A primer set, kit and method for detecting Mycobacterium tuberculosis by loop-mediated isothermal amplification
By using the Rv2424c gene as the target and combining it with loop-mediated isothermal amplification technology and Bst DNA polymerase, the sensitivity and time problems of existing detection methods were solved, and rapid and accurate detection of Mycobacterium tuberculosis was achieved.
Patent Information
- Application Number
- CN202310121405.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-15
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2043-02-15
AI Technical Summary
Existing methods for detecting Mycobacterium tuberculosis have problems such as low sensitivity, false positives and false negatives, and conventional PCR detection takes a long time, making it difficult to quickly and accurately distinguish between Mycobacterium tuberculosis and non-tuberculosis mycobacteria.
The Rv2424c gene is used as the target, and loop-mediated isothermal amplification technology is used for detection through a specific primer set. Amplification is performed under isothermal conditions with Bst DNA polymerase to avoid temperature adjustment, and DNA or metal ion indicators are used to judge the results.
It achieves rapid, sensitive and accurate detection of Mycobacterium tuberculosis with high specificity. It can distinguish tuberculosis bacteria from non-tuberculosis mycobacteria in a short time, shortening the detection time to one-quarter. The results can be presented in a variety of ways.
Smart Images

Figure CN116121426B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a primer set, a kit and a method for detecting Mycobacterium tuberculosis by loop-mediated isothermal amplification. Background Art
[0002] According to a World Health Organization report, one-third of the world's population is infected with Mycobacterium tuberculosis. This infection can worsen the clinical condition of infected individuals. Therefore, detecting Mycobacterium tuberculosis in clinical specimens is crucial for the treatment and management of infected individuals.
[0003] One of the conventional detection methods for Mycobacterium tuberculosis is through morphological differentiation and identification. However, in practice, sputum contains varying components, and preparing and staining sputum slides suitable for testing can be difficult for inexperienced testers. After acid-fast staining of a sputum smear, the presence of short red rods under a microscope is considered positive. However, a positive stain only indicates the presence of acid-fast rods and cannot distinguish them from other acid-fast-positive bacteria, particularly tuberculosis bacteria from non-tuberculosis mycobacteria. Another conventional detection method is isolation and culture. Although this method is more sensitive than smear microscopy, the incubation period is as long as 6-8 weeks. Other conventional detection methods include molecular biology, including polymerase chain reaction (PCR), isothermal amplification (SAT, LAMP, RPA, RAA, etc.), and molecular hybridization (MH). These methods are more sensitive and significantly reduce the time required for detection (from several hours to a day). Molecular detection methods can also detect and identify strains directly from specimens and isolated and cultured in the laboratory. However, due to the repeated cycles of denaturation, annealing, and extension, the temperature must be constantly adjusted, and this temperature adjustment process nearly doubles the overall reaction time. Moreover, currently disclosed different targets for detecting Mycobacterium tuberculosis include the groE1, mtb-4, and dnaJ genes encoding 32kDa, 38kDa, and 65kDa antigens, insertion sequences, the 16S-23S spacer region encoding heat shock protein (hsp) 65, and 16S rRNA. IS986 and IS6110 are the most common repetitive elements in most Mycobacterium tuberculosis, with 10-16 copies in the strain. Among them, IS6110 is more sensitive and more specific than IS986. IS6110 is considered to be a useful target for detecting Mycobacterium tuberculosis. However, the presence of this target in Mycobacterium bovis can lead to false positive results. In addition, it has been reported that some Mycobacterium tuberculosis strains lack this component, which may lead to false negative results.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The present invention aims to provide a primer set, a kit and a method for detecting Mycobacterium tuberculosis. The detection primers use Rv2424c as a target and utilize loop-mediated isothermal amplification detection technology to rapidly, sensitively, accurately and efficiently detect Mycobacterium tuberculosis in a sample.
[0006] The target gene Rv2424c used in the present invention is a recently discovered specific transposase for insertion sequences of Mycobacterium tuberculosis and is commonly found in Mycobacterium tuberculosis groups.
[0007] Transposases are enzymes that perform transposition, typically encoded by transposons. They recognize specific sequences at either end of the transposon, detaching it from adjacent sequences and reinserting it into a new DNA target site. In bacteria, these transposases are classified as DDE, DEDD, HUH, and serine transposases, depending on the amino acid sequence of the catalytically active center of the insertion sequence. Insertion sequences can be inserted into gene coding regions through different transposition mechanisms, causing mutations, deletions, and inversions. Alternatively, they can be inserted upstream of genes, where they influence the expression of downstream genes through their own promoters or by forming hybrid promoters with the gene, thereby helping bacteria withstand complex environmental changes. To date, at least 2,000 insertion sequences have been discovered. The first insertion sequence in mycobacteria was discovered in the 1980s. To date, at least 37 different mycobacterial insertion sequences have been identified.
[0008] Mycobacterium tuberculosis is an acid-tolerant, host-restricted aerobic pathogen that carries approximately 30 different insertion sequence elements. The most studied of these is IS6110, which is found only in members of the Mycobacterium tuberculosis complex (MTBC). Currently, foreign researchers use PCR to amplify Rv2424c to study the function of transposases, but there are no methods that use it as a DNA detection target. The present invention uses the Rv2424c gene as a target for isothermal amplification detection of Mycobacterium tuberculosis, providing a highly sensitive and rapid detection method for this new MTBC target, Rv2424c.
[0009] The present invention is achieved in that:
[0010] In a first aspect, the present invention provides a primer set for detecting Mycobacterium tuberculosis by loop-mediated isothermal amplification, wherein the primer set uses Rv2424c as a target gene and comprises an outer primer pair, an inner primer pair, and a loop primer pair;
[0011] The outer primer pair includes F3 and B3, the nucleotide sequence of F3 is shown in SEQ ID No. 2, and the nucleotide sequence of B3 is shown in SEQ ID No. 3;
[0012] The inner primer pair includes FIP and BIP, the nucleotide sequence of FIP is shown in SEQ ID No. 4, and the nucleotide sequence of BIP is shown in SEQ ID No. 5;
[0013] The loop primer pair includes LF and LB, the nucleotide sequence of LF is shown in SEQ ID No.6, and the nucleotide sequence of LB is shown in SEQ ID No.7.
[0014] In a second aspect, the present invention further provides a kit for detecting Mycobacterium tuberculosis by loop-mediated isothermal amplification, which includes the above-mentioned LAMP primer set.
[0015] The amount of each primer added and their ratio will affect the amplification results. In order to make the amplification results easier to distinguish, preferably, the molar ratio of the outer primer pair, inner primer pair and loop primer pair in the present invention is 1:8:4.
[0016] In some embodiments, the kit further comprises one or more of dNTPs, PCR buffer, and Bst DNA polymerase.
[0017] The present invention replaces the DNA polymerase used in conventional PCR with Bst DNA polymerase, which is heat-resistant, has strand displacement function and DNA 5'→3' polymerization activity, and achieves specific amplification of target DNA under isothermal conditions of 60-65°C. Since high-temperature denaturation, low-temperature annealing and extension cycles are not required, the time required for conventional PCR temperature changes is saved, thereby achieving rapid and efficient DNA amplification.
[0018] In some embodiments, the PCR buffer comprises: Tris-HCl, MnCl2, (NH4)2SO4, MgSO4, Tween 20, betaine, and an indicator.
[0019] The indicator in the kit is selected from a DNA indicator or a metal ion indicator. The present invention does not limit the use of a DNA indicator or a metal ion indicator. The DNA indicator is a fluorescent indicator, which may be Syto 9; the metal ion indicator may be calcein or hydroxynaphthol blue.
[0020] In a third aspect, the present invention provides a method for detecting Mycobacterium tuberculosis, which comprises using the above primer set or kit to perform a loop-mediated isothermal amplification reaction on a sample to be tested, and determining the result by color change after the amplification reaction is completed.
[0021] The reaction process of the loop-mediated isothermal amplification reaction is as follows: Figure 1 As shown:
[0022] The FIP primer hybridizes with the F2 region of the target DNA, synthesizing a complementary chain, and the LAMP reaction begins ( Figure 1 B); Bst DNA polymerase (with strand displacement function) displaces the complementary strand synthesized by FIP primer with the extended strand of the external primer (F3 or B3) ( Figure 1 C); the complementary strand synthesized by the FIP primer is released and becomes the template for the BIP primer ( Figure 1 C); a dumbbell-shaped DNA formation ( Figure 1 D), the dumbbell-shaped DNA serves as a template for the LAMP cycle ( Figure 1 D). LF acts as another primer and simultaneously enters the amplification cycle until the reaction is complete. The final product is a mixture of DNA molecules with stem-loop structures of varying lengths (stem-loop DNAs).
[0023] In the present invention, the 25 μL reaction system for the above amplification reaction is: a final concentration of Tris-HCl (pH = 7.1) of 10 mM, a final concentration of KCl of 50 mM, a final concentration of MnCl2 of 10 mM, a final concentration of an indicator of 10 mM, a final concentration of MgSO4 of 8 mM, a final concentration of EDTA of 0.1 mM, a final concentration of DTT of 1 mM, a final concentration of Triton X-100 of 0.1%, a final concentration of glycerol of 2%, a final concentration of betaine of 0.8 M, a final concentration of an outer primer pair of 0.2 μM, a final concentration of an inner primer pair of 1.6 μM, a final concentration of a loop primer pair of 0.8 μM, a final concentration of dNTPs of 1.4 mM, a final concentration of Bst DNA polymerase of 8 U / μL, and 5 μL of DNA sample.
[0024] like Figure 2 and Figure 3 As shown, when the indicator is calcein, under visible light, the color shows light yellow, indicating a positive result, and the color shows light pink, indicating a negative result; under ultraviolet light, the color shows green fluorescence, indicating a positive result, and the color shows no fluorescence, indicating a negative result.
[0025] The results of the present invention can be presented in a variety of convenient and efficient ways: 1: observing color changes under visible light; 2: observing whether there is green fluorescence under ultraviolet light; 3: fluorescence values can be detected in real time in a fluorescence instrument with FAM / SYBGREEN channels and interpreted by amplification curves and Ct values; 4: instruments with melting curve mode can be interpreted by annealing temperature and curves.
[0026] When the indicator is Syto 9, under ultraviolet light, the color shows green fluorescence, indicating a positive test, and the color shows no fluorescence, indicating a negative test.
[0027] When the indicator is hydroxynaphthol blue, under visible light, the color appears sky blue, indicating a positive result, and the color appears lavender, indicating a negative result.
[0028] In some embodiments, the loop-mediated isothermal amplification reaction conditions are: 62-68° C. for 20-40 minutes, followed by inactivation of Bst DNA polymerase at 80-99° C. for 1-3 minutes. Preferably, the reaction conditions are: 65° C. for 30 minutes, followed by inactivation of Bst DNA polymerase at 80-99° C. for 2 minutes.
[0029] The loop-mediated isothermal amplification using the above primer set, reaction system and reaction conditions not only has good stability and high sensitivity, but also can quickly detect and obtain an amplification curve in a relatively short time. Compared with the conventional PCR amplification reaction which takes at least 2 hours, the present invention only takes 10 minutes to 30 minutes.
[0030] In a fourth aspect, the present invention also provides use of the above primer set, kit or method in detecting Mycobacterium tuberculosis.
[0031] The present invention has the following beneficial effects:
[0032] (1) Compared with the smear microscopy method, the present invention can specifically detect the genes of Mycobacterium tuberculosis by detecting the genome in Mycobacterium tuberculosis without amplifying the genes of other organisms; and it is not dependent on morphology; and the present invention amplifies the Rv2424c gene unique to the Mycobacterium tuberculosis complex as the target gene, which can not only distinguish it from other acid-fast positive bacteria, but also from non-tuberculosis mycobacteria, and has strict specificity.
[0033] (2) Since the present invention targets the Rv2424c gene, which is unique to Mycobacterium tuberculosis, as the target gene for amplification, and this gene only exists in the Mycobacterium tuberculosis complex, it can identify the Mycobacterium tuberculosis complex that causes human infection, and does not amplify non-tuberculosis mycobacteria, and has high specificity.
[0034] (3) Compared with conventional PCR, the present invention adopts isothermal amplification technology, which does not require temperature adjustment and shortens the reaction time to one-fourth. The original PCR amplification reaction requires at least 2 hours, while the present invention only requires 10 minutes to 30 minutes.
[0035] (4) The results of the present invention can be presented in a variety of ways, which are convenient, efficient, and suitable for a variety of instruments and scenarios. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.
[0037] Figure 1 This is the reaction process of the loop-mediated isothermal amplification reaction of the present invention;
[0038] Figure 2 The test results under visible light in Example 1 of the present invention are shown, with the left side showing the negative control, the middle showing the positive sample, and the right side showing the positive control;
[0039] Figure 3 The test results under ultraviolet light in Example 1 of the present invention are shown, with the left side being the negative control, the middle being the positive sample, and the right side being the positive control;
[0040] Figure 4 The corresponding positions of each primer in the Rtb145 primer set and the Rv2424c template;
[0041] Figure 5 The sensitivity test results of Rtb145 in Example 3 (A: H37Ra: 4x10 4 CFU / ml; B:H37Ra:4x10 3 CFU / ml; C:H37Ra:4x10 2 CFU / ml; D:H37Ra:4x10 0 CFU / ml). DETAILED DESCRIPTION
[0042] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.
[0043] The features and performance of the present invention are further described in detail below with reference to the embodiments.
[0044] Example 1
[0045] This embodiment provides a method for detecting Mycobacterium tuberculosis, which comprises:
[0046] 1. DNA extraction:
[0047] (1) Sample Preparation: Take a sputum specimen and add 1-2 times the volume of sputum dissolving solution (containing 2% NaOH and 0.5% N-acetyl-L-cysteine before use) depending on the specimen properties. Mix thoroughly and let stand at room temperature for 10-15 minutes. Centrifuge 1-3 ml of the solution at 13000 g for 15 minutes at room temperature and discard the supernatant.
[0048] (2) Lysis: Add 10 μL of proteinase K (1 mg / mL) to the precipitate, mix quickly, incubate at 100°C for 10 minutes, and then place in a -20°C refrigerator to cool for 10 minutes.
[0049] (3) Nucleic acid purification
[0050] ① Suspend the nucleic acid precipitate: add 300 μl of adsorption buffer and mix immediately.
[0051] ②Insert the adsorption column into a 2 ml blank tube.
[0052] ③ Membrane adsorption of nucleic acids: transfer all liquid to the adsorption column, centrifuge at 13,000g for 1 minute, and discard the flow-through;
[0053] ④ Washing: Add 700 μL of washing solution (80% anhydrous ethanol (v / v)) to the column, centrifuge at 13,000 g for 1 minute, and discard the flow-through. Repeat once.
[0054] ⑤ Dry nucleic acid: Place the empty adsorption column in a centrifuge and centrifuge at 13,000g for 2 minutes.
[0055] ⑥Elute DNA: Place the adsorption column into a new 1.5 ml centrifuge tube, add 60 μl of elution buffer to the adsorption column, and centrifuge at 13,000 g for 1 minute.
[0056] (4) Nucleic acid storage: Freeze the eluted DNA solution at -20°C for testing.
[0057] 2. Primer set design and screening:
[0058] (1) Primers were designed based on the gene sequence of Mycobacterium tuberculosis Nc_000962.3:2720776-2721777Rv2424c [organism = Mycobacterium tuberculosis H37Rv], wherein the nucleotide sequence of Rv2424c is shown in SEQ ID No. 1. The designed LAMP-specific primer set capable of identifying Mycobacterium tuberculosis was named Rtb145, and the position corresponding to the template Rv2424c was shown in FIG. Figure 4 Primer set Rtb145 contains two outer primers (F3 and B3), two inner primers (FIP, composed of the complementary sequences of F1c and F2; BIP, composed of B1c and B2) and two loop primers (LF and LB), the sequences of which are shown in Table 1.
[0059] Table 1 Primer sequences of primer set Rtb145
[0060] sequence SEQ ID No. F3 AGGTCCGCAAGTTCGGT 2 B3 TCCTTGGGCTTCGAGTTTG 3 FIP (F1c+F2) AGCACGTGCCAAATGATGACGACAGTCCCGCTGCCAAC 4 BIP(B1c+B2) GCCTCACCAGGATCTCGGCCGTTCTTTGTCGGGATCCAT 5 LF TCAGCTTGTGGGCGACG 6 LB GCCGACTACTTCACCACCC 7
[0061] 3. Loop-mediated isothermal amplification reaction
[0062] Add the sample DNA from step 1 to the reaction system and place it in the amplification instrument for amplification. The 25 μL reaction system includes 10 mM tris–HCl (pH 7.1), 50 mM KCl, 10 mM MnCl2, 10 mM Calcium (Sigma–Aldrich), 8 mM MgSO4, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton X-100, 2% glycerol, 0.8 M Betaine (Sigma–Aldrich), 0.2 μM F3 and B3, 1.6 μM FIP and BIP, 0.8 μM LF and LB, 1.4 mM dNTPs, 8 units of Bst DNA polymerase, and 5 μL sample DNA.
[0063] The reaction conditions of the amplification reaction were as follows: reaction at 65°C for 30 min, followed by inactivation of Bst DNA polymerase at 80-99°C for 2 min.
[0064] During the test, three groups of tests were set up, including water-negative control, Mycobacterium tuberculosis (H37a) DNA positive control, and positive sample. Figure 2 and Figure 3 As shown, the left side is the negative control, the middle is the positive sample, and the right side is the positive control. The negative control and negative sample are light pink under visible light and have no fluorescence under ultraviolet light; the positive control and positive sample are light yellow under visible light and have green fluorescence under ultraviolet light.
[0065] Example 2
[0066] This example is a verification of the effect of the primer set provided in Example 1
[0067] 1. Using TB-DNA as template
[0068] After 30 minutes of amplification at 65°C, the Rtb145 primer set showed no amplification curve in the water control, but an amplification curve appeared after adding TB-DNA. The average time for the two amplification curves was 8 minutes and 22 seconds, and the annealing temperature was 91.46°C. The results are shown in Table 2:
[0069] Table 2 Screening results of Rtb145 primer set
[0070]
[0071] 2. Using gradient dilutions of BCG as a template, its cross-reactivity with Mycobacterium bovis tuberculosis was tested. The results are shown in Table 3. The results showed that primer set Rtb145 was reactive to 250 CFU / mL BCG bacteria after 30 minutes of amplification.
[0072] Table 3 Cross-reactivity results with BCG
[0073]
[0074] 3. Using clinical samples as templates
[0075] Testing of clinical samples showed that Rtb145 was able to rapidly detect and obtain amplification curves for all 10 samples, with an average time of 8 minutes and 18 seconds, the shortest being 5 minutes and 45 seconds, and the longest being 12 minutes. The average annealing temperature was 91.46°C. The results are shown in Table 4.
[0076] Table 4 Detection results of primer set Rtb145 on 10 samples
[0077]
[0078] Example 3
[0079] Sensitivity detection of the LAMP primer set of Example 1
[0080] The inactivated Mycobacterium tuberculosis H37Ra was diluted in gradients and then the DNA was extracted and purified. The results of isothermal amplification using primer set Rtb145 were as follows: Figure 5 As shown, where A: H37Ra: 4x10 4 CFU / ml; B:H37Ra:4x10 3 CFU / ml; C:H37Ra:4x10 2 CFU / ml; D:H37Ra:4x10 0 CFU / ml. The results showed that the Rtb145 primer set could effectively amplify TBH37Ra 4×10 2 CFU / ML.
[0081] Example 4
[0082] Specificity detection of the LAMP primer set of Example 1
[0083] Isothermal amplification using primer set Rtb145 showed no reaction to Mycobacterium avium, Mycobacterium terrestris, Mycobacterium schrenkieri, Mycobacterium kansasii, Mycobacterium asiatica, Mycobacterium scrofulae, Mycobacterium gordonii, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium phlei, influenza virus, parainfluenza virus, respiratory syncytial virus, rhinovirus, coxsackievirus, adenovirus, Nocardia brasiliensis, Corynebacterium pekinensis, Pneumococcus, Legionella pneumophila, Bordetella pertussis, Mycoplasma pneumoniae, Haemophilus influenzae, and Staphylococcus aureus.
[0084] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.
Claims
1. A primer set for detecting Mycobacterium tuberculosis by loop-mediated isothermal amplification, characterized in that: The primer set includes an outer primer pair, an inner primer pair and a loop primer pair; Wherein, the outer primer pair includes F3 and B3, the nucleotide sequence of F3 is shown in SEQ ID No.2, and the nucleotide sequence of B3 is shown in SEQ ID No.3; The inner primer pair includes FIP and BIP, the nucleotide sequence of FIP is shown in SEQ ID No. 4, and the nucleotide sequence of BIP is shown in SEQ ID No. 5; The loop primer pair includes LF and LB, the nucleotide sequence of LF is shown in SEQ ID No.6, and the nucleotide sequence of LB is shown in SEQ ID No.
7.
2. A kit for detecting Mycobacterium tuberculosis by loop-mediated isothermal amplification, characterized in that: The method comprises a LAMP reaction solution containing the primer set according to claim 1.
3. The kit according to claim 2, wherein The molar ratio of the outer primer pair, the inner primer pair and the loop primer pair in the LAMP reaction solution is 1:8:
4.
4. The kit according to claim 3, wherein The kit further comprises one or more of dNTPs, PCR buffer and Bst DNA polymerase.
5. The kit according to claim 4, characterized in that The PCR buffer comprises: Tris-HCl, MnCl2, (NH4)2SO4, MgSO4, Tween 20, betaine and an indicator.
6. The kit according to claim 5, characterized in that The indicator is selected from a DNA indicator or a metal ion indicator.
7. The kit according to claim 6, characterized in that The DNA indicator is Syto 9.
8. The kit according to claim 6, characterized in that The metal ion indicators are hydroxynaphthol blue and calcein.
9. A method for detecting Mycobacterium tuberculosis, characterized in that: The method is for non-disease diagnosis purposes, and comprises performing a loop-mediated isothermal amplification reaction on a sample to be tested using the primer set of claim 1 or the kit of any one of claims 2-8, and determining the result by color change after the amplification reaction is completed.
10. The method according to claim 9, characterized in that The reaction system for the loop-mediated isothermal amplification is 25 μL: 10 mM tris-HCl (pH 7.1), 50 mM KCl, 10 mM MnCl2, 10 mM indicator, 8 mM MgSO4, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton X-100, 2% glycerol, 0.8 M betaine, 0.2 μM F3 and B3, 1.6 μM FIP and BIP, 0.8 μM LF and LB, 1.4 mM dNTPs, 8 units Bst DNA polymerase and 5 μL sample DNA.
11. The method according to claim 10, characterized in that The reaction conditions of the loop-mediated isothermal amplification are: reaction at 62-68° C. for 20-40 minutes, and then inactivation of Bst DNA polymerase at 80-99° C. for 1-3 minutes.
Citation Information
Patent Citations
Primer composition for loop-mediated isothermal amplification detection of mycobacterium tuberculosis complex, and reaction system
CN112126695A