Use of cryptosporidium cgd6_2310 protein as an oocyst outer wall marker protein
By using Cryptosporidium cgd6_2310 protein as a marker protein for the outer wall of the oocyst, a specific antibody was prepared, which solved the problem of low sensitivity in existing Cryptosporidium detection methods and achieved efficient and economical oocyst wall detection, suitable for monitoring environmental and clinical samples.
Patent Information
- Application Number
- CN202210804248.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-09
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2042-07-09
AI Technical Summary
The lack of specific antibodies in existing technologies for labeling the outer wall of Cryptosporidium oocysts results in low sensitivity and high cost in Cryptosporidium detection methods, making them difficult to apply on a large scale, especially when the oocyst content in environmental water samples is diluted.
Cryptosporidium cgd6_2310 protein was used as a marker protein for the outer wall of the oocyst. Specific antibodies were prepared and detected by indirect immunofluorescence. The application of recombinant protein and peptide antibodies was combined to achieve specific recognition and enrichment of the oocyst wall.
It improves the sensitivity and specificity of Cryptosporidium detection, reduces detection costs, and is suitable for efficient monitoring of environmental water samples and clinical samples, with broad application potential.
Smart Images

Figure 220706104509 
Figure 220706104517 
Figure 220706104746
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological detection, and particularly relates to an outer wall protein of Cryptosporidium oocyst wall and application thereof. BACKGROUND
[0002] Cryptosporidium is an apicomplexan genus of parasitic protozoa that includes multiple species that infect humans or animals. Among them, the zoonotic Cryptosporidium parvum ( Cryptosporidium parvum ) and the human-specific Cryptosporidium hominis ( Cryptosporidium hominis ) are two major pathogens that cause severe, even fatal diarrhea caused by cryptosporidiosis worldwide; and Cryptosporidium parvum can also infect multiple economic animals including cattle, goats and sheep, causing severe diarrhea and death of their young. Cryptosporidium is a gastrointestinal parasite, mainly transmitted through the fecal-oral route, and hosts are infected after ingesting water or food contaminated with Cryptosporidium. It mainly parasitizes small intestinal epithelial cells, causing symptoms in hosts that vary in severity, mainly moderate to severe diarrhea. In normal immune function of human and animal groups, cryptosporidiosis is generally self-limiting; but in immunocompromised hosts (such as AIDS patients), it is a major cause of death. Cryptosporidium oocysts are round or oval, microscopic size (such as Cryptosporidium parvum oocyst diameter about 5 microns), the main structure includes oocyst wall and its wrapped 4 sporozoites, can survive in the environment for a long time ( Figure 1 ). The structure of the oocyst wall is specific, and can resist conventional sodium hypochlorite disinfection, so Cryptosporidium is a big problem for controlling Cryptosporidium parvum pollution in food (such as vegetables, berries, etc.) and water samples (such as drinking water, recreational water, etc.). So far, there is no specific drug and vaccine for Cryptosporidium parvum, which further increases the demand for Cryptosporidium parvum prevention and control. At present, the detection methods for Cryptosporidium parvum in the environment or in human or animal clinical samples mainly include pathogen detection, molecular biology detection and immunological detection of oocyst or worm antigen. Among them, pathogen detection can directly observe the unstained or labeled oocyst by microscope, but this method is time-consuming and laborious, with very low sensitivity, and requires skilled technicians to operate; the existing molecular biology diagnosis has high sensitivity and specificity, but requires high detection instrument; and the immunological detection method has certain sensitivity and specificity, and is suitable for clinical examination and environmental sample monitoring, but requires antibodies that can specifically label the outer wall of the oocyst. In addition, the content of the worm oocyst in the environment is usually highly diluted, and the oocyst content of some clinical samples is low, and the detection of such samples requires oocyst enrichment and concentration before using the above diagnostic methods (non-specific physical methods: only by centrifugal sedimentation; by high-density liquid flotation combined with centrifugal sedimentation; specific immunological methods: use small particles or small magnetic beads coupled with oocyst outer wall labeling antibodies to capture oocysts, and then collect the particles or magnetic beads by centrifugal sedimentation or magnetic object sedimentation).
[0003] The current domestic clinical detection method of cryptosporidium mainly relies on acid-fast staining method to detect oocysts, which has low specificity and poor sensitivity. There is a fluorescent antibody labeled cryptosporidium oocyst wall diagnostic kit abroad, which uses an oocyst wall protein with unknown specific gene information as an antigen to prepare an antibody fluorescently labeled oocyst wall for microscopic observation and detection. The antibody is also used for immunological enrichment of cryptosporidium oocysts in samples. The detection kit based on the antibody is expensive and not easy to use on a large scale. Moreover, the method of detecting cryptosporidium in environmental water samples or clinical samples by indirect immunofluorescence (IFA) is still blank in China, the main reason being that no protein located on the outer wall of cryptosporidium oocyst wall has been found for the development of specific antibodies for labeling the outer wall of oocyst. Therefore, it is of great significance to find the marker protein of the outer wall of cryptosporidium oocyst wall, to prepare specific antibodies against the outer wall of oocyst according to the marker protein, and to establish related immunological detection methods and sample enrichment methods for the monitoring of cryptosporidium in water samples, the detection and diagnosis of clinical cryptosporidiosis, the epidemiological investigation of human and animal cryptosporidium infection, and the prevention and control of human and animal cryptosporidium. SUMMARY
[0004] The purpose of the present application is to solve the above problems, and to provide a cryptosporidium cgd6_2310 oocyst wall outer wall marker protein molecule for detection and application.
[0005] The cryptosporidium cgd6_2310 protein has a nucleotide sequence as shown in the sequence table SEQ ID N0. 2
[0006] The cryptosporidium cgd6_2310 protein has an amino acid sequence as shown in the sequence table SEQ ID N0. 1.
[0007] The cryptosporidium cgd6_2310 protein is a marker protein of the outer wall of the oocyst wall, and is located on the outer surface of the outer wall of the oocyst wall.
[0008] The cryptosporidium oocyst wall protein specific polypeptide has an amino acid sequence of CLTPQSIERKEGTIID or ELDSSRTPVNETINC.
[0009] The anti-cryptosporidium oocyst wall outer wall protein antibody is an antibody prepared by using the cryptosporidium cgd6_2310 protein, and specifically binds to the outer surface of the outer wall of the cryptosporidium oocyst wall.
[0010] The anti-cryptosporidium oocyst wall outer wall specific polypeptide antibody is an antibody prepared by using the cryptosporidium oocyst wall protein specific polypeptide.
[0011] Application of anti-Cryptospora cgd6_2310 protein antibody or anti-Cryptospora oocyst wall protein specific polypeptide antibody in the detection of Cryptosporidium.
[0012] The Cryptosporidium detected refers to Cryptosporidium oocysts that have not been broken.
[0013] This invention provides a protein from the outer wall of Cryptosporidium oocysts for detection and its application. The inventors have discovered that the Cryptosporidium protein with the amino acid sequence shown in SEQ ID NO.1 is an outer wall protein of the oocyst, located on the outer surface of the Cryptosporidium oocyst wall. The inventors have confirmed the feasibility of using this protein as a detection antigen. The recombinant protein antibody of this protein can be used for the immunological detection of unbroken Cryptosporidium oocysts (live Cryptosporidium oocysts). Furthermore, this invention also provides two specific polypeptides of this protein. Attached Figure Description
[0014] Figure 1 Schematic diagram of Cryptosporidium oocysts;
[0015] Figure 2 Successful amplification of the target fragment of the Cgd6_2310 gene;
[0016] Figure 3 This recombinant protein was used to prove that it is a protein from the outer wall of the ovum sac.
[0017] Figure 4 This is a graph showing the titer of specific polypeptide antibodies.
[0018] Figure 5 Specific polypeptide antibodies were used to confirm, via IFA, that the protein is an outer wall protein of the ovum sac.
[0019] Figure 6 Sensitivity of detection at different titers of peptide antibodies;
[0020] Figure 7 Specificity detection charts for different samples. Detailed Implementation
[0021] Example 1: Recombinant protein expression of the protein from Cryptosporidium microsporidium with the gene cgd6_2310.
[0022] I. Screening of recombinant proteins from Cryptosporidium microsporidium cgd6_2310
[0023] (1) Search for gene number cgd6_2310 on the professional website of Cryptosporidium (http: / / cryptodb.org / cryptodb / ) and download its nucleotide sequence (as shown in SEQ ID NO.2) and amino acid sequence (as shown in SEQ ID NO.1).
[0024] (2) Construction of prokaryotic expression vectors
[0025] For the constructed prokaryotic expression vector:
[0026] The nucleotide sequence of the protein was ligated into the expression vector pET-28a to express the cgd6_2310 recombinant protein.
[0027] Primers were designed targeting the cgd6_2310 base sequence. DNAMAN was used to select suitable restriction enzyme sites. The selected restriction enzyme sites were: upstream: BamH I (GGATCC) Xho I (CTCGAG), and the specificity of the primers was compared using BLAST. The designed primers are shown in the table below: F- CGC GGATCCTCAATTCAAAGAGCAGGGGTGAAGC,
[0028] R- CCG CTCGAGCAATAATTTATAAGACTCTGATTTATCATCATTTTCTGGT,
[0029] The amplified fragment was 777 bp in size. The designed primers were synthesized by Jilin Kumei Biotechnology Co., Ltd.
[0030] Cryptosporidium microsporidium DNA was extracted and used as a template. The primers described above were added, and PCR was performed using a high-fidelity enzyme (Novizan P515-01). The reaction system was: 25 µL of 2× Phanta Max Master Mix premix, 2 µL each of forward and reverse primers, 1 µL of DNA template, and 20 µL of water, for a total volume of 50 µL. The reaction program was: pre-denaturation: 95℃ for 3 min; denaturation: 95℃ for 15 s; annealing: 60℃ for 30 s; extension: 72℃ for 60 s; 72℃ for 5 min, 35 cycles. After identification by nucleic acid electrophoresis, the gene fragment was recovered using a gel extraction kit (see [link to kit]). Figure 2 Then, measure its concentration, perform enzyme digestion, and prepare the empty vector pET-28a at the same time.
[0031] The target fragment and the empty vector pET-28a were double-digested with enzymes. According to the enzyme instructions, the digestion system was 1 μg of plasmid. BamH I, Xho I1 µL each; 2 µL of 10×Buffer; water to 20 µL. Enzyme digestion conditions: 37℃ water bath for 1 h, then check the digestion effect, recover the target fragment by gel, and determine its concentration. Ligate the vector and fragment according to the Solution I (Takara) instructions (fraction to vector molar ratio 5:1) in a 16℃ water bath for 30 min, then transfer to BL21(DE3) competent cells, plate on solid medium containing kanamycin resistance, PCR identification and sequencing, and inoculate the correctly identified expression strain into K+-containing medium. + Cultured in liquid culture medium.
[0032] II. Expression and purification of recombinant proteins
[0033] (1) Screening and optimization of expression conditions
[0034] Strains successfully ligated to the pET-28a vector (His tag) were streaked, and single colonies were cultured in 5 mL of liquid medium for 8-10 h. The bacterial culture was then expanded at a 1:100 ratio for approximately 2 h. When the OD value at 600 nm reached approximately 0.6, expression was induced. IPTG was added to a final concentration of 0.1 mmol / L for induction. Three different induction temperatures and durations were set: 16℃, 12 h; 25℃, 6 h; and 37℃, 3 h. A control group without IPTG was also established to determine the optimal expression conditions.
[0035] (2) Purification of His-tagged recombinant proteins
[0036] 1) After selecting appropriate induction conditions to induce protein expression, collect the bacterial culture, centrifuge at 3500 r / min for 10 min at 4℃, and discard the supernatant.
[0037] 2) Add an appropriate amount of PBS buffer to fully suspend the precipitate.
[0038] 3) Vortex the precipitate with 20 mL of 10 mM imidazole solution, add PMSF (0.5 mmol / L) and Triton X-100 (1%) and mix well. Place the centrifuge tube in an ice-water mixture and use an ultrasonic disruptor to disrupt the bacterial cells. Set the ultrasonic parameters as follows: working time 15 min, ultrasonic 3 s, stop 3 s, power 160 W.
[0039] 4) Centrifuge the sonicated liquid at 16400 rpm / min and 4℃ for 30 min, and collect the supernatant.
[0040] 5) Use His GraviTrap TMRecombinant proteins were purified using a column. After the 20% ethanol in the nickel column had completely eluented, 20 mL of 5 mM imidazole solution was added to equilibrate the column. After the 10 mM imidazole eluent had completely eluented, the supernatant from the lysed bacterial cells was slowly added, and the column was incubated for approximately 2 hours. The eluent was then slowly passed through the nickel column. Subsequently, 20 mM, 40 mM, 60 mM, 80 mM, and 100 mM imidazole were added sequentially for washing. Finally, 1 mL of 500 mM imidazole was added, and the column was incubated for 10 minutes. The eluent was collected, and this process was repeated three times. The entire procedure was performed at 4°C.
[0041] 6) Pre-cool PBS, dialyze the protein to deimidazole, and the dialyzing time should not be less than 1 h to obtain the recombinant protein cgd6_2310. After dialyzing, determine the protein concentration and identify the recombinant protein by SDS-PAGE and Western blot.
[0042] Example 2: Animal Immunization of Recombinant Protein and Preparation of Antibodies and Indirect Immunofluorescence Detection
[0043] I. Immunization Procedures for Laboratory Animals
[0044] New Zealand white rabbits were immunized with recombinant protein. For the first immunization, 300 μg / rabbit (recombinant protein) was emulsified with an equal volume of Freund's complete adjuvant and injected intradermally at multiple sites. Two weeks after the first immunization, 150 μg / rabbit (recombinant protein) was emulsified with an equal volume of Freund's incomplete adjuvant and given as a booster immunization. A total of four immunizations were administered. Serum was collected from the marginal ear vein before the first immunization and 14 days after the fourth immunization. The serum was separated for subsequent testing.
[0045] II. Indirect Immunofluorescence Detection
[0046] For environmental or clinical samples, use saturated saline or sucrose flotation to remove most bacteria and impurities before conducting subsequent tests, and then proceed with the following steps.
[0047] (1) Treatment of coverslips: Treat coverslips with 0.1 mg / mL polylysine for 30 min, rinse once with ddH2O, and air dry at room temperature for 2 h.
[0048] (2) Sample fixation: intact Cryptosporidium oocysts were fixed with 4% paraformaldehyde at room temperature for 30 min, and excess formaldehyde was washed away with PBS.
[0049] (3) Drawing a circle and smearing the sample: Use a histological pen to draw a small circle in the center of the treated coverslip, take 30 μL of sporozoites and drop them into the small circle, and let it stand at room temperature for 1 h;
[0050] (4) Cleaning: Absorb the liquid on the coverslip and wash with PBS 3-4 times, 5 min / time;
[0051] (5) Primary antibody: Dilute the antiserum 1:50 with PBS containing 3% BSA, add 50 μL to a coverslip, and incubate at room temperature for 1 h or at 4°C overnight. (Note: For verification of the outer wall protein of the oocyst: If the antibody is incubated for 15 min and the sample is not permeabilized, it will stain with green fluorescence (if the prepared antibody recognizes this protein, it proves that the protein is the outer wall protein of the oocyst). Figure 1 ).
[0052] (6) Secondary antibody: After washing with PBS, add Alexa Fluor® 488 goat anti-rabbit IgG (1:1000) to each well and incubate at 37 ℃ in the dark for 1 h.
[0053] (7) Nucleus staining: Wash with PBS, add DAPI (4',6-diamidinyl-2-phenylindole) to each well to a final concentration of 1 µg / mL, stain the nucleus at room temperature in the dark for 5 min, and wash with PBS 3-4 times.
[0054] (8) Mounting: Add one drop of anti-fluorescence quenching mounting solution (Beyotime, P0126-5 mL), and observe the slide under a fluorescence microscope after mounting with the mounting solution.
[0055] The results are as follows Figure 3 As shown, the recombinant protein antibodies all confirmed that the protein is an outer wall protein of the Cryptosporidium oocyst wall, and the fluorescence signal was strong, indicating that the protein has potential value in establishing detection methods. To more accurately confirm that it is an outer wall protein of the oocyst wall and to maximize the sensitivity and specificity of detection, we designed two peptide sequences with good specificity for further evidence.
[0056] Example 3: Screening of Cryptosporidium microsporidium cgd6_2310-specific peptides
[0057] (1) Search for gene number cgd6_2310 on the Cryptosporidium professional website (http: / / cryptodb.org / cryptodb / ) and download its amino acid sequence;
[0058] (2) Design of specific peptides
[0059] Screening for specific peptides:
[0060] The downloaded amino acid sequence of the gene was input into swissmodel.expasy.org to predict its spatial structure and identify polypeptide fragments of 10-14 amino acids located in the loop region. Then, using iedb.org, its B-cell epitopes were analyzed, and fragments with high prediction values were selected. Finally, specificity alignment analysis was performed using NCBI, and fragments with high specificity were selected for synthesis.
[0061] (3) To enhance the coupling efficiency of the peptide with KLH and BSA, peptides containing cysteine were selectively avoided during peptide design, and a cysteine residue was artificially added to the end of peptides without cysteine at the N-terminus or C-terminus. The designed peptide sequence is: Cgd6_2310-N:CLTPQSIERKEGTIID;Cgd6_2310-C:ELDSSRTPVNETINC. This peptide was synthesized by Shanghai Qiangyao Biotechnology Co., Ltd.
[0062] (4) Coupling of peptide with KLH / BSA: First, dissolve 1 mg of KLH / BSA in 200 µL of ddH2O. Dissolve 200 µg of MBS (m-maleimide benzoyl-N-hydroxysuccinimide) in 0.04 mL of DMF (dimethylformamide) solution and add it to the carrier protein solution. Mix well at RT for 2 h and dialyze overnight with PBS. Dissolve 2 mg of peptide in 0.4 mL of PBS, and add the overnight dialyzed mixture to two peptide solutions respectively. React at RT for 4 h, dialyze for 12 h, aliquot into 20 µL and store at -20℃. Identify the above-conjugated BSA-peptide using SDS-PAGE.
[0063] Example 4: Animal Immunization and Preparation and Titer Determination of Polyclonal Antibodies
[0064] I. Immunization Procedures for Laboratory Animals
[0065] New Zealand white rabbits were immunized with successfully conjugated peptide (CLTPQSIERKEGTIID / ELDSRTPVNETINC)-KLH. For the first immunization, the conjugated peptide (300 μg / rabbit) was emulsified with an equal volume of Freund's complete adjuvant and injected intradermally at multiple sites. Two weeks later, peptide-KLH (150 μg / rabbit) was emulsified with an equal volume of Freund's incomplete adjuvant as a booster immunization, for a total of four immunizations. Serum samples were collected from the marginal ear vein before the first immunization and 14 days after the fourth immunization; serum was separated for antibody titer determination.
[0066] II. Detection of serum antibody titers using indirect ELISA method
[0067] Using conjugated BSA peptides as the coating antigen, pre-immunization serum served as a negative control, serum after four immunizations served as the primary antibody, and alkaline phosphatase (AP)-labeled goat anti-rabbit IgG (H+L) served as the secondary antibody, indirect ELISA was performed. The final concentration of the coating antigen was 5 μg / mL. Serum was serially diluted starting at 1:500, and the secondary antibody was diluted 1:20000. After adding the chromogenic buffer, the A405 value was measured using an ELISA reader.
[0068] (1) Coating antigen: Dilute the successfully conjugated peptide-BSA 5 µg / mL with Coating Buffer (0.05 M carbonate buffer at pH 9.6), 50 µL / well, 37°C for 1 h, then overnight at 4°C; or proceed to the next step after 2 h at 37°C.
[0069] (2) Washing the plate: Wash the plate with Washing Buffer (0.05% Tween-20, 8g NaCl / L) and use an ELISA plate washer to wash the plate 3-4 times, with an interval of 4 min each time.
[0070] (3) Blocking: Add 100 µL of Blocking Buffer (3% BSA in 0.05 M carbonate buffer at pH 9.6) per well and incubate at 37°C for 1 h.
[0071] (4) Washing the plate: Same as step (2).
[0072] (5) Incubation of primary antibody: Dilute the antibody with Tween Buffer (PBS solution containing 0.5% BSA and 0.05% Tween-20). Use serum before the first immunization as negative control, serum after the last immunization as positive antibody, and serum before immunization as negative control. Dilute the antibody at dilution ratios of 1:500, 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000. Use 50 µL per well and incubate at 37°C for 1 h.
[0073] (6) Washing the plate: Same as (2)
[0074] (7) Incubation with enzyme-labeled secondary antibody: Use Tween Buffer, dilute alkaline phosphatase-labeled goat anti-rabbit IgG (H+L) 1:20000 as secondary antibody, 50 µL / well, incubate at 37℃ for 1 h.
[0075] (8) Washing the board: Same as (2)
[0076] (9) Color development: Prepare a 1 mg / mL color development solution (PNPP substrate color development) using color development buffer, 50 µL / well, and develop the color at 37℃ in the dark for 10-20 min. Then, use an ELISA reader to detect the A405 reading. Use the BSA-conjugated peptide as the detection coating antigen and use the ELISA method to detect the antibody titer of rabbit serum immunized with KLH-peptide.
[0077] The results are as follows Figure 4 As shown, after four immunizations of rabbits, the effective serum titer reached 1:32,000, which was sufficient for subsequent experiments.
[0078] Example 5: Indirect immunofluorescence detection of samples
[0079] For environmental or clinical samples, use saturated saline or sucrose flotation to remove most bacteria and impurities before conducting subsequent tests, and then proceed with the following steps.
[0080] (1) Treatment of coverslips: Treat coverslips with 0.1 mg / mL polylysine for 30 min, rinse once with ddH2O, and air dry at room temperature for 2 h.
[0081] (2) Sample fixation: Intact oocysts were fixed with 4% paraformaldehyde at room temperature for 30 min, and excess formaldehyde was washed away with PBS.
[0082] (3) Drawing a circle and smearing the sample: Use a histological pen to draw a small circle in the center of the treated coverslip, take 30 μL of sporozoites and drop them into the small circle, and let it stand at room temperature for 1 h;
[0083] (4) Cleaning: Absorb the liquid on the coverslip and wash with PBS 3-4 times, 5 min / time;
[0084] (5) Primary antibody: Dilute 1 μL of anti-peptide serum 1:50 with PBS containing 3% BSA (bovine serum albumin), then add 50 μL to a coverslip and incubate at room temperature for 1 hour or at 4°C overnight. (Note: For verification of oocyst wall outer wall proteins: If the antibody is incubated for 15 minutes and the sample is not permeabilized, and fluorescence is observed, then the protein is an oocyst wall outer wall protein.) Figure 1 ).
[0085] (6) Secondary antibody: After washing with PBS, add Alexa Fluor® 488 goat anti-rabbit IgG (1:1000) to each well and incubate at 37 ℃ in the dark for 1 h.
[0086] (7) Nucleus staining: Wash with PBS, add DAPI (4',6-diamidinyl-2-phenylindole) to each well to a final concentration of 1 µg / mL, stain the nucleus at room temperature in the dark for 5 min, and wash with PBS 3-4 times.
[0087] (8) Mounting: Add one drop of anti-fluorescence quencher, mount the slide with mounting solution, and observe it under a fluorescence microscope.
[0088] like Figure 5 As shown, the specific polypeptide antibody targeting this protein segment 2 can sensitively and specifically recognize the oocyst wall of Cryptosporidium, and the rabbit serum antibody against this polypeptide exhibits good sensitivity, such as... Figure 6 As shown, the fluorescence intensity was very bright when the serum was diluted 1:50. As the antibody was continuously diluted, the fluorescence intensity gradually weakened. When the serum was diluted to 1:800, there was still a weak fluorescence. This experiment shows that the serum antibody has good sensitivity.
[0089] In the detection of samples in the environment, such as Figure 7 As shown, the polypeptide antibody only recognizes Cryptosporidium oocysts (Cryptospora microsporidium and Cryptosporidium taizer in the above image) and does not cross-react with other species (Escherichia coli, coccidia, etc.), indicating that the antibody has good specificity.
[0090] Therefore, selecting this outer wall protein of the oocyst as a candidate antigen has great potential as a diagnostic reagent for detecting Cryptosporidium in environmental water samples or clinical samples.
Claims
1. Cryptosporidium oocyst wall protein-specific polypeptide, characterized in that: Its amino acid sequence is CLTPQSIERKEGTIID.
2. A polyclonal antibody against a specific polypeptide on the outer wall of a Cryptosporidium oocyst, characterized in that: It is a polyclonal antibody prepared by conjugating KLH with the Cryptosporidium oocyst wall protein-specific polypeptide as described in claim 1.
3. The application of the polyclonal antibody against the specific polypeptide of the outer wall of Cryptosporidium oocyst as described in claim 2 in the preparation of a kit for detecting Cryptosporidium.
4. The application according to claim 3, characterized in that: The Cryptosporidium mentioned refers to Cryptosporidium oocysts that have not been broken.
Citation Information
Patent Citations
Protein marked on outer wall of oocyst wall of cryptosporidium for detection and application thereof
CN114031679A