wherein the five bodies of pigs include porcine rickettsia, porcine chlamydia, mycoplasma hyopneumoniae, toxoplasma and leptospira. The application selects the conserved sequences of porcine rickettsia ORF5 genes, porcine chlamydia glgp genes, mycoplasma hyopneumoniae P95 genes, toxoplasma B1 genes and leptospira CLPS genes to design probe primers, the kit can simultaneously analyze a large number of samples, and whether the samples contain mycoplasma hyopneumoniae, chlamydia, rickettsia, toxoplasma and leptospira can be identified at one time, and the kit has the characteristics of simplicity, rapidness, good stability, high sensitivity and strong specificity.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological molecules, in particular to a fluorescent probe primer for pig five-body, a kit and application thereof. BACKGROUND

[0002] Among various diseases of pig breeding, five-body infection frequently occurs, and if not monitored and treated in time, a large number of pig groups will be infected, causing serious economic losses. The five-body refers to porcine rickettsia, toxoplasma, chlamydia, leptospira and mycoplasma. The first four bodies have a serious impact on the reproductive performance of sows, and can cause abortion, premature delivery, stillbirth, weak fetus, new-born piglet disease, postpartum sow no milk, less milk and the like, seriously affecting the reproductive performance of sows and the production results of pig farms.

[0003] Rickettsia is parasitic on the surface of pig red blood cells, free in the plasma and bone marrow, and causes a disease characterized by fever, anemia and jaundice in piglets, abortion in sows and the like.

[0004] Chlamydia spp. is a kind of microorganism parasitic in cells, between bacteria and viruses. Chlamydia is gram-negative, has ribosomes and cell walls, and contains DNA and RNA nucleic acids. Chlamydia is mainly related to subclinical infection of pigs, but can also cause respiratory diseases, diarrhea, conjunctivitis and reproductive disorders.

[0005] Mycoplasmal pneumonia of pigs (Mhp) is the main pathogen causing mycoplasmal pneumonia of pigs (MPS), and the disease is characterized by contact, high infectivity, high morbidity and low mortality, mainly showing cough and dyspnea, and the main harm is to cause growth inhibition and serious reduction of feed conversion rate of pigs, and is prone to secondary infection of other pathogens and induction of chronic pneumonia.

[0006] Toxoplasma gondii is a pathogenic parasitic worm causing swine toxoplasmosis, and is a protozoan disease caused by invasion of Toxoplasma gondii into the body of pigs, which is a parasitic disease of human and animal co-infection, and is characterized by high fever, respiratory and neurological symptoms, death, abortion of pregnant sows, fetal deformity and death. In recent years, "unexplained high fever" disease pigs have been found in many places in our county, and it is proved that they are mainly caused by toxoplasma infection.

[0007] Swine leptospira disease is caused by leptospira infection, and is a natural epidemic infectious disease of human and animal co-infection. At the beginning of the disease, the body temperature rises, the feed intake decreases, the urine is dark tea or red urine with a large amount of blood, and the body gradually becomes emaciated. After the infected sows are impregnated, they may cause abortion, and the fetuses flowing out are dead or mummified fetuses.

[0008] Five body infection is a common phenomenon in pig farms, especially the infection rate of swine rickettsia, mycoplasma is almost 100%, the infection rate of chlamydia is about 60%, the carrier rate of toxoplasma and spirochete is also relatively high. Therefore, the pig population is in a state of sub-health for a long time, and various stress reactions occur when the temperature changes, the environment of the pig house is poor, and the defense function of the pig itself is low. Therefore, it is necessary to regularly monitor the infection of the five pathogens and the content of the pathogens in the environment, reduce the content of the pathogens in time, improve the immunity and disease resistance of the pig population, and take comprehensive prevention and control measures to fundamentally solve the problem of five body infection of sows. Improve the reproductive performance of sows and achieve good production results.

[0009] However, there is no commercial detection kit for rapid detection of five body disease at present, so it is urgent to develop a fluorescence quantitative PCR commercial kit that meets the current epidemic trend and can rapidly and efficiently detect and identify the above five pathogens. SUMMARY

[0010] The purpose of the present application is to overcome the defects of the prior art and provide a pig five body fluorescence probe primer, kit and application, wherein the pig five body includes swine rickettsia, swine chlamydia, swine mycoplasma pneumonia, toxoplasma and swine leptospira. The probe primer is designed according to the conserved sequences of swine rickettsia ORF5 gene, swine chlamydia glgp gene, swine mycoplasma pneumonia P95 gene, toxoplasma B1 gene and leptospira CLPS gene. The kit can simultaneously analyze a large number of samples, and can identify whether the sample contains swine mycoplasma pneumonia, chlamydia, rickettsia, toxoplasma and leptospira at one time. It has the characteristics of simple and fast, good stability, high sensitivity and strong specificity.

[0011] The purpose of the present application can be realized by the following technical solutions:

[0012] The first purpose of the present application is to provide a primer probe set for detecting swine rickettsia ORF5 gene, which comprises:

[0013] The upstream primer EPE-F is 5'-TGGGCAGAGATTGCTGGC-3';

[0014] The downstream primer EPE-R is 5'-TTTTAGGGGTGGGGTGGA-3';

[0015] The fluorescence probe primer EPE-P is 5'-CCAGGCACCCCTGAAACCTGGTGCG-3', wherein a reporter group FAM is added to the 5' end, and a quenching group BHQ1 is added to the 3' end;

[0016] The target sequence of the primer probe set of the ORF5 gene is:

[0017] TGGGCAGAGATTGCTGGCCAGGCACCCCTGAAACCTGGTGCGGAGGATT CCAAGCCTGAAGCCGTCCCTTCCTCCATCCACCCCACCCCTAAAA.

[0018] A second object of the present application is to provide a primer probe set for detecting the glgp gene of Chlamydia suis, which comprises:

[0019] The upstream primer CS-F is 5'-CAGGAATGCCGAGAGTTG-3';

[0020] The downstream primer CS-R is 5'-CTTGGAAATGGGGGGTTA-3';

[0021] The fluorescent probe primer CS-P is 5'-CCATAGAATCAAGAAAACATGCTGCT-3', wherein a reporter group HEX is added to the 5' end and a quencher group BHQ1 is added to the 3' end.

[0022] The target sequence of the primer probe set of the glgp gene is:

[0023] CAGGAATGCCGAGAGTTGCCATAGAATCAAGAAAACATGCTGCTAATCGACCTAACCCCCCATTTCCAAG.

[0024] A third object of the present application is to provide a primer probe set for detecting the P95 gene of Mycoplasma hyopneumoniae, which comprises:

[0025] The upstream primer MPS-F is 5'-TCAGGTTGTTTTTTCAGAGC-3';

[0026] The downstream primer MPS-R is 5'-TAAATTTCCCCCAGTCATTA-3';

[0027] The fluorescent probe primer MPS-P is 5'-CTTCAGCAGAGGTAAAATTACTATCAGC-3', wherein a reporter group CY5 is added to the 5' end and a quencher group BHQ2 is added to the 3' end.

[0028] The target sequence of the primer probe set of the P95 gene is:

[0029] TCAGGTTGTTTTTTCAGAGCTTCAGCAGAGGTAAAATTACTATCAGCAAG CTCTAATTTCAGTAATGACTGGGGGAAATTTA.

[0030] A fourth object of the present application is to provide a primer probe set for detecting the Toxoplasma B1 gene, the primer probe set comprising:

[0031] an upstream primer TP-F: 5'-AACATTCTTGTGCTGCCT-3';

[0032] a downstream primer TP-R: 5'-TTTCACCTGTATTTGCCA-3';

[0033] a fluorescent probe primer TP-P: 5'-TCCTCTCATGGCAAATGCCAGAAGAAGG-3', wherein a reporter group ROX is added to the 5' end and a quencher group BHQ2 is added to the 3' end;

[0034] The target sequence of the primer probe set for the B1 gene is:

[0035] AACATTCTTGTGCTGCCTCCTCTCATGGCAAATGCCAGAAGAAGGGTAC GTGTTGCATCATAACAAGAGCTGTATTTCCCGCTGGCAAATACAGGTGAAA.

[0036] A fifth object of the present application is to provide a primer probe set for detecting the Leptospira CLPS gene, the primer probe set comprising:

[0037] an upstream primer LEP-F: 5'-CACAAACTCCAGACCTAAA-3';

[0038] a downstream primer LEP-R: 5'-AGTATGTTCGTTATCGTCC-3';

[0039] a fluorescent probe primer LEP-P: 5'-ATGAAATTACTGAGGAGTCCACGAAATC-3', wherein a reporter group CY3 is added to the 5' end and a quencher group BHQ2 is added to the 3' end;

[0040] The target sequence of the primer probe set for the CLPS gene is:

[0041] CACAAACTCCAGACCTAAATGAAATTACTGAGGAGTCCACGAAATCAAC GGGAGGACCTTGGAGAGTTGTACTTTGGGACGATAACGAACATACT.

[0042] A sixth object of the present application is to provide a kit comprising a negative control, a positive control, a primer premix, a probe premix, a PCR amplification solution;

[0043] The primer premix comprises a premix of EPE-F, EPE-R, CS-F, CS-R, MPS-F, MPS-R, TP-F, TP-R, LEP-F, LEP-R at an initial concentration of 10 μM at a molar ratio of 1:1:1:1:1:1:1:1:1:1,

[0044] EPE-F: 5'-TGGGCAGAGATTGCTGGC-3',

[0045] EPE-R: 5'-TTTTAGGGGTGGGGTGGA-3',

[0046] CS-F: 5'-CAGGAATGCCGAGAGTTG-3',

[0047] CS-R: 5'-CTTGGAAATGGGGGGTTA-3',

[0048] MPS-F: 5'-TCAGGTTGTTTTTTCAGAGC-3',

[0049] MPS-R: 5'-TAAATTTCCCCCAGTCATTA-3',

[0050] TP-F: 5'-AACATTCTTGTGCTGCCT-3',

[0051] TP-R: 5'-TTTCACCTGTATTTGCCA-3',

[0052] LEP-F: 5'-CACAAACTCCAGACCTAAA-3',

[0053] LEP-R: 5'-AGTATGTTCGTTATCGTCC-3';

[0054] The probe premix comprises a premix of EPE-P, CS-P, MPS-P, TP-P, LEP-P at an initial concentration of 10 μM at a molar ratio of 1:1:1:1:1,

[0055] EPE-P: 5'-CCAGGCACCCCTGAAACCTGGTGCG-3', wherein a reporter group FAM is added to the 5' end and a quencher group BHQ1 is added to the 3' end,

[0056] CS-P: 5'-CCATAGAATCAAGAAAACATGCTGCT-3', wherein a reporter group HEX is added to the 5' end and a quencher group BHQ1 is added to the 3' end,

[0057] MPS-P: 5'-CTTCAGCAGAGGTAAAATTACTATCAGC-3', wherein a reporter group CY5 is added to the 5' end and a quencher group BHQ2 is added to the 3' end,

[0058] TP-P: 5'-TCCTCTCATGGCAAATGCCAGAAGAAGG-3', wherein a reporter group ROX is added to the 5' end and a quencher group BHQ2 is added to the 3' end,

[0059] LEP-P: 5'-ATGAAATTACTGAGGAGTCCACGAAATC-3', wherein a reporter group CY3 is added to the 5' end and a quencher group BHQ2 is added to the 3' end;

[0060] The positive control is a recombinant plasmid containing the ORF5 gene, the glgp gene, the P95 gene, the B1 gene and the CLPS target gene fragment;

[0061] The negative control is double distilled water;

[0062] The PCR amplification solution is 2x Animal Detection Probe Master Mix produced by Nanjing Novozyme Bio-tech Co., Ltd.

[0063] A seventh object of the present application is to provide an application of the above-mentioned kit, which specifically comprises the following steps:

[0064] (1) extracting total DNA of a sample to be tested for standby use;

[0065] (2) using the total DNA obtained in step (1) as a template, performing fluorescent amplification using the fluorescent reaction system configured by the kit as an experimental group; using the negative control as a template, performing fluorescent amplification using the fluorescent reaction system configured by the kit as a negative control group; using the positive control as a template, performing fluorescent amplification using the fluorescent reaction system configured by the kit as a positive control group;

[0066] (3) determining whether the sample to be tested is positive or negative for porcine rickettsia, porcine chlamydia, mycoplasma hyopneumoniae, toxoplasma and / or leptospira nucleic acid according to the results of the fluorescent amplification reaction in step (2).

[0067] In one embodiment of the present application, in step (2), the experimental group includes 5 μL of total DNA sample, 6 μL of primer premix (400 nM), 1.5 μL of probe premix (100 nM), and 12.5 μL of PCR amplification solution, based on the total volume of 25 μL of the fluorescent reaction system;

[0068] The negative control group includes 6 μL of primer premix, 1.5 μL of probe premix, 12.5 μL of PCR amplification solution, and 5 μL of RNase free H2O.

[0069] The positive control group includes 5 μL of recombinant plasmid containing the gene fragments of ORF5, glgp, P95, B1, and CLPS, 6 μL of primer premix, 1.5 μL of probe premix, and 12.5 μL of PCR amplification solution.

[0070] In one embodiment of the present application, the primer premix includes a premix with an initial concentration of 10 μM of EPE-F, EPE-R, CS-F, CS-R, MPS-F, MPS-R, TP-F, TP-R, LEP-F, and LEP-R at a molar ratio of 1:1:1:1:1:1:1:1:1:1.

[0071] The probe premix includes a premix with an initial concentration of 10 μM of EPE-P, CS-P, MPS-P, TP-P, and LEP-P at a molar ratio of 1:1:1:1:1.

[0072] In one embodiment of the present application, in step (2), the reaction procedure of the fluorescent amplification is as follows: 37 °C for 2 min, 95 °C for 30 s, 95 °C for 10 s, and 58 °C for 30 s (collecting fluorescence signal) for a total of 45 cycles, and a total of 5 fluorescence channels, which are reporter group “FAM”, quencher group “BHQ1”, reporter group “HEX”, quencher group “BHQ1”, reporter group “Cy5”, quencher group “BHQ2”, reporter group “ROX”, quencher group “BHQ2”, reporter group “Cy3”, and quencher group “BHQ2”, respectively.

[0073] In one embodiment of the present application, in step (3), the results are determined as follows: the Ct value of the positive control is < 30 and a specific S-shaped amplification curve appears, the Ct value of the negative control is not present and no specific amplification curve appears, and both conditions are met to determine that the experimental results are correct.

[0074] (1) Ct value of the sample in FAM channel is ≤35 and specific S-shaped amplification curve appears, it is judged that the nucleic acid of porcine rickettsia is positive; no Ct value and no specific amplification curve, it is judged that the nucleic acid of porcine rickettsia is negative; 35 < CT value < 45 and specific amplification curve appears, it is judged that the nucleic acid of porcine rickettsia is suspicious, the suspicious sample needs to be re-sampled to extract DNA and recheck, Ct value < 45 is judged to be positive, otherwise it is judged to be negative;

[0075] (2) Ct value of the sample in HEX channel is ≤35 and specific S-shaped amplification curve appears, it is judged that the nucleic acid of porcine chlamydia is positive; no Ct value and no specific amplification curve, it is judged that the nucleic acid of porcine chlamydia is negative; 35 < CT value < 45 and specific amplification curve appears, it is judged that the nucleic acid of porcine chlamydia is suspicious, the suspicious sample needs to be re-sampled to extract DNA and recheck, Ct value < 45 is judged to be positive, otherwise it is judged to be negative;

[0076] (3) Ct value of the sample in Cy5 channel is ≤35 and specific S-shaped amplification curve appears, it is judged that the nucleic acid of porcine mycoplasma pneumoniae is positive; no Ct value and no specific amplification curve, it is judged that the nucleic acid of porcine mycoplasma pneumoniae is negative; 35 < CT value < 45 and specific amplification curve appears, it is judged that the nucleic acid of porcine mycoplasma pneumoniae is suspicious, the suspicious sample needs to be re-sampled to extract DNA and recheck, Ct value < 45 is judged to be positive, otherwise it is judged to be negative;

[0077] (4) Ct value of the sample in ROX channel is ≤35 and specific S-shaped amplification curve appears, it is judged that the nucleic acid of toxoplasma gondii is positive; no Ct value and no specific amplification curve, it is judged that the nucleic acid of toxoplasma gondii is negative; 35 < CT value < 45 and specific amplification curve appears, it is judged that the nucleic acid of toxoplasma gondii is suspicious, the suspicious sample needs to be re-sampled to extract DNA and recheck, Ct value < 45 is judged to be positive, otherwise it is judged to be negative;

[0078] (5) Ct value of the sample in Cy3 channel is ≤35 and specific S-shaped amplification curve appears, it is judged that the nucleic acid of porcine leptospira is positive; no Ct value and no specific amplification curve, it is judged that the nucleic acid of porcine leptospira is negative; 35 < CT value < 45 and specific amplification curve appears, it is judged that the nucleic acid of porcine leptospira is suspicious, the suspicious sample needs to be re-sampled to extract DNA and recheck, Ct value < 45 is judged to be positive, otherwise it is judged to be negative.

[0079] In the present application, the Ct value is the cycle number corresponding to the inflection point from the baseline to the exponential growth.

[0080] In one embodiment of the present application, the positive control is a positive standard with a concentration of 10 4 copies / μL.

[0081] In one embodiment of the present application, the above kit is also applied to environmental sample detection.

[0082] Compared with the prior art, the present application has the following advantages:

[0083] 1) The genome of swine rickettsia, swine chlamydia, mycoplasma hyopneumoniae, toxoplasma, and leptospira is 100000-2000000bp, the genome is large and the related research is less, by homology comparison of virulence protein genes, the conservative gene sequence is selected for the design of probe primers, and according to the gene sequence analysis, the conservative regions of EPE ORF5 gene, CS glgp gene, MPS P95 gene, TP B1 gene and LEP CLPS gene are selected for the design of fluorescent probe primers.

[0084] 2) The five-fold fluorescence quantitative experiment is to amplify five target genes in one reaction tube for quantitative experiment, so the amplification of the five target genes will inevitably affect each other, so the synchronization amplification efficiency is optimized by primer design and reaction condition, instead of simply mixing all primers and templates in the same reaction tube. Since EPE, CS, MPS, TP and LEP are five different pathogens, according to the specific infection condition, the concentrations of the five pathogens in the co-infected sample may differ in different degrees, and when amplification is performed in the same reaction tube, if the amplification efficiency of one pathogen gene is too high, the amplification of other pathogen genes may be inhibited, which finally affects the detection rate of the pathogen; in the present application, five pairs of probe primers are designed in the highly conservative sequences of the five pathogens, and the probe primers with higher sensitivity and similar amplification efficiency are matched by experiment for multiple fluorescence quantitative PCR experiment, which is difficult and the result is not easy to control, and needs to be performed for multiple times; at the same time, by adjusting the ratio of primers and fluorescent probes, the reaction condition is optimized, so that the amplification efficiency of the five pathogen genes in the sample is consistent, and the sensitivity of each single reaction is consistent.

[0085] 3) The specificity of the present application is strong, and there is no non-specific amplification curve for swine fever virus, porcine circovirus, porcine pseudorabies virus, porcine blue ear virus, porcine parvovirus and porcine encephalitis virus, which ensures the accuracy of detection.

[0086] 4) The present application can simultaneously analyze a large number of samples, and after one detection operation, whether the sample contains swine rickettsia, swine chlamydia, mycoplasma hyopneumoniae, toxoplasma and leptospira, the five domestic prevalent pathogens causing sub-health of pig population, has the characteristics of high sensitivity, strong specificity and good repeatability. BRIEF DESCRIPTION OF DRAWINGS

[0087] Figure 1 is the fluorescence amplification curve of the African swine fever virus EPE gene;

[0088] Figure 2is a standard curve diagram of the EPE gene of African swine fever virus;

[0089] Figure 3 is a fluorescence amplification curve diagram of the CS gene of African swine fever virus;

[0090] Figure 4 is a standard curve diagram of the CS gene of African swine fever virus;

[0091] Figure 5 is a fluorescence amplification curve diagram of the MPS gene of African swine fever virus;

[0092] Figure 6 is a standard curve diagram of the MPS gene of African swine fever virus;

[0093] Figure 7 is a fluorescence amplification curve diagram of the TP gene of African swine fever vaccine strain;

[0094] Figure 8 is a standard curve diagram of the TP gene of African swine fever vaccine strain;

[0095] Figure 9 is a fluorescence amplification curve diagram of the LEP gene of African swine fever vaccine strain;

[0096] Figure 10 is a standard curve diagram of the LEP gene of African swine fever vaccine strain;

[0097] Figure 11 is a fluorescence amplification curve diagram obtained by specificity experiment. DETAILED DESCRIPTION

[0098] The present application will be described in detail below in conjunction with the accompanying drawings and specific examples.

[0099] A first object of the present application is to provide a primer probe set for detecting the ORF5 gene of porcine rickettsia, which comprises:

[0100] an upstream primer EPE-F: 5'-TGGGCAGAGATTGCTGGC-3' (the sequence is shown as SEQ ID NO. 1);

[0101] a downstream primer EPE-R: 5'-TTTTAGGGGTGGGGTGGA-3' (the sequence is shown as SEQ ID NO. 2);

[0102] a fluorescence probe primer EPE-P: 5'-CCAGGCACCCCTGAAACCTGGTGCG-3' (the sequence is shown as SEQ ID NO. 3), wherein a reporter group FAM is added at the 5' end and a quencher group BHQ1 is added at the 3' end;

[0103] The target sequence of the primer probe set of the ORF5 gene is:

[0104] TGGGCAGAGATTGCTGGCCAGGCACCCCTGAAACCTGGTGCGGAGGATT CCAAGCCTGAAGCCGTCCCTTCCTCCATCCACCCCACCCCTAAAA (the sequence is shown as SEQ ID NO. 4).

[0105] A second object of the present application is to provide a primer probe set for detecting the glgp gene of Chlamydia suis, which comprises:

[0106] The upstream primer CS-F is 5'-CAGGAATGCCGAGAGTTG-3' (the sequence is shown as SEQ ID NO. 5);

[0107] The downstream primer CS-R is 5'-CTTGGAAATGGGGGGTTA-3' (the sequence is shown as SEQ ID NO. 6);

[0108] The fluorescent probe primer CS-P is 5'-CCATAGAATCAAGAAAACATGCTGCT-3' (the sequence is shown as SEQ ID NO. 7), wherein a reporter group HEX is added at the 5' end and a quencher group BHQ1 is added at the 3' end;

[0109] The target sequence of the primer probe set of the glgp gene is:

[0110] CAGGAATGCCGAGAGTTGCCATAGAATCAAGAAAACATGCTGCTAATCGACCTAACCCCCCATTTCCAAG (the sequence is shown as SEQ ID NO. 8).

[0111] A third object of the present application is to provide a primer probe set for detecting the P95 gene of Mycoplasma hyopneumoniae, which comprises:

[0112] The upstream primer MPS-F is 5'-TCAGGTTGTTTTTTCAGAGC-3' (the sequence is shown as SEQ ID NO. 9);

[0113] The downstream primer MPS-R is 5'-TAAATTTCCCCCAGTCATTA-3' (the sequence is shown as SEQ ID NO. 10);

[0114] The fluorescent probe primer MPS-P: 5'-CTTCAGCAGAGGTAAAATTACTATCAGC-3' (the sequence is shown as SEQ ID NO. 11), wherein a reporter group CY5 is added at the 5' end, and a quencher group BHQ2 is added at the 3' end; the target sequence of the primer probe set of the P95 gene is:

[0115] TCAGGTTGTTTTTTCAGAGCTTCAGCAGAGGTAAAATTACTATCAGCAAG CTCTAATTTCAGTAATGACTGGGGGAAATTTA (the sequence is shown as SEQ ID NO. 12).

[0116] A fourth object of the present application is to provide a primer probe set for detecting the Toxoplasma B1 gene, which comprises:

[0117] The upstream primer TP-F: 5'-AACATTCTTGTGCTGCCT-3' (the sequence is shown as SEQ ID NO. 13);

[0118] The downstream primer TP-R: 5'-TTTCACCTGTATTTGCCA-3' (the sequence is shown as SEQ ID NO. 14);

[0119] The fluorescent probe primer TP-P: 5'-TCCTCTCATGGCAAATGCCAGAAGAAGG-3' (the sequence is shown as SEQ ID NO. 15), wherein a reporter group ROX is added at the 5' end, and a quencher group BHQ2 is added at the 3' end;

[0120] The target sequence of the primer probe set of the B1 gene is:

[0121] AACATTCTTGTGCTGCCTCCTCTCATGGCAAATGCCAGAAGAAGGGTAC GTGTTGCATCATAACAAGAGCTGTATTTCCCGCTGGCAAATACAGGTGAAA (the sequence is shown as SEQ ID NO. 16).

[0122] A fifth object of the present application is to provide a primer probe set for detecting the Leptospira CLPS gene, which comprises:

[0123] The upstream primer LEP-F: 5'-CACAAACTCCAGACCTAAA-3' (the sequence is shown as SEQ ID NO. 17);

[0124] Downstream primer LEP-R: 5'-AGTATGTTCGTTATCGTCC-3' (sequence as shown in SEQ ID NO. 18);

[0125] Fluorescent probe primer LEP-P: 5'-ATGAAATTACTGAGGAGTCCACGAAATC-3' (sequence as shown in SEQ ID NO. 19), wherein a reporter group CY3 is added to the 5' end and a quencher group BHQ2 is added to the 3' end;

[0126] The primer probe set of the CLPS gene has the following target sequence:

[0127] CACAAACTCCAGACCTAAATGAAATTACTGAGGAGTCCACGAAATCAAC GGGAGGACCTTGGAGAGTTGTACTTTGGGACGATAACGAACATACT (sequence as shown in SEQ ID NO. 20).

[0128] A sixth object of the present application is to provide a kit comprising a negative control, a positive control, a primer premix, a probe premix, a PCR amplification solution;

[0129] The primer premix has an initial concentration of 10 μM of EPE-F, EPE-R, CS-F, CS-R, MPS-F, MPS-R, TP-F, TP-R, LEP-F, LEP-R in a molar ratio of 1:1:1:1:1:1:1:1:1:1,

[0130] EPE-F: 5'-TGGGCAGAGATTGCTGGC-3' (sequence as shown in SEQ ID NO. 1),

[0131] EPE-R: 5'-TTTTAGGGGTGGGGTGGA-3' (sequence as shown in SEQ ID NO. 2),

[0132] CS-F: 5'-CAGGAATGCCGAGAGTTG-3' (sequence as shown in SEQ ID NO. 5),

[0133] CS-R: 5'-CTTGGAAATGGGGGGTTA-3' (sequence as shown in SEQ ID NO. 6),

[0134] MPS-F: 5'-TCAGGTTGTTTTTTCAGAGC-3' (sequence as shown in SEQ ID NO. 9),

[0135] MPS-R: 5'-TAAATTTCCCCCAGTCATTA-3' (the sequence is shown as SEQ ID NO. 10),

[0136] TP-F: 5'-AACATTCTTGTGCTGCCT-3' (the sequence is shown as SEQ ID NO. 13),

[0137] TP-R: 5'-TTTCACCTGTATTTGCCA-3' (the sequence is shown as SEQ ID NO. 14),

[0138] LEP-F: 5'-CACAAACTCCAGACCTAAA-3' (the sequence is shown as SEQ ID NO. 17), LEP-R: 5'-AGTATGTTCGTTATCGTCC-3' (the sequence is shown as SEQ ID NO. 18);

[0139] The probe premix solution comprises a premix solution with an initial concentration of 10 μM of EPE-P, CS-P, MPS-P, TP-P, LEP-P in a molar ratio of 1:1:1:1:1,

[0140] EPE-P: 5'-CCAGGCACCCCTGAAACCTGGTGCG-3' (the sequence is shown as SEQ ID NO. 3), wherein a reporter group FAM is added to the 5' end and a quencher group BHQ1 is added to the 3' end,

[0141] CS-P: 5'-CCATAGAATCAAGAAAACATGCTGCT-3' (the sequence is shown as SEQ ID NO. 7), wherein a reporter group HEX is added to the 5' end and a quencher group BHQ1 is added to the 3' end,

[0142] MPS-P: 5'-CTTCAGCAGAGGTAAAATTACTATCAGC-3' (the sequence is shown as SEQ ID NO. 11), wherein a reporter group CY5 is added to the 5' end and a quencher group BHQ2 is added to the 3' end,

[0143] TP-P: 5'-TCCTCTCATGGCAAATGCCAGAAGAAGG-3' (the sequence is shown as SEQ ID NO. 15), wherein a reporter group ROX is added to the 5' end and a quencher group BHQ2 is added to the 3' end,

[0144] LEP-P: 5'-ATGAAATTACTGAGGAGTCCACGAAATC-3' (the sequence is shown as SEQ ID NO. 19), wherein a reporter group CY3 is added to the 5' end and a quencher group BHQ2 is added to the 3' end;

[0145] The positive control is a recombinant plasmid containing the gene fragments of ORF5, glgp, P95, B1 and CLPS;

[0146] The negative control is double distilled water;

[0147] The PCR amplification solution is 2x Animal Detection Probe Master Mix produced by Nanjing Novozyme Bio-tech Co., Ltd.

[0148] A seventh object of the present application is to provide an application of the above-mentioned kit, which specifically comprises the following steps:

[0149] (1) Extracting total DNA of the sample to be tested for standby;

[0150] (2) Using the total DNA obtained in step (1) as a template, using the kit to configure a fluorescent reaction system to perform fluorescent amplification as an experimental group; using the negative control as a template, using the kit to configure a fluorescent reaction system to perform fluorescent amplification as a negative control group; using the positive control as a template, using the kit to configure a fluorescent reaction system to perform fluorescent amplification as a positive control group;

[0151] (3) According to the fluorescent amplification reaction results of step (2), determining whether the sample to be tested is positive or negative for porcine rickettsia, porcine chlamydia, porcine mycoplasma pneumoniae, toxoplasma and / or porcine leptospira nucleic acid.

[0152] In an embodiment of the present application, in step (2), the experimental group includes 5 μL of sample total DNA, 6 μL of primer premix (400 nM), 1.5 μL of probe premix (100 nM), and 12.5 μL of PCR amplification solution, with a total volume of 25 μL of the fluorescent reaction system;

[0153] The negative control group includes 6 μL of primer premix, 1.5 μL of probe premix, 12.5 μL of PCR amplification solution, and 5 μL of RNase-free H2O;

[0154] The positive control group includes 5 μL of recombinant plasmid containing the gene fragments of ORF5, glgp, P95, B1 and CLPS, 6 μL of primer premix, 1.5 μL of probe premix, and 12.5 μL of PCR amplification solution.

[0155] In an embodiment of the present application, the primer premix includes a premix with an initial concentration of 10 μM of EPE-F, EPE-R, CS-F, CS-R, MPS-F, MPS-R, TP-F, TP-R, LEP-F, LEP-R at a molar ratio of 1:1:1:1:1:1:1:1:1:1;

[0156] The probe premix solution comprises a premix solution of EPE-P, CS-P, MPS-P, TP-P, and LEP-P at an initial concentration of 10 μM and a molar ratio of 1:1:1:1:1.

[0157] In one embodiment of the present application, in step (2), the reaction procedure of the fluorescence amplification is specifically as follows: 37°C for 2 min, 95°C for 30 s, and 95°C for 10 s and 58°C for 30 s (fluorescence signal acquisition) for 45 cycles, and 5 fluorescence channels, respectively, being a reporter group "FAM", a quencher group "BHQ1", a reporter group "HEX", a quencher group "BHQ1", a reporter group "Cy5", a quencher group "BHQ2", a reporter group "ROX", a quencher group "BHQ2", a reporter group "Cy3", and a quencher group "BHQ2".

[0158] In one embodiment of the present application, in step (3), the result determination is as follows: the Ct value of the five channels of the positive control is < 30 and a specific S-shaped amplification curve appears, the Ct value of the negative control is null and no specific amplification curve appears, and both of them are true, so that the experimental result is determined to be true.

[0159] (1) The Ct value of the FAM channel of the sample to be detected is ≤ 35 and a specific S-shaped amplification curve appears, the sample is determined to be positive for the nucleic acid of swine rickettsia; the Ct value is null and no specific amplification curve appears, the sample is determined to be negative for the nucleic acid of swine rickettsia; 35 < CT value < 45 and a specific amplification curve appears, the sample is determined to be suspicious for the nucleic acid of swine rickettsia, the suspicious sample needs to be re-sampled to extract DNA and re-inspected, the Ct value < 45 is determined to be positive, otherwise, it is determined to be negative;

[0160] (2) The Ct value of the HEX channel of the sample to be detected is ≤ 35 and a specific S-shaped amplification curve appears, the sample is determined to be positive for the nucleic acid of swine chlamydia; the Ct value is null and no specific amplification curve appears, the sample is determined to be negative for the nucleic acid of swine chlamydia; 35 < CT value < 45 and a specific amplification curve appears, the sample is determined to be suspicious for the nucleic acid of swine chlamydia, the suspicious sample needs to be re-sampled to extract DNA and re-inspected, the Ct value < 45 is determined to be positive, otherwise, it is determined to be negative;

[0161] (3) The Ct value of the Cy5 channel of the sample to be detected is ≤ 35 and a specific S-shaped amplification curve appears, the sample is determined to be positive for the nucleic acid of swine mycoplasma pneumoniae; the Ct value is null and no specific amplification curve appears, the sample is determined to be negative for the nucleic acid of swine mycoplasma pneumoniae; 35 < CT value < 45 and a specific amplification curve appears, the sample is determined to be suspicious for the nucleic acid of swine mycoplasma pneumoniae, the suspicious sample needs to be re-sampled to extract DNA and re-inspected, the Ct value < 45 is determined to be positive, otherwise, it is determined to be negative;

[0162] (4) Ct value of the sample in ROX channel is less than or equal to 35 and specific S-shaped amplification curve appears, the sample is judged as positive; no Ct value and no specific amplification curve, the sample is judged as negative; 35 < CT value < 45 and specific amplification curve appears, the sample is judged as suspicious, the suspicious sample needs to be re-sampled to extract DNA and re-inspected, Ct value < 45 is judged as positive, otherwise, it is judged as negative;

[0163] (5) Ct value of the sample in Cy3 channel is less than or equal to 35 and specific S-shaped amplification curve appears, the sample is judged as positive; no Ct value and no specific amplification curve, the sample is judged as negative; 35 < CT value < 45 and specific amplification curve appears, the sample is judged as suspicious, the suspicious sample needs to be re-sampled to extract DNA and re-inspected, Ct value < 45 is judged as positive, otherwise, it is judged as negative.

[0164] In the present application, the Ct value is the cycle number corresponding to the inflection point from the baseline to the exponential growth.

[0165] In one embodiment of the present application, the positive control is a positive standard sample with a concentration of 10 4 copies / μL.

[0166] In one embodiment of the present application, the above-mentioned kit is also applied to environmental sample detection.

[0167] In the following examples, the nucleotide sequences are as follows:

[0168] The nucleotide sequence of the ORF5 gene of porcine rickettsia is shown in SEQ ID NO. 21;

[0169] The nucleotide sequence of the glgp gene of porcine chlamydia is shown in SEQ ID NO. 22;

[0170] The nucleotide sequence of the P95 gene of porcine mycoplasma pneumoniae is shown in SEQ ID NO. 23;

[0171] The nucleotide sequence of the B1 gene of toxoplasma is shown in SEQ ID NO. 24;

[0172] The nucleotide sequence of the CLPS gene of porcine leptospira is shown in SEQ ID NO. 25.

[0173] The present application will be described in detail below in combination with the drawings and specific examples.

[0174] In the following examples, the materials used are commercially available unless otherwise specified; the detection means used are conventional technical means in the art unless otherwise specified.

[0175] Example 1

[0176] The embodiment provides application of a pig five-body kit.

[0177] 1. Preparation of positive standard

[0178] The positive standard of EPE, CS, MPS, TP and LEP is prepared by using a purchased virus vaccine, extracting DNA as a template, extracting total DNA according to a DNA virus extraction kit of Tiangeng, and using a 50 muL system, wherein the reaction system comprises 25 muL of 2x Taq Master Mix (Dye Plus), 2 muL of an upstream primer, 2 muL of a downstream primer, 6 muL of DNA and 15 muL of RNase free H2O (nuclease-free water). The PCR amplification program is as follows: 95 DEG C for 3 min; 95 DEG C for 15 s, 55 DEG C for 15 s and 72 DEG C for 30 s, for a total of 30 cycles; and then 72 DEG C for 5 min. After amplification, all the products are identified by 1.2% agarose gel electrophoresis. The PCR product identified as positive is purified and recovered by using a gel recovery kit of Tiangeng, connected to a pEASY-T1 vector and transformed into DH5a competent cells, and after picking positive clones, amplifying the bacteria in LB culture solution, the bacterial solution is sent to Shanghai SunGene Bioengineering Co., Ltd. for sequencing.

[0179] 2. Optimization of five-fold fluorescence quantitative PCR conditions

[0180] The standard plasmid is extracted by using a plasmid extraction kit of Tiangeng, and the plasmid template concentration is detected by using a NanoDrop 2000 nucleic acid concentration detector. After the five standard plasmids are diluted by 10 times in gradient, 10 4 copies / uL, 1:1:1:1:1 are mixed as templates, the total system is 25 muL, the upstream primer and the downstream primer are mixed with the corresponding probe at different probe final concentrations and primer final concentrations, the primer (upstream and downstream) and the corresponding probe are added in an amount of 1.2 muL, 1.2 muL (400 nM:400 nM), 1.2 muL, 0.6 muL (400 nM:200 nM), 1.2 muL, 0.3 muL (400 nM:100 nM), 0.6 muL, 0.3 muL (200 nM:100 nM), and the concentration of all primers and probes is 10 muM, PCR amplification is carried out according to the amplification program provided in the embodiment, 37 DEG C for 2 min, 95 DEG C for 30 s, 95 DEG C for 10 s, 58 DEG C for 30 s (fluorescence signal acquisition), for a total of 45 cycles, so as to obtain the lowest CT value and the primer probe concentration ratio at the time of higher fluorescence intensity increase value as the best.

[0181] Table 1: primer concentration and probe concentration grouping test

[0182]

[0183] The experimental results (Table 1) show that by exploring the optimal reaction system using different combinations of probes and primer concentrations, it was found that when the final probe concentration was 100 nM and the final upstream and downstream primer concentrations were 400 nM, the fluorescence intensity of Cy5, ROX, and Cy3 in this multiplex qPCR reaction was the highest, and the CT value was also the lowest (because the fluorescence of Cy5, ROX, and Cy3 in this multiplex detection method is relatively weak, therefore the primer-probe combination with the highest fluorescence intensity of Cy5, ROX, and Cy3 was selected as the optimal combination).

[0184] Five standard plasmids were serially diluted 10-fold to serve as templates, and the plasmids with a concentration of 10 were used as templates. 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0 Sensitivity was determined using a singlet qPCR reaction system with a concentration of 5 μL of DNA template, 1.2 μL (400 nM) of forward and reverse primers, 0.3 μL (100 nM) of probe, 12.5 μL of PCR amplification buffer, and 6 μL of DNAse-free ddH2O. All primers and probes were used at a concentration of 10 μM. The amplification program was 37℃ for 2 min, 95℃ for 30 s, followed by cycles of 95℃ for 10 s and 58℃ for 30 s (fluorescence signal acquisition), for a total of 45 cycles. PCR amplification was performed, and the standard curve was analyzed.

[0185] like Figures 1-10 As shown, within the current concentration range of dilutions, the template amount and the corresponding Ct value exhibit a good linear relationship, with correlation coefficients R² of 0.999, 0.998, 0.998, 0.998, and 0.997, respectively. The quantitative fluorescence method of this invention has high amplification efficiency (99.13%-101.25%) for different virulence genes, and the minimum detection limit for quantitative fluorescence PCR is 10. 1 The concentration of copise / μL is such that the fluorescence quantitative PCR established in this invention has high sensitivity.

[0186] 3. Repeatability test

[0187] Using positive standards diluted 10-fold at seven different concentrations as templates, the final concentrations were 10... 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0copise / μL, the fluorescence quantitative PCR was carried out according to the reaction system and procedure for providing fluorescence quantification, 3 repetitions were set for each gradient, and the repeatability of the method was verified. The results show that the repeatability variation coefficients (CV values) of the repeated experiments are all below 0.5%, indicating that the present application has good repeatability.

[0188] 4. Specificity test

[0189] The positive samples of the porcine pestivirus, porcine pseudorabies virus, porcine blue-ear virus, porcine circovirus, porcine parvovirus and porcine encephalitis virus preserved by the inventors were used as templates, and the primers and probes in the present application were used for fluorescence quantitative PCR amplification. The results are shown in Table 2. Figure 11 As shown in Table 2, the detection results of different signal channels in the system are all negative, indicating that the method has strong specificity and no cross-reaction with other main infectious agents.

[0190] The above description of the embodiments is for facilitating the ordinary skilled person in the art to understand and use the present application. The person skilled in the art can obviously easily make various modifications to the embodiments, and apply the general principles described herein to other embodiments without creative labor. Therefore, the present application is not limited to the above embodiments, and the improvements and modifications made by the person skilled in the art according to the disclosure of the present application without departing from the scope of the present application should be within the protection scope of the present application.

Claims

1. A reagent kit, characterized in that, The kit includes a negative control, a positive control, primer premix, probe premix, and PCR amplification solution; The primer premix solution was initially 10 μM of a premix solution containing EPE-F, EPE-R, CS-F, CS-R, MPS-F, MPS-R, TP-F, TP-R, LEP-F, and LEP-R in a molar ratio of 1:1:1:1:1:1:1:1:1:

1. EPE-F: 5'-TGGGCAGAGATTGCTGGC-3', EPE-R: 5'-TTTTAGGGGTGGGGTGGA-3', CS-F: 5'-CAGGAATGCCGAGAGTTG-3', CS-R: 5'-CTTGGAAATGGGGGGTTA-3', MPS-F: 5'-TCAGGTTGTTTTTTCAGAGC-3', MPS-R: 5'-TAAATTTCCCCCAGTCATTA-3', TP-F: 5'-AAATTCTTGTGCTGCCT-3', TP-R: 5'-TTTCACCTGTATTTGCCA-3', LEP-F: 5'-CACAAACTCCAGACCTAAA-3', LEP-R: 5'-AGTATGTTTCGTTATCGTCC-3'; The probe premix solution comprises an initial concentration of 10 μM of EPE-P, CS-P, MPS-P, TP-P, and LEP-P in a molar ratio of 1:1:1:1:

1. EPE-P: 5'-CCAGGCACCCCTGAAACCTGGTGCG-3', wherein a reporter group FAM is added to the 5' end and a quencher group BHQ1 is added to the 3' end. CS-P: 5'-CCATAGAATCAAGAAAACATGCTGCT-3', where a reporter group HEX is added to the 5' end and a quencher group BHQ1 is added to the 3' end. MPS-P: 5'-CTTCAGCAGAGGTAAAATTACTATCAGC-3', wherein a reporter group CY5 is added to the 5' end and a quencher group BHQ2 is added to the 3' end. TP-P: 5'-TCCTCTCATGGCAAATGCCAGAAGAAGG-3', wherein a reporter group ROX is added to the 5' end and a quencher group BHQ2 is added to the 3' end. LEP-P: 5'-ATGAAATTACTGAGGAGTCCACGAAATC-3', wherein a reporter group CY3 is added to the 5' end and a quencher group BHQ2 is added to the 3' end; The positive control is a recombinant plasmid containing the ORF5 gene, glgp gene, P95 gene, B1 gene and CLPS target gene fragment. The target sequence of the primer-probe set for the ORF5 gene is: TGGGCAGAGATTGCTTGGCCAGGCACCCCTGAAACCTGGTGCGGAGGATTCCAAGCCTGAAGCCGTCCCTTCCTCCATCCACCCCACCCTAAAA; The target sequence of the primer-probe set for the glgp gene is: CAGGAATGCCGAGAGTTGCCATAGAATCAAGAAAACATGCTGCTAATCGACCTAACCCCCCATTTCCAAG; The target sequence of the primer-probe set for the P95 gene is: TCAGGTTGTTTTTTCAGAGCTTCAGCAGAGGTAAAATTACTATCAGCAAGCTCTAATTTCAGTAATGACTGGGGGAAATTTA; The target sequence of the primer-probe set for the B1 gene is: AACATTCTTGTGCTGCCTCCTCTCATGGCAAATGCCAGAAGAAGGGTACGTGTTGCATCATAACAAGAGCTGTATTTCCCGCTGGCAAATACAGGTGAAA; The target sequence of the primer-probe set for the CLPS gene is: CACAAACTCCAGACCTAAATGAAATTACTGAGGAGTCCACGAAATCAACGGGAGGACCTTGGAGAGTTGTACTTTGGGACGATAACGAACATACT; The negative control was double-distilled water; The PCR amplification solution was 2×Animal Detection Probe Master Mix.

Images