Composition for detecting influenza A virus and influenza B virus and its application

Abstract

The present invention provides a composition for detecting influenza A virus and influenza B virus and its application, belonging to the field of biotechnology. The composition includes primers and probes, and the nucleotide sequences of the primers and probes are shown in SEQ ID NO: 1-12. The detection kit prepared by the present invention has low temperature requirements, only requires 37-42°C constant temperature reaction, and has lower requirements for the module for heating the reaction; the reaction time is short, which greatly improves the detection efficiency; the primer-probe composition has high specificity and sensitivity, and can quickly detect influenza A virus and influenza B virus; it can realize the detection of influenza A virus and influenza B virus in a tube of sample, and type influenza A virus typing.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a composition for detecting influenza A virus and influenza B virus and an application thereof. Background Art

[0002] Influenza virus belongs to the family Orthomyxoviridae. It is a segmented single-stranded negative-sense RNA virus with typical spherical virus particles. Based on the different antigenicity of the hemagglutinin (HA) and neuraminidase (NA) proteins on the outer membrane of the virus particles, influenza A virus can currently be divided into 16 H subtypes (H1-H16) and 9 N subtypes (N1-N9). There have been reports of human infection with subtypes such as H1, H2, H3, H5, H7 and H9. Influenza virus is mainly transmitted through airborne droplets, often causing fever, fatigue, muscle aches and mild to moderate respiratory symptoms. Severe cases can cause pneumonia, myocarditis and heart failure.

[0003] Unlike influenza A, influenza B virus is not divided into subtypes, but is divided into two lineages based on the antigenicity and genetic characteristics of hemagglutinin: B / Victoria / 2 / 1987 lineage and B / Yamagata / 16 / 1988 lineage. The former is now more dominant in transmission. Influenza B virus almost only infects humans, and is prone to cause complications such as pneumonia and bacterial infection in specific populations of the elderly and children, which can be fatal in severe cases. Sometimes the disease burden caused by influenza B virus even exceeds that of influenza A virus. Accurate typing of influenza viruses can deepen the clinical understanding of influenza prevalence and pathogenicity, and improve the diagnosis and treatment of influenza cases.

[0004] At present, the technologies for detecting viruses mainly include polymerase chain reaction (PCR) and recombinase polymerase amplification (RPA). PCR is a molecular biology technology used to amplify specific DNA fragments. It can be regarded as a special DNA replication outside the body. Its essence is semi-conservative replication of DNA. The reaction is divided into three steps: denaturation-annealing-extension. However, the existing conventional detection technology is qPCR, which has high requirements for amplification instruments, and the detection time is long, and rapid detection cannot be achieved. Based on constant temperature amplification technology, there is no need for complex temperature control modules, and the detection time is faster.

[0005] Chinese patent CN115478119A discloses a test kit for influenza A and B viruses and adenovirus nucleic acid and a method of use. The test kit includes a combination of primers and probes designed for the MatrixProtein gene of influenza A virus, the MatrixProtein gene of influenza B virus and the hexonProtein gene of adenovirus nucleic acid, and also includes primers and probes for internal standard human Actin gene detection. The test kit of this patent can effectively detect influenza A and B viruses and adenovirus at the same time. The primers and probes are designed for pathogenic microorganism-specific conserved sequences, so the detection specificity is high, but the detection time is long.

[0006] Currently, there is a lack of a kit and method for the co-detection of influenza A virus and influenza B virus that can amplify at a constant temperature, shorten the detection time, facilitate transportation and storage, reduce errors caused by human operation, have high sensitivity and can type influenza A virus. Summary of the invention

[0007] Terms and Claims of the Present Invention:

[0008] In the present invention, the term "nucleotide sequence" refers to the order of bases in DNA or RNA.

[0009] In the present invention, the term "primer" refers to two artificially synthesized oligonucleotide sequences, one primer is complementary to a DNA template strand at one end of the target gene, and the other primer is complementary to another DNA template strand at the other end of the target gene.

[0010] In the present invention, the term "probe" refers to a nucleic acid sequence (DNA or RNA) with a detection label, a known sequence, and complementary to the target gene.

[0011] In the present invention, the term "influenza A virus" refers to an influenza virus including multiple subtypes, and the virus is the only species under the genus Influenza A virus of the family Orthomyxoviridae.

[0012] In the present invention, the term "influenza B virus" refers to a highly contagious acute respiratory infectious disease caused by influenza virus. Type B virus often causes localized epidemics. The outer layer of influenza virus has two different glycoproteins forming radial protrusions, namely hemagglutinin and neuraminidase. Antigenic variation of influenza virus refers to the change of H and N antigen structures.

[0013] In order to solve the above technical problems, the present invention provides a primer-probe combination and application thereof for rapid detection of influenza A virus and influenza B virus by isothermal amplification using a recombinase polymerase, and achieves typing of influenza A virus through a highly specific primer-probe combination, providing a powerful reference for targeted treatment.

[0014] The technical solution of the present invention includes:

[0015] In one aspect, the present invention provides a composition for detecting influenza A virus and influenza B virus, the composition comprising primers and probes, the primers comprising FluA-H1 / H3 forward primers, FluA-H1 / H3 reverse primers, FluA-H7 / H9 forward primers, FluA-H7 / H9 reverse primers, FluB forward primers, and FluB reverse primers; the probes comprising FluA-H1 / H3 probes, FluA-H7 / H9 probes, and FluB probes;

[0016] The nucleotide sequence of the FluA-H1 / H3 forward primer is shown in SEQ ID NO: 1;

[0017] The nucleotide sequence of the FluA-H1 / H3 reverse primer is shown in SEQ ID NO: 2;

[0018] The nucleotide sequence of the FluA-H1 / H3 probe is shown in SEQ ID NO: 3;

[0019] The nucleotide sequence of the FluA-H7 / H9 forward primer is shown in SEQ ID NO:4;

[0020] The nucleotide sequence of the FluA-H7 / H9 reverse primer is shown in SEQ ID NO:5;

[0021] The nucleotide sequence of the FluA-H7 / H9 probe is shown in SEQ ID NO:6;

[0022] The nucleotide sequence of the FluB forward primer is shown in SEQ ID NO:7;

[0023] The nucleotide sequence of the FluB reverse primer is shown in SEQ ID NO:8;

[0024] The nucleotide sequence of the FluB probe is shown in SEQ ID NO:9.

[0025] Preferably, the primers further include an internal standard forward primer GAPDH-F and an internal standard reverse primer GAPDH-R, and the probe further includes an internal standard probe GAPDH-P; the nucleotide sequence of GAPDH-F is shown in SEQ ID NO: 10;

[0026] The nucleotide sequence of GAPDH-R is shown in SEQ ID NO:11;

[0027] The nucleotide sequence of the GAPDH-P probe is shown in SEQ ID NO:12.

[0028] Specifically, the influenza A virus is an influenza virus comprising multiple subtypes, and the virus is the only species under the family Orthomyxoviridae and the genus Influenza A virus.

[0029] Specifically, the influenza B virus is a highly contagious acute respiratory infectious disease caused by influenza virus. The influenza B virus often causes localized epidemics. The outer layer of the influenza virus has two different glycoproteins that form radial protrusions, namely hemagglutinin and neuraminidase. The antigenic variation of the influenza virus refers to the change in the structure of the H and N antigens.

[0030] Preferably, the FluA-H1 / H3 probe is labeled with a fluorescent group and a quenching group, and modified with tetrahydrofuran. The 36th base T of the probe sequence is labeled with a fluorescent group, the 39th base T of the probe sequence is labeled with a quenching group, the 37th base C of the probe sequence is modified with tetrahydrofuran, and the 3' end is labeled with C3-spacer.

[0031] Further preferably, the modified FluA-H1 / H3 probe is as follows:

[0032] 5'-ATCTGGCCTGCGGATGCCTTTTGTTGATTGGTATT-[P-dT]-[H-dC]-C-[B-dT]-CCACTCCT-C3 Spacer, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0033] Preferably, the FluA-H7 / H9 probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 34th base T of the probe sequence is labeled with a fluorescent group, the 37th base T of the probe sequence is labeled with a quenching group, the 36th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0034] Further preferably, the modified FluA-H7 / H9 probe is as follows:

[0035] 5'-AGGCTCTCATGGAGTGGATAAAGACAAGACCAA-[P-dT]-C-[H-dC]-[B-dT]-GTCACCTCTGAC-C3 Spacer, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0036] Preferably, the FluB probe is labeled with a fluorescent group and a quencher group and modified with tetrahydrofuran, wherein the 15th base T of the probe sequence is labeled with a fluorescent group, the 18th base T of the probe sequence is labeled with a quencher, the 17th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0037] Further preferably, the modified FluB probe is as follows:

[0038] 5'-AGATGGCCATCGGA-[P-dT]-C-[H-dC]-[B-dT]-CAACTCACTCTCGAGCGTTTTAATGAAGG-C3 Spacer, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0039] Preferably, the GAPDH-P probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 34th base T of the probe sequence is labeled with a fluorescent group, the 37th base T of the probe sequence is labeled with a quenching group, the 36th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0040] Further preferably, the modified GAPDH-P probe is as follows:

[0041] 5'-GTGTCGCTGTTGAAGTCAGAGGAGACCACCTGG-[P-dT]-G-[H-dC]-[B-dT]-CAGTGTAG-C3 Space, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0042] Preferably, the fluorescent group is selected from at least one of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670, NED, AMCA, Pacific Blue, Atto425, BODIPY FL, Alexa Fluor 488, Yakima Yellow, Quasar 570, Aqua Phluor593, Atto 590, and Cy5.5.

[0043] Further preferably, the fluorescent group is selected from at least one of FAM, HEX, ROX, JOE, VIC, and CY5.

[0044] Most preferably, the fluorescent group is FAM.

[0045] Preferably, the quenching group is selected from at least one of 6-TAMRA, BHQ-1, BHQ-2, BHQ-3, Dabcyl, Eclipse, MGB, and QYS-7.

[0046] Further preferably, the quenching group is selected from at least one of BHQ1 and BHQ2.

[0047] Most preferably, the quencher group is BHQ1.

[0048] Specifically, the chemical formula of tetrahydrofuran is C4H8O, and the CAS number of tetrahydrofuran is 109-99-9.

[0049] Specifically, based on the comparison and analysis of influenza A virus H1 and H3 sequences in the public sequences of the Genebank database, a 342 bp conserved sequence of the nucleocapsid protein NS was screened out as a template sequence, and an influenza A virus H1 / H3 primer probe composition suitable for recombinase-mediated isothermal amplification was designed. The template sequence is shown in SEQ ID NO: 13.

[0050] By comparing and analyzing the influenza A virus H7 and H9 sequences in the public sequences of the Genebank database, a 262 bp conserved sequence of the M2 matrix protein was screened out as a template sequence, and a primer-probe combination of influenza A virus H7 / H9 suitable for recombinase-mediated isothermal amplification was designed. The template sequence is shown in SEQ ID NO: 14.

[0051] By comparing and analyzing the influenza B virus sequences in the public sequences of the Genebank database, a 183 bp conserved sequence of the NS1 protein was screened out as a template sequence, and an influenza B virus primer-probe combination suitable for recombinase-mediated isothermal amplification was designed. The template sequence is shown in SEQ ID NO: 15.

[0052] According to the complete sequence of human glyceraldehyde 3-phosphate dehydrogenase GAPDH in the public sequence of Genebank database, the interval from 781 bp to 1041 bp was selected as the template sequence, and a GAPDH primer probe combination suitable for recombinase-mediated isothermal amplification was designed. The GAPDH sequence is shown in SEQ ID NO: 16.

[0053] In yet another aspect, the present invention provides a kit for detecting influenza A virus and influenza B virus, the kit comprising the above-mentioned composition.

[0054] Preferably, the kit further comprises a buffer, a protease mixture, mannosylglycerol, dNTPs, a kinase system, polyethylene glycol, magnesium acetate and deionized water;

[0055] Further preferably, the buffer is selected from at least one of Tris buffer, borax buffer, phosphate buffer, HEPES buffer and MOPS buffer.

[0056] Further preferably, the protease mixture comprises a recombinase, a single-stranded DNA binding protein, a strand displacement DNA polymerase and a RT enzyme;

[0057] Further preferably, the kinase system comprises ATP and creatine phosphate.

[0058] In yet another aspect, the present invention provides use of the above composition or the above kit in detecting influenza A virus and influenza B virus for non-diagnostic purposes.

[0059] Preferably, the reaction system for detecting influenza A virus and influenza B virus includes the following components by volume: 1-7 parts of buffer, 1.5-5 parts of protease mixture, 4-10 parts of mannosylglyceric acid, 2-4 parts of dNTPs, 2-4 parts of kinase system, 0.4-1 parts of forward primer, 0.4-1 parts of reverse primer, 0.1-0.5 parts of probe, 10-15 parts of polyethylene glycol and 2-3 parts of magnesium acetate.

[0060] Further preferably, the reaction system for detecting influenza A virus and influenza B virus includes the following components by volume: 2.5 parts of buffer, 4 parts of protease mixture, 8 parts of mannosylglyceric acid, 3 parts of dNTPs, 3 parts of kinase system, 0.8 parts of forward primer, 0.8 parts of reverse primer, 0.4 parts of probe, 12.5 parts of polyethylene glycol and 2.5 parts of magnesium acetate.

[0061] In a specific embodiment of the present invention, the reaction system for detecting influenza A virus and influenza B virus includes: 20×Tris buffer 1-7μL, protease mixture 1.5-5μL, mannosylglycerol 4-10μL, dNTPs 2-4μL, kinase system 2-4μL, 50μM forward primer 0.4-1μL, 50μM reverse primer 0.4-1μL, 50μM probe 0.1-0.5μL, polyethylene glycol 10-15μL, and magnesium acetate 2-3μL.

[0062] Preferably, the reaction system for detecting influenza A virus and influenza B virus includes: 20×Tris buffer 2.5 μL, protease mixture 4 μL, mannosylglycerol 8 μL, dNTPs 3 μL, kinase system 3 μL, 50 μM forward primer 0.8 μL, 50 μM reverse primer 0.8 μL, 50 μM probe 0.4 μL, polyethylene glycol 12.5 μL, and magnesium acetate 2.5 μL.

[0063] Preferably, the final system concentration of the forward primer is 0.4-1 μM; the final system concentration of the reverse primer is 0.4-1 μM; and the final system concentration of the probe is 0.1-0.5 μM.

[0064] More preferably, the final system concentration of the forward primer is 0.6-1 μM; the final system concentration of the reverse primer is 0.6-1 μM; and the final system concentration of the probe is 0.3-0.5 μM.

[0065] Most preferably, the final system concentration of the forward primer is 0.8 μM; the final system concentration of the reverse primer is 0.8 μM; and the final system concentration of the probe is 0.4 μM.

[0066] Preferably, the total volume of the reaction system for detecting influenza A virus and influenza B virus is 50 μL.

[0067] Preferably, the amplification conditions of the composition when used to detect influenza A virus and influenza B virus are: amplification temperature of 37-42° C., and amplification time of 15-20 min.

[0068] Further preferably, the amplification conditions of the composition when used to detect influenza A virus and influenza B virus are: amplification temperature is 37° C., and amplification time is 20 min.

[0069] The beneficial effects of the present invention include:

[0070] (1) The detection kit prepared by the present invention has low temperature requirements, requiring only a constant temperature reaction of 37-42 degrees Celsius, and has even lower requirements for the reaction heating module;

[0071] (2) Short reaction time: Compared with the 1.5-3 hours of conventional PCR, this technology shortens the reaction time to 15-20 minutes, greatly improving the detection efficiency;

[0072] (3) The primer-probe combination has high specificity and sensitivity and can quickly detect influenza A and influenza B viruses;

[0073] (4) It is possible to detect influenza A virus and influenza B virus in a tube of sample and to type influenza A virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 This is a graph showing the joint test results of influenza A virus H1 / H3, influenza A virus H7 / H9, influenza B virus and the internal standard primer probe set in Example 1;

[0075] Figure 2 This is a graph showing the detection sensitivity results of the influenza A virus H1 / H3 primer probe set of Example 1;

[0076] Figure 3 This is a graph showing the sensitivity of the influenza A virus H7 / H9 primer probe set detection in Experimental Example 1;

[0077] Figure 4 This is a graph showing the sensitivity of the influenza B virus primer probe set detection in Experimental Example 1;

[0078] Figure 5 This is a graph showing the detection sensitivity of the influenza A virus primer probe set of Comparative Example 1;

[0079] Figure 6 This is a graph showing the detection sensitivity of the influenza B virus primer probe set of Comparative Example 1;

[0080] Figure 7 This is a graph showing the repeatability results of the influenza A virus H1 / H3 primer probe set of Example 1;

[0081] Figure 8 This is a graph showing the repeatability results of the influenza A virus H7 / H9 primer probe set of Example 1;

[0082] Fig. 9 This is a graph showing the repeatability results of the influenza B virus primer probe set of Example 1. DETAILED DESCRIPTION

[0083] Example 1 Establishment of multiple RPA detection method for influenza A virus and influenza B virus

[0084] 1. RPA primer probe design

[0085] The sequences of influenza A virus H1 and H3 in the public sequences of Genebank database were compared and analyzed, and the conservative nucleocapsid protein was selected as the target sequence of the primer. The sequence was used as the core target to extend the sequence to the 5' end and the 3' end. Finally, a 342 bp conservative sequence of the nucleocapsid protein NS was selected as the template sequence. Pseudovirus was prepared based on the sequence. The template sequence is as follows (SEQ ID NO: 13):

[0086] 5'-CATGGACTCCAATACCCTGGAACTAAGAAGCAGATACTGGGCCATA AGAACCAGGAGTGGAGGAAATACCAATCAACAGAAGGCATCTGCAGGCCAGATCAGTGTGCAGCCTACATTCTCAGTGCAGCGAAATCTCCCCTTTGAAAGAGCAACCATTATGGCAGCATTCAGCGGGAACAATGAAGGACGGACATC CGACATGCGAACAGAAGTTATAAGAATGATGGAAAGTGCAAAGCCAGAGGATTTGTCCTTCCAGGGGCGGGGAGTCTTCGAGCTCTCGGACGAAAAGGCAACGAACCCGATCGTGCCTTCCTTTGACATGAGTAATGAAGGGTCTTA-3'

[0087] Based on the comparison and analysis of influenza A virus H7 and H9 sequences in the public sequence of Genebank database, a 262 bp long matrix protein M2 conservative sequence was screened out as a template sequence, and pseudovirus was prepared based on this sequence. The template sequence is as follows (SEQ ID NO: 14):

[0088] 5'-TGAGTCTCTAACCGAGGTCGAAACGTACGTTCTCTTCATCATTCCA TCAGGCCCCCTCAAAGCCGAGATCGCACAGAGACTTGAGGATGTTTTTGCAGGGAAGAACGCAGATCTCGAGGCTCTCATGGAGTGGATAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGGTTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGGTTTGTCCAAAACGCCCTAAATGGGAATGG-3'

[0089] The influenza B virus sequences in the public sequences of the Genebank database were compared and analyzed, and a 181 bp conservative sequence of the NS1 protein was screened out as a template sequence. Pseudovirus was prepared based on this sequence. The template sequence is as follows (SEQ ID NO: 15):

[0090] 5'-CTTGTTGCTAAACTTGTTGCTACTGATGATCTTACAGTGGAGGATGA AGAAGATGGCCATCGGATCCTCAACTCACTCTTCGAGCGTCTTAATGAAGG ACATTCAAAGCCAATTCGAGCAGCTGAAACTGCGGTGGGAGTCCTATCCCA ATTTGGTCAAGAGCACCGATTATCACCAGAAGAG-3'

[0091] According to the complete sequence of human glyceraldehyde-3-phosphate dehydrogenase GAPDH in the public sequence of Genebank database, the interval from 781 bp to 1041 bp was selected as the template sequence, and plasmid synthesis was performed based on the sequence. The GAPDH template sequence is as follows (SEQ ID NO: 16):

[0092] 5'-GCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCT GACCTCCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGTGGCT-3'

[0093] According to the above target sequence, Primer Premier 6.0 was used for design and Lasergene 7.1 Primerselect was used for strict screening to obtain a set of primer-probe combinations of influenza A virus, influenza B virus and internal standard GAPDH suitable for recombinase-mediated isothermal amplification. The length of the target sequence to be amplified by the influenza A virus H1 / H3 primer-probe combination is 323 bp, the length of the target sequence to be amplified by the influenza A virus H7 / H9 primer-probe combination is 221 bp, the length of the target sequence to be amplified by the influenza B virus primer-probe combination is 167 bp, and the length of the target sequence to be amplified by the internal standard GAPDH primer-probe combination is 128 bp. The primer-probe combination is shown in Table 1:

[0094] Table 1 Primer probe set design table

[0095]

[0096] Among them, the FluA-H1 / H3 probe in Table 1 is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 36th base T of the probe sequence is labeled with a fluorescent group, the 39th base T of the probe sequence is labeled with a quenching group, the 37th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0097] The modified probe is: 5'-ATCTGGCCTGCGGATGCCTTTTGTTGATTGGTATT-[P-dT]-[H-dC]-C-[B-dT]-CCACTCCT-C3 Spacer, where P is a fluorescent group, H is tetrahydrofuran, and B is a quenching group.

[0098] The FluA-H7 / H9 probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 34th base T of the probe sequence is labeled with a fluorescent group, the 37th base T of the probe sequence is labeled with a quenching group, the 36th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0099] The modified probe is: 5'-AGGCTCTCATGGAGTGGATAAAGACAAGACCAA-[P-dT]-C-[H-dC]-[B-dT]-GTCACCTCTGAC-C3 Spacer, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0100] The FluB probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 15th base T of the probe sequence is labeled with a fluorescent group, the 18th base T of the probe sequence is labeled with a quenching group, the 17th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0101] The modified probe is:

[0102] 5'-AGATGGCCATCGGA-[P-dT]-C-[H-dC]-[B-dT]-CAACTCACTCTCGAGCGTTTTAATGAAGG-C3 Spacer, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0103] The internal standard GAPDH probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 34th base T of the probe sequence is labeled with a fluorescent group, the 37th base T of the probe sequence is labeled with a quenching group, the 36th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

[0104] The modified probe is:

[0105] 5'-GTGTCGCTGTTGAAGTCAGAGGAGACCACCTGG-[P-dT]-G-[H-dC]-[B-dT]-CAGTGTAG-C3 Space, where P is the fluorescent group, H is tetrahydrofuran, and B is the quenching group.

[0106] 2. Sample processing

[0107] The pseudovirus prepared above was subjected to nucleic acid extraction using a magnetic bead kit (from Shengxiang Biotechnology Co., Ltd., catalog number S10015), and the obtained nucleic acid was diluted with deionized water to 2000 copies / mL as a reaction template.

[0108] 3. Preparation of constant temperature amplification system

[0109] Take a 1.5 mL centrifuge tube and prepare a 50 μL reaction system. The configuration parameters are shown in Table 2: 20×Tris buffer 2.5 μL, protease mixture 4 μL, mannosylglycerol 8 μL, dNTPs 3 μL, kinase system 3 μL, polyethylene glycol 12.5 μL, magnesium acetate 2.5 μL, primer probe combination mixture 2 μL, deionized water 2.5 μL. The above components, except magnesium acetate, are prepared into a reaction solution in advance. Before adding the template, magnesium acetate is not added to the reaction solution.

[0110] Table 2 Constant temperature amplification system configuration table

[0111]

[0112]

[0113] 4. Constant temperature amplification

[0114] Using the pseudovirus nucleic acid extracted in step 2 and its dilution as a template, take 10 μL and add it to the constant temperature amplification reaction system shown in step 3, add 2.5 μL of magnesium acetate to the tube cap, cover the tube cap, invert and vortex to mix, and then quickly centrifuge to ensure that it is immediately put on the machine after mixing. Use the Hongshi fully automatic medical PCR analysis system (SLAN-96P) for detection, and the program is set to 39°C, 30s (collecting fluorescence), 40 cycles, and obtain the amplification image.

[0115] Figure 1 Amplification images of influenza A virus H1 / H3, influenza A virus H7 / H9, influenza B virus and internal standard primer probe set with 2000 copies / mL reaction template.

[0116] Comparative Example 1

[0117] Compared with Example 1, the primer-probe combination was replaced with a primer-probe combination for isothermal amplification of influenza A virus and influenza B virus reported before, and other conditions remained unchanged.

[0118] The sequences of the primer probes are shown in Table 3 below:

[0119] Table 3.

[0120]

[0121]

[0122] Experimental Example 1

[0123] (1) Sensitivity test

[0124] The synthesized pseudovirus was quantified, and the template was diluted to 10,000 copies / ml using deionized water, and then diluted to 1,000 copies / ml, 500 copies / ml, 200 copies / ml, and 100 copies / ml using direct expansion cell preservation fluid.

[0125] 10 μL of template was added to the isothermal amplification reaction system of Example 1 and the isothermal amplification reaction system of Comparative Example 1 respectively. After the mixture was centrifuged, it was placed on a Macrostone fully automatic medical PCR analysis system (SLAN-96P) for an amplification reaction at 37° C. for 20 minutes to obtain an amplification image.

[0126] Figure 2 This is the amplification image of the FluA H1 / H3 type primer-probe combination in Example 1. Figure 2 It can be seen that the influenza A virus H1 / H3 pseudovirus sample with 1000 copies / ml in Example 1 can be detected in about 8 minutes, and all samples from 1000 copies / ml to 200 copies / ml can be fully detected, and the detection rate of the influenza A virus H1 / H3 pseudovirus sample with 100 copies / ml can reach 90%.

[0127] Figure 3 This is the amplification image of the FluA H7 / H9 type primer-probe combination in Example 1. Figure 3 It can be seen that the influenza A virus H7 / H9 pseudovirus sample with 1000 copies / ml in Example 1 can be detected in about 8 minutes, and all samples from 1000 copies / ml to 200 copies / ml can be fully detected, and the detection rate of the influenza A virus H7 / H9 pseudovirus sample with 100 copies / ml can reach 85%.

[0128] Figure 4 The amplification image of the FluB primer-probe combination in Example 1 is shown in FIG. Figure 4It can be seen that the influenza B pseudovirus sample with 1000 copies / ml in Example 1 can be detected in about 8 minutes, and all samples from 1000 copies / ml to 200 copies / ml can be fully detected, and the detection rate of the influenza B pseudovirus sample with 100 copies / ml can reach 95%.

[0129] Figure 5 This is the amplification image of the influenza A virus primer-probe combination in Comparative Example 1. Figure 5 It can be seen that the 1000 copies / ml influenza A virus H1 / H3 pseudovirus sample in Comparative Example 1 was detected in about 12 minutes, and the start time was postponed; the 500 copies / ml influenza A virus H1 / H3 pseudovirus sample can be fully detected, but the fluorescence value decreases; the 200 copies / ml influenza A virus H1 / H3 pseudovirus sample can be detected, but the fluorescence value is extremely low; the 100 copies / ml influenza A virus H1 / H3 pseudovirus sample can no longer be detected, and the amplification curve determines it as a negative result. In addition, the influenza A primer probe combination in Comparative Example 1 cannot detect influenza A virus H7 / H9 pseudovirus and real swab samples, and cannot detect influenza A virus H7 / H9.

[0130] Figure 6 This is the amplification image of the influenza B virus primer-probe combination in Comparative Example 1. Figure 6 It can be seen that the influenza B virus pseudovirus sample with 1000 copies / ml in Comparative Example 1 was detected in about 12 minutes, and the starting time was postponed; the influenza B virus pseudovirus sample with 500 copies / ml can be completely detected, but the fluorescence value decreases; the influenza B virus pseudovirus sample with 200 copies / ml can be detected, but the fluorescence value is extremely low, and the detection rate is 20%; the influenza B virus pseudovirus sample with 100 copies / ml can no longer be detected, and is determined to be a negative result by the amplification curve.

[0131] The specific detection comparison between Example 1 and Comparative Example 1 is shown in Table 4.

[0132] Table 4 Comparison of detection rates of influenza A virus and influenza B virus pseudovirus samples between Example 1 and Comparative Example 1

[0133]

[0134] (2) Specificity experiment

[0135] In order to verify the specificity of the influenza A virus and influenza B virus primer-probe composition in Example 1, real swab samples of influenza A virus H1N1, influenza A virus H3N2, influenza A virus H7N9, influenza A virus H9N2, influenza B virus, respiratory syncytial virus, adenovirus, Mycoplasma pneumoniae, human rhinovirus, human herpes virus, and human cytomegalovirus and novel coronavirus liquid quality control products were selected and used as templates as cross-experimental objects, and the nucleic acid was extracted and used as a template for testing.

[0136] The test results of Example 1 (Table 5) show that the influenza A virus and influenza B virus primer-probe combinations of the present invention can only amplify the corresponding virus samples without cross-reaction and have good specificity.

[0137] Table 5 Specificity test results of Example 1

[0138]

[0139] Note: “+” indicates positive, “-” indicates negative.

[0140] (3) Repeatability experiment

[0141] The influenza A virus H1 / H3, influenza A virus H7 / H9 and influenza B virus target sequence pseudovirus nucleic acids in Example 1 were gradiently diluted, and medium and low concentrations were selected as repeatability test concentrations, which were 500 copies / ml and 200 copies / ml, respectively, and each concentration was tested 8 times.

[0142] Figure 7 , Figure 8 , Fig. 9 They are amplification curves of the primer probe sets for influenza A virus H1 / H3, influenza A virus H7 / H9 and influenza B virus in Example 1, and it can be seen that in the repeatability test, the repeatability of the concentration and low concentration in Example 1 is good, the starting time is concentrated, and the fluorescence peak value remains basically consistent, indicating that the present invention has good repeatability.

[0143] (4) Direct expansion test with real samples

[0144] Ten swab samples were selected for testing, and the influenza A and B virus multiple isothermal detection kit (isothermal amplification method) was used to detect influenza A virus and influenza B virus. At the same time, the respiratory six-item virus detection kit (PCR fluorescence method) (from Shengxiang Biotechnology Co., Ltd.) was used as the gold standard for simultaneous detection, and the differences in the test results of the two were compared.

[0145] The results of constant temperature amplification detection and PCR fluorescence detection are shown in Table 6. The detection results of the multiple constant temperature detection kit for influenza A and B (constant temperature amplification method) are completely consistent with those of the respiratory six virus detection kit (PCR fluorescence method). The results of the multiple constant temperature detection kit for influenza A and B (constant temperature amplification method) are accurate.

[0146] Table 6.10 DS detection results of unknown samples

[0147]

[0148] Note: “+” indicates positive, “-” indicates negative.

[0149] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A composition for detecting influenza A virus and influenza B virus, characterized in that: The composition comprises primers and probes, wherein the primers comprise forward primers and reverse primers of FluA-H1 / H3, forward primers and reverse primers of FluA-H7 / H9, and forward primers and reverse primers of FluB; the probes comprise FluA-H1 / H3 probes, FluA-H7 / H9 probes, and FluB probes; The nucleotide sequences of the forward primer, reverse primer and probe of FluA-H1 / H3 are shown in SEQ ID NOs: 1-3, respectively; The FluA-H1 / H3 probe is labeled with a fluorescent group and a quenching group, and is modified with tetrahydrofuran. The 36th base T of the probe sequence is labeled with a fluorescent group, the 39th base T of the probe sequence is labeled with a quenching group, the 37th base C of the probe sequence is modified with tetrahydrofuran, and the 3' end is labeled with C3-spacer; The nucleotide sequences of the forward primer, reverse primer and probe of FluA-H7 / H9 are shown in SEQ ID NOs: 4-6, respectively; The FluA-H7 / H9 probe is labeled with a fluorescent group and a quenching group, and modified with tetrahydrofuran, wherein the 34th base T of the probe sequence is labeled with a fluorescent group, the 37th base T of the probe sequence is labeled with a quenching group, the 36th base C of the probe sequence is modified with tetrahydrofuran, and the 3' end is labeled with C3-spacer; The nucleotide sequences of the forward primer, reverse primer and probe of FluB are shown in SEQ ID NOs: 7-9, respectively; The FluB probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 15th base T of the probe sequence is labeled with a fluorescent group, the 18th base T of the probe sequence is labeled with a quenching group, the 17th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

2. The composition according to claim 1, characterized in that The primers further include an internal standard forward primer GAPDH-F and an internal standard reverse primer GAPDH-R, and the probe further includes an internal standard probe GAPDH-P; The nucleotide sequences of GAPDH-F, GAPDH-R and GAPDH-P are shown in SEQ ID NOs: 10-12, respectively.

3. The composition according to claim 2, characterized in that The GAPDH-P probe is labeled with a fluorescent group and a quenching group and modified with tetrahydrofuran, wherein the 34th base T of the probe sequence is labeled with a fluorescent group, the 37th base T of the probe sequence is labeled with a quenching group, the 36th base C of the probe sequence is modified with tetrahydrofuran and the 3' end is labeled with C3-spacer.

4. The composition according to any one of claims 1 or 3, characterized in that The fluorescent group is selected from at least one of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670, NED, AMCA, Pacific Blue, Atto 425, BODIPY FL, Alexa Fluor 488, Yakima Yellow, Quasar 570, Aqua Phluor593, Atto 590, and Cy5.5; the quenching group is selected from at least one of 6-TAMRA, BHQ-1, BHQ-2, BHQ-3, Dabcyl, Eclipse, MGB, and QYS-7.

5. A kit for detecting influenza A virus and influenza B virus, characterized in that: The kit comprises the composition according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit also includes a buffer, a protease mixture, mannosylglycerol, dNTPs, a kinase system, polyethylene glycol and magnesium acetate; The protease mixture comprises recombinase, single-stranded DNA binding protein, strand displacement DNA polymerase and RT enzyme; The kinase system includes ATP and creatine phosphate.

7. Use of the composition according to any one of claims 1 to 4 or the kit according to any one of claims 5 to 6 in detecting influenza A virus and influenza B virus for non-diagnostic purposes.

8. The use according to claim 7, characterized in that: The reaction system for detecting influenza A virus and influenza B virus comprises the following components by volume: 1-7 parts of buffer, 1.5-5 parts of protease mixture, 4-10 parts of mannosylglyceric acid, 2-4 parts of dNTPs, 2-4 parts of kinase system, 0.4-1 part of forward primer, 0.4-1 part of reverse primer, 0.1-0.5 part of probe, 10-15 parts of polyethylene glycol and 2-3 parts of magnesium acetate.

9. The use according to any one of claims 7-8, characterized in that: The final system concentration of the forward primer is 0.4-1 μM; the final system concentration of the reverse primer is 0.4-1 μM; and the final system concentration of the probe is 0.1-0.5 μM.

Images