A method for improving the gas fermentation of Clostridium and its application

Abstract

The present invention relates to the technical field of metabolic engineering bacteria, and in particular to a method and application for improving the gas fermentation of Clostridium, by overexpressing CLJU_c18450 on plasmid Ppta-18450, and introducing the constructed plasmid Ppta-18450 into a standard strain of Clostridium jundal through electroporation transformation. Through the above design, the present invention can improve the CO2 / CO utilization ability and product synthesis ability of Clostridium.

Description

Technical Field

[0001] The invention relates to the technical field of metabolic engineering bacteria, and in particular to a method for improving the gas fermentability of clostridium and its application. Background Art

[0002] Carbon gases such as carbon dioxide (CO2) and carbon monoxide (CO) can be absorbed and utilized by microorganisms, which can alleviate environmental problems while generating high-value chemicals to bring economic benefits. Synthesis gas emitted by industry is one of the main sources of carbon dioxide (CO2) and carbon monoxide (CO). Synthesis gas mainly contains CO, CO2, H2 and other gases, which can be used as raw materials for the autotrophic growth of Clostridium aerophaga. Among them, CO and CO2 can be used as carbon sources, while H2 can be used as energy.

[0003] Acetogenic bacteria are a type of obligate anaerobes that have attracted attention due to their unique Wood-Ljungdahl (WL) pathway (also known as the reductive acetyl-CoA pathway) to fix CO2 or other one-carbon substrates. Clostridium is the most important member of this type of microorganisms. It can use carbon-containing gases to achieve rapid bacterial growth and has a strong ability to produce ethanol and butanol, making it an ideal CO / CO2 bioconversion microorganism. Among them, Clostridium ljungdahlii is the most popular one, which can produce high levels of ethanol, butyric acid, isopropanol, isoglutaric acid and other compounds.

[0004] However, the natural WL pathway of Clostridium ljungdahlii is inefficient, and it is urgent to develop C. ljungdahlii with better performance for gas fermentation and conversion utilization. Metabolic engineering of Clostridium ljungdahlii is an effective means to achieve the above goals.

[0005] However, since Clostridium jundal is a strict anaerobic bacterium that is difficult to culture and its powerful restriction modification system can efficiently degrade foreign DNA, the efficiency of exogenous DNA transformation of Clostridium jundal is very low. Therefore, it is currently difficult to genetically manipulate the bacterium, resulting in slow progress in related research. Summary of the invention

[0006] In order to solve the technical defects mentioned in the above background technology, one of the objects of the present invention is to provide a method for improving the gas fermentation of Clostridium, which can improve the CO2 / CO utilization ability and product synthesis ability of Clostridium.

[0007] The present invention adopts the following technical solution:

[0008] A method for improving the gas fermentation of Clostridium, wherein the Clostridium is Clostridium ljungdahlii, which is derived from the standard strain of Clostridium ljungdahlii of the German National Culture Collection DSMZ, with the collection number of DSM NO.13528;

[0009] S1: Construction of overexpression plasmid, overexpressing gene CLJU_c18450 in Clostridium jundal. Plasmid P pta -18450, the plasmid backbone used was pMTL83151, and the promoter used to drive gene expression was P pta The specific operation process is as follows: the above-mentioned genome of the standard strain of Clostridium jundal was used as a template, and the gene CLJU_c18450 was amplified by PCR method, and the primers were 18450-F and 18450-R, and the primers P pta -F and P pta -R amplification promoter P pta Then, the PCR amplified products CLJU_c18450 and P pta At the same time, primer P was used as a template. pta -F and 18450-R, and DNA fragment P was obtained by PCR amplification again pta -18450, then, the plasmid backbone pMTL83151 was double-digested with Thermo fast-cutting enzymes XbaI and BamHI. Since the DNA fragment P obtained by the above amplification pta There is a homologous sequence of more than 21 bp between -18450 and the digested plasmid backbone, and the two can generate a circular P pta -18450 plasmid, which was transformed into competent E. coli TOP10 cells and plated on a solid medium containing chloramphenicol for culture. The single colony grown within 24 hours was the one containing P pta -18450 plasmid E. coli transformants,

[0010] The primer sequences used are as follows:

[0011] 18450-F:

[0012] 5'TAAATTTAAAGGGAGGAAATGAACatgaataaaactcaaaatacatttataacatcaag3';

[0013] 18450-R:

[0014] 5'tggacgcgtgacgtcgactctagattattttttttcaaaactaccaccttttttaaaag3';

[0015] P pta -F:

[0016] 5'cgaattcgagctcggtacccggggatccAGAAATTTTCCTTTCTAAAATATTTTATTCC3';

[0017] P pta -R:

[0018] 5'GTTCATTTCCTCCCTTTAAATTTAAC 3';

[0019] S2: Preparation of electroporation competent cells of Clostridium jundal. The Clostridium jundal preserved in glycerol was inoculated into liquid culture medium for activation culture. 600 When the OD reaches 0.8-1.0, use an inoculation loop to take a small amount of bacterial solution, streak on the solid culture medium, culture anaerobically, pick a single colony grown on the plate, inoculate it into 5 mL of liquid culture medium, and wait until it grows to OD 600 When the inoculum concentration is 0.8-1.0, transfer the bacterial solution to 200 mL of liquid culture medium at a 5% (v / v) inoculum for expansion. The latter is grown to 0D 600 When the pH is 0.4-0.5, add sucrose solution and glycine solution, treat for 2 hours, place it on ice for 20 minutes, and collect the cells by centrifugation, remove the supernatant, wash the cells 2-3 times with pre-cooled buffer, then completely discard the supernatant, and finally, resuspend the cells with 2-3 mL of buffer and store them at -80°C for later use;

[0020] S3: Electroporation transformation of Clostridium Jondal. The constructed plasmid Ppta-18450 was introduced into the standard strain of Clostridium Jondal through electroporation transformation.

[0021] Preferably, the electroporation step of Clostridium jundal is as follows: 4 μg of plasmid is mixed with 200 μL of competent medium, incubated on ice for 10 min, and then transferred to a pre-cooled 2 mm electroporation cup, the electroporation cup containing the mixed solution is placed in an electroporator, electroporated, and then 800 μL of liquid culture medium is quickly added as a resuscitation solution, resuscitated for 6-20 hours, and then spread on a solid culture medium with chloramphenicol resistance. After anaerobic culture for 3-4 days, the colonies grown on the solid culture medium obtain the engineered strain.

[0022] The second purpose of the present invention is to use the engineered strain prepared above to synthesize ethanol using CO2, CO and H2, so as to increase the ethanol production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a schematic diagram of the growth of Clostridium Yongdal in Example 1 of the present invention under the induction of low concentration formate;

[0024] Figure 2 is a schematic diagram of the arginine deiminase pathway of Example 1 of the present invention;

[0025] Figure 3 is a schematic diagram of different promoters driving CLJU_c18450 in Example 3 of the present invention;

[0026] Figure 4 is P of Example 4 of the present invention pta Schematic diagram of the effect of promoter-driven CLJU_c18450 gene expression on ethanol production of gaseous fermentation products. DETAILED DESCRIPTION

[0027] In order to make the content of the present invention more clearly understood, the present invention is further described below based on specific embodiments in conjunction with the accompanying drawings.

[0028] In the following examples, the Clostridium jendalii used is DSM NO.13528.

[0029] Example 1

[0030] Experimental steps:

[0031] 1. Spread the bacterial solution on the solid culture medium, pick the colonies grown on the flat solid culture medium after culturing at 37°C for 4 days, and inoculate them into the liquid culture medium to make the first-level fermentation seeds. Subsequently, the first-level seeds cultured overnight were transferred to the new liquid culture medium to make the second-level fermentation seeds. When the second-level seeds grew to OD600 of 1.0, the second-level seeds were transferred to a serum bottle containing 30mL of liquid culture medium at a transfer volume of 5% (v / v), and synthetic gas (CO-CO2-H2-N2, the volume ratio of each component was 56% / 20% / 9% / 15%) was used as the carbon source, and placed in a 37°C shaking table with an oscillation frequency of 100rpm, and the gas pressure was set to 0.2MPa. All experimental operations were carried out under anaerobic conditions, and the synthetic gas in the serum bottle was replaced every 24 hours. The experimental group added sodium formate (FA) with a final concentration of 0.25g / L in the fermentation medium, and the control group did not add sodium formate.

[0032] 2. Comparative transcriptome analysis. The sample preparation process is as follows: Fermentation of Clostridium jundal in 120 mL of culture medium. During the fermentation process, when the bacterial concentration reaches OD 600 =1.0, 0, 2, and 4 g / L sodium formate were added to the fermentation medium, and samples were taken 24 h after the addition of sodium formate. The fermentation broth was collected by centrifugation (temperature 4 ° C, speed 5000 rpm, time 10 min) and frozen in liquid nitrogen. The frozen samples were evenly ground and dissolved in Trizol reagent, and sent to Shanghai Bohao Biochip Company for RNA-seq experiments.

[0033] Example 2

[0034] S1. Construction of overexpression plasmid. The gene CLJU_c18450 was overexpressed in Clostridium jundal and fermentation test of the engineered strain was performed. pta -18450. The plasmid backbone used was pMTL83151, which is a common gene expression plasmid in Clostridium jundal (Zhang et al., 2020). The promoter used to drive gene expression was P pta , which has been reported as a strong promoter that can be used for gene overexpression in Clostridium jondahlii (Jones et al., 2016).

[0035] The specific operation process is as follows: the genome of the above-mentioned standard strain of Clostridium jundal was used as a template to amplify the gene CLJU_c18450 using the PCR method, with primers 18450-F and 18450-R, and primers P pta -F and P pta -R amplification promoter P pta Then, the PCR amplified products CLJU_c18450 and P pta At the same time, primer P was used as a template. pta -F and 18450-R, and DNA fragment P was obtained by PCR amplification again pta -18450, then, the plasmid backbone pMTL83151 was double-digested with Thermo fast-cutting enzymes XbaI and BamHI. Since the DNA fragment P obtained by the above amplification pta There is a homologous sequence of more than 21 bp between -18450 and the digested plasmid backbone, and the two can generate a circular P pta -18450 plasmid, which was transformed into competent E. coli TOP10 cells and plated on a solid medium containing chloramphenicol for culture. The single colony grown within 24 hours was the one containing P pta -18450 plasmid E. coli transformants,

[0036] The primer sequences used are as follows:

[0037] 18450-F:

[0038] 5'TAAATTTAAAGGGAGGAAATGAACatgaataaaactcaaaatacatttataacatcaag3';

[0039] 18450-R:

[0040] 5'tggacgcgtgacgtcgactctagattattttttttcaaaactaccaccttttttaaaag3';

[0041] P pta -F:

[0042] 5'cgaattcgagctcggtacccggggatccAGAAATTTTCCTTTCTAAAATATTTTATTCC3';

[0043] P pta -R:

[0044] 5'GTTCATTTCCTCCCTTTAAATTTAAC 3'.

[0045] S2. Preparation of electroporation competent cells of Clostridium jundal. Inoculate Clostridium jundal stored in 30% glycerol at ultra-low temperature into liquid culture medium and activate the culture at 37°C. 600 When the OD reaches 0.8-1.0, use an inoculation loop to take a small amount of bacterial solution, streak it on the solid culture medium, and culture it anaerobically at 37°C. Pick a single colony grown on the plate and inoculate it into 5 mL of liquid culture medium. Wait until it grows to OD 600 When the inoculum concentration is 0.8-1.0, transfer the bacterial solution to 200 mL of liquid culture medium at a 5% (v / v) inoculum for expansion. 600 When the concentration is 0.4-0.5, add sucrose solution (final concentration is 0.3M) and glycine solution (final concentration is 0.125M), treat for about 2 hours, place it on ice for 20 minutes, and centrifuge (temperature 4°C, speed 4500rpm, time 10min) to collect the bacteria. Remove the supernatant, wash the bacteria 2-3 times with pre-cooled buffer, and then completely discard the supernatant. Finally, resuspend the bacteria with 2-3mL buffer and store it at -80°C for use.

[0046] S3. Transformation of Clostridium jundal by electroporation. Constructed plasmid P pta-18450 was introduced into the standard strain of Clostridium jundal through electroporation transformation. The specific steps are: take 4μg of plasmid and mix with 200μL of competent medium, incubate on ice for 10 minutes, and then transfer to a pre-cooled 2mm electroporation cup. Place the electroporation cup containing the mixed solution in an electroporator, electroshock, and then quickly add 800μL of liquid culture medium as a resuscitation solution, resuscitate for 6-20 hours, and then spread on a solid culture medium with chloramphenicol resistance (working concentration is 5mg / L). After 3-4 days of anaerobic culture at 37°C, the colonies grown on the solid culture medium are identified by colony PCR using primers M13R and 18450-SEQ-R. The engineered strain containing the target plasmid can obtain a DNA fragment of the expected size.

[0047] The primers used are as follows:

[0048] M13R:

[0049] 5'caggaaacagctatgacc 3'

[0050] 18450-SEQ-R:

[0051] 5'gtaaatacaaaattccaatacccaataaaag 3'

[0052] For the blank control experiment, a control strain containing the pMTL83151 empty plasmid (no gene was overexpressed) was prepared (the preparation method was the same as above).

[0053] Example 3

[0054] Syngas fermentation experiments were carried out with the engineered strains and the control strains.

[0055] The bacterial liquid of the engineered strain and the control strain were spread on the solid culture medium respectively. After culturing at 37°C for 4 days, the colonies grown on the solid culture medium were picked and inoculated into the liquid culture medium to prepare the first-level fermentation seeds. Subsequently, the first-level seeds cultured overnight were transferred to a new liquid culture medium to prepare the second-level fermentation seeds. When the second-level seeds grew to OD 600 The pH value was 1.0, and the secondary seeds were transferred to a serum bottle containing 30 mL of liquid culture medium at a transfer volume of 5% (v / v), and syngas (CO-CO2-H2-N2, the volume ratio of each component was 56% / 20% / 9% / 15%) was used as the carbon source. The cells were placed in a 37°C shaker with an oscillation frequency of 100 rpm and the gas pressure was set to 0.2 MPa. All experimental operations were carried out under anaerobic conditions, and the syngas in the serum bottle was replaced every 24 hours.

[0056] Example 4

[0057] Liquid chromatography was used to detect the product content of the gas-eating fermentation engineering strain and the control strain.

[0058] Experimental results:

[0059] like Figure 1 As shown in the figure, although there was no difference in growth between the strains added with 0.25 g / L sodium formate and the control strain at 0 o'clock and 24 o'clock, there was a significant difference in growth between the experimental group and the control group after the logarithmic growth period. The highest biomass (OD 600 ) was 14.55% higher than that of the control strain. This result suggests that the addition of formic acid may promote the expression of gas utilization-related genes in Clostridium jundal, thereby affecting the utilization of syngas by Clostridium jundal.

[0060] like Figure 2 As shown, directly overexpressing CLJU_c18450 in Clostridium jundal can also significantly improve strain growth. Further sequence comparison revealed that CLJU_c18450 is an arginine transporter AcrD, which helps arginine to be transported into the cell, where it is further degraded through the arginine deiminase (ADI) pathway to generate citrulline, which then reacts to produce ATP.

[0061] like Figure 3 As shown, further syngas fermentation experiments verified that P pta The promoter-driven overexpression of CLJU_c18450 can significantly improve the fermentation performance of Clostridium jundal. The maximum biomass (OD 600 ) was 33.27% higher than that of the control strain.

[0062] like Figure 4 As shown, the product content of Clostridium jundal of gas fermentation was detected by liquid chromatography, and it was found that the ethanol production of the engineered strain overexpressing CLJU_c18450 was increased by 31.24% compared with the control strain.

Claims

1. A method for improving the gas fermentability of Clostridium, characterized in that: The clostridium is Clostridium jundal ( Clostridium ljungdahlii ) ， The standard strain of Clostridium jondahlii from the German National Culture Collection DSMZ, with the accession number DSM NO.13528; S1: Construction of plasmid Ppta-18450 for overexpressing gene CLJU_c18450. The plasmid backbone used was pMTL83151, and the promoter used to drive gene expression was P pta The specific operation process is as follows: the above-mentioned genome of the standard strain of Clostridium jundal was used as a template, and the gene CLJU_c18450 was amplified by PCR method, and the primers were 18450-F and 18450-R, and the primers P pta -F and P pta -R amplification promoter P pta Then, the PCR amplified products CLJU_c18450 and P pta At the same time, primer P was used as a template. pta -F and 18450-R, and DNA fragment P was obtained by PCR amplification again pta -18450, then, the plasmid backbone pMTL83151 was double-digested with Thermo fast-cutting enzymes XbaI and BamHI, and the DNA fragment P pta There is a homologous sequence of more than 21 bp between -18450 and the digested plasmid backbone, and the two generate a circular P pta -18450 plasmid, which was transformed into competent E. coli TOP10 cells and plated on solid medium containing chloramphenicol for culture. The single colony grown within 24 h was the one containing P pta -18450 plasmid E. coli transformants, The primer sequences used are as follows: 18450-F： 5'TAAATTTAAAGGGAGGAAATGAACatgaataaaactcaaaatacatttataacatcaag 3'; 18450-R： 5'tggacgcgtgacgtcgactctagattattttttttcaaaactaccaccttttttaaaag 3'; P pta -F: 5'cgaattcgagctcggtacccggggatccAGAAATTTTCCTTTCTAAAATATTTTATTCC 3'; P pta -R: 5'GTTCATTTCCTCCCTTTAAATTTAAC 3'; S2: Preparation of electroporation competent cells of Clostridium jundal. The Clostridium jundal preserved in glycerol was inoculated into liquid culture medium for activation culture. 600 When the OD reaches 0.8-1.0, use an inoculation loop to take a small amount of bacterial solution, streak on the solid culture medium, culture anaerobically, pick a single colony grown on the plate, inoculate it into 5 mL of liquid culture medium, and wait until it grows to OD 600 When the inoculum density is 0.8-1.0, transfer the bacterial solution to 200 mL of liquid culture medium at a 5% (v / v) inoculum for expansion. The latter is grown to 0D 600 When the pH is 0.4-0.5, add sucrose solution and glycine solution, treat for 2 hours, place it on ice for 20 minutes, and collect the cells by centrifugation, remove the supernatant, wash the cells 2-3 times with pre-cooled buffer, then completely discard the supernatant, and finally, resuspend the cells with 2-3 mL of buffer and store them at -80°C for later use; S3: Electroporation transformation of Clostridium jundal. The constructed plasmid Ppta-18450 was introduced into the standard strain of Clostridium jundal through electroporation transformation to obtain an engineered strain.

2. A method for improving the gas fermentation of Clostridium according to claim 1, characterized in that: The steps of electroporation of Clostridium jundal are as follows: 4 μg of plasmid is mixed with 200 μL of competent medium, incubated on ice for 10 minutes, and then transferred to a pre-cooled 2 mm electroporation cup, the electroporation cup containing the mixed solution is placed on an electroporator, electroporated, and then 800 μL of liquid culture medium is quickly added as a resuscitation solution, resuscitated for 6-20 hours, and then spread on a solid culture medium with chloramphenicol resistance. After anaerobic culture for 3-4 days, the colonies grown on the solid culture medium obtain the engineered strain.

3. Use of the engineered strain according to claim 2 to synthesize ethanol using CO2, CO and H2.

Images