Corynebacterium glutamicum variant with enhanced L-citrulline production ability, and method for producing L-citrulline using the same
By deleting the NCgl2816 gene in the Corynebacterium glutamicum strain, the activity of transporter was weakened or inactivated, and the problem of insufficient productivity of L-citrulline was solved, and high yield and high purity L-citrulline production was achieved.
Patent Information
- Application Number
- CN202180061834.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-09-29
- Filing Date
- 2021-03-23
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2041-03-23
AI Technical Summary
In the prior art, the L-citrulline productivity of the Corynebacterium glutamicum strain is insufficient and it is difficult to significantly improve through traditional methods.
The productivity of L-citrulline is increased by deleting the NCgl2816 gene in the Corynebacterium glutamicum strain, or inactivated transporters involved in the L-citrulline biosynthesis pathway.
High yield and high concentration of L-citrulline production is achieved, and the production of by-product 6-acetylornithine is reduced, which improves the purity and production efficiency of L-citrulline.
Smart Images

Figure BDA0004116447230000071 
Figure BDA0004116447230000081 
Figure BDA0004116447230000082
Abstract
Description
Technical Field
[0001] The present invention relates to a mutant strain of Corynebacterium glutamicum having improved L-citrulline productivity, and a method for producing L-citrulline using the mutant strain. Background Art
[0002] L-citrulline is a non-essential amino acid, and citrulline is known to have useful effects such as promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, neurotransmission, enhancing immunity, and scavenging reactive oxygen species. Such citrulline is synthesized as an intermediate during arginine biosynthesis. Arginine biosynthesis in microorganisms proceeds from L-glutamic acid through two different pathways (linear pathway and cyclic pathway) via eight enzymatic steps. In the linear pathway, L-arginine is synthesized from L-glutamic acid via N-acetylglutamic acid, N-acetylornithine, ornithine, citrulline, and argininosuccinic acid.
[0003] L-citrulline is generally produced by fermentation using microorganisms such as bacteria or yeast, and the production of L-citrulline can be carried out using naturally occurring wild-type strains or mutant strains modified from wild-type strains to have improved citrulline productivity. Recently, in order to improve the production efficiency of L-citrulline, genetic recombination techniques have been applied to microorganisms such as Escherichia coli and Corynebacterium, which have been widely used for the production of L-amino acids and other useful substances, and various recombinant strains or mutant strains having excellent L-citrulline productivity, and methods for producing L-citrulline using the same have been developed. According to Korean Patent Nos. 10-1102263 and 10-1053429, it has been determined that the productivity of L-citrulline is improved by enhancing or weakening the activity or expression of proteins (such as enzymes and transcription factors) involved in L-citrulline biosynthesis. Therefore, it is expected that the production of L-citrulline can also be regulated by regulating the activity or expression of various proteins involved in the L-citrulline biosynthesis pathway.
[0004] [Prior Art Documents]
[0005] [Patent Documents]
[0006] Korean Patent No. 10-1102263
[0007] Korean Patent No. 10-1053429 Summary of the Invention
[0008] Technical Problem
[0009] An object of the present invention is to provide a mutant strain of Corynebacterium glutamicum having improved L-citrulline productivity.
[0010] Another object of the present invention is to provide a method for producing L-citrulline using the mutant strain.
[0011] Technical solution
[0012] The inventors of the present invention have conducted research on developing a new mutant strain with improved L-citrulline productivity using Corynebacterium glutamicum strains, and as a result, found that the production of L-citrulline is increased when the NCgl2816 gene encoding a transporter or transport protein involved in the L-citrulline biosynthetic pathway is removed, thereby completing the present invention.
[0013] One aspect of the present invention provides a Corynebacterium glutamicum mutant strain in which the activity of the protein expressed by the NCgl2816 gene has been attenuated or inactivated and which has improved L-citrulline productivity.
[0014] As used herein, the term "NCgl2816 gene" refers to a gene encoding a putative integral membrane transporter among multiple secondary transporters involved in active transport, which overcomes the concentration gradient between the extracellular and intracellular during the movement of substances through the cell membrane and selectively absorbs or releases nutrients.
[0015] According to one embodiment of the present invention, the NCgl2816 gene may be derived from a strain of the genus Corynebacterium. In particular, the Corynebacterium strain may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi or Corynebacterium flavescens, but is not limited thereto.
[0016] According to one embodiment of the present invention, the NCgl2816 gene may consist of the nucleotide sequence of SEQ ID NO:1. According to another embodiment of the present invention, the NCgl2816 gene may encode the amino acid sequence of SEQ ID NO:2.
[0017] According to one embodiment of the present invention, the protein expressed by the NCgl2816 gene is a transporter involved in the L-citrulline biosynthetic pathway, and the effect of this transporter on the production of L-citrulline is unknown or unstudied. However, the present inventors have found that when the NCgl2816 gene encoding the transporter is deleted, membrane stability can be improved, the release of L-citrulline can be increased, the release of the intermediate 6-acetylornithine, which was additionally detected in the overproduction of L-citrulline, can be inhibited, and thus L-citrulline can be produced in high yield and high concentration.
[0018] As used in the present invention, "attenuated activity" means that the expression level of the gene of interest has been reduced compared to the original expression level. The term "attenuated activity" also includes: cases where the activity of the protein itself is reduced compared to the activity of the protein in the parental microorganism due to substitution, insertion, deletion, or a combination of one or more nucleotides in the nucleotide sequence of the encoding gene; cases where the overall activity of the enzyme in the cell is lower than that in the natural strain, wild-type strain, or the strain before modification due to reduced expression or translation of the gene encoding the enzyme; and combinations thereof.
[0019] As used in the present invention, "inactivated" means that the gene encoding a protein such as an enzyme, transcription factor, or transporter is not expressed at all compared to those in the natural strain, wild-type strain, or the strain before modification, or the gene has no activity even if it is expressed.
[0020] According to one embodiment of the present invention, by deleting the NCgl2816 gene from a Corynebacterium glutamicum strain, a Corynebacterium glutamicum mutant strain with improved L-citrulline productivity was obtained compared to the wild-type Corynebacterium glutamicum strain or a Corynebacterium glutamicum mutant strain previously developed for overproducing citrulline.
[0021] As used herein, the term "improved productivity" means that the L-citrulline productivity is improved as compared to the L-citrulline productivity in the parental strain. As used herein, the term "parental strain" refers to a wild-type strain or a mutant strain to be mutated, and includes a strain to be directly mutated or a strain to be transformed with a recombinant vector or the like. In the present invention, the parental strain may be a wild-type Corynebacterium glutamicum strain or a strain mutated from a wild-type strain. For example, the parental strain may be a Corynebacterium glutamicum mutant strain having enhanced ornithine carbamoyltransferase and carbamoyl phosphate synthase activities to overproduce citrulline (see Korean Patent Application No. 10-2019-0151321).
[0022] According to one embodiment of the present invention, a Corynebacterium glutamicum mutant strain having improved L-citrulline productivity exhibits improved L-citrulline productivity as compared to the parental strain. In particular, the amount of L-citrulline produced by the Corynebacterium glutamicum mutant strain may be at least 0.5% higher, particularly 0.5% to 5% higher, than the amount of L-citrulline produced by the parental strain, while the amount of 6-acetylornithine produced as a by-product may be at least 20% lower, particularly 20% to 50% lower, than the amount of 6-acetylornithine produced by the parental strain.
[0023] The Corynebacterium glutamicum mutant strain according to one embodiment of the present invention can be obtained by a recombinant vector that deletes the NCgl2816 gene in the parental strain.
[0024] As used herein, the term "vector" refers to any vehicle for cloning and / or transferring nucleic acids into a host cell. A vector may be a replicon capable of ligating additional DNA fragments to cause replication of the ligated fragments. The term "replicon" refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., is capable of replicating under its own control. In the present invention, the vector is not particularly limited as long as it can replicate in the host, and any vector known in the art can be used. The vector for constructing the recombinant vector may be a plasmid, cosmid, virus, or phage in a natural state or a recombinant state. Some examples of phage vectors or cosmid vectors that can be used include, but are not limited to, pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, and Charon21A, and some examples of plasmid vectors that can be used include, but are not limited to, pDZ vectors, and pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors.
[0025] As used herein, the term "transformation" means introducing a gene into a host cell such that the gene can be expressed in the host cell. The transformed gene can include any gene, whether the gene is inserted into the chromosome of the host cell or is outside the chromosome, as long as the gene can be expressed in the host cell.
[0026] According to one embodiment of the present invention, the transformation method includes any method of introducing nucleic acid into a cell, and can be carried out using suitable standard techniques known in the art and selected according to the host cell. Some examples of transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.
[0027] According to one embodiment of the present invention, as a transformation method, the electroporation method (van der Rest et al., Appl. Microbiol. Biotechnol., 52, 541-545, 1999) can be used.
[0028] Host cells include cells transfected, transformed, or infected in vivo or in vitro with the recombinant vector or polynucleotide of the present invention. A host cell containing the recombinant vector of the present invention is a recombinant host cell, a recombinant cell, or a recombinant microorganism.
[0029] In addition, the recombinant vector according to the present invention may contain a selection marker. The selection marker is used to select the transformant (host cell) transformed with the vector. Since only cells expressing the selection marker can survive in the medium treated with the selection marker, the transformed cells can be selected. Representative examples of selection markers include, but are not limited to, kanamycin, streptomycin, chloramphenicol, etc.
[0030] The gene inserted into the recombinant vector for transformation according to the present invention can be cross-integrated into a host cell such as a microorganism (such as a Corynebacterium strain or Escherichia coli) by homologous recombination.
[0031] Another aspect of the present invention provides a method for producing L-citrulline, which includes the following steps: a) culturing a mutant strain of Corynebacterium glutamicum in a medium; and b) recovering L-citrulline from the cultured mutant strain or from the medium in which the mutant strain is cultured.
[0032] The culturing can be carried out using suitable media and culture conditions known in the art, and any person skilled in the art can easily adjust and use the media and culture conditions. In particular, the medium can be a liquid medium, but is not limited thereto. Some examples of culturing methods include, but are not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.
[0033] According to one embodiment of the present invention, the culture medium should meet the requirements of a specific strain in a suitable manner and can be appropriately modified by those skilled in the art. For the culture medium used for Corynebacterium strains, reference can be made to known documents (Manual of Methods for General Bacteriology, American Society for Bacteriology, Washington D.C., USA, 1981), but it is not limited thereto.
[0034] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Some examples of carbon sources that can be used include: sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats, such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids, such as palmitic acid, stearic acid, and linoleic acid; alcohols, such as glycerol and ethanol; and organic acids, such as acetic acid. These substances can be used alone or as a mixture, but it is not limited thereto. Some examples of nitrogen sources that can be used include peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean powder, urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen source can also be used alone or as a mixture, but it is not limited thereto. Some examples of phosphorus sources that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or the corresponding sodium salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. Additionally, the culture medium may contain essential growth substances, such as amino acids and vitamins. Furthermore, suitable precursors can be used in the culture medium. The culture medium or individual components can be added to the culture medium in batches or continuously by suitable methods during cultivation, but it is not limited thereto.
[0035] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in a suitable manner during cultivation. Additionally, during cultivation, an antifoaming agent such as fatty acid polyethylene glycol ester can be used to inhibit foaming. Additionally, in order to maintain the culture medium under aerobic conditions, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium. The temperature of the culture medium can generally be 20°C to 45°C, such as 25°C to 40°C. Cultivation can be continued until the desired amount of available substance is produced. For example, the cultivation time can be 10 hours to 160 hours.
[0036] According to one embodiment of the present invention, in the step of recovering L-citrulline from the cultured mutant strain or from the culture medium for culturing the mutant strain, the produced L-citrulline can be collected or recovered from the culture medium according to the culture method using suitable methods known in the art. Some examples of methods that can be used for recovering L-citrulline include, but are not limited to, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), etc.
[0037] According to one embodiment of the present invention, the step of recovering L-citrulline can be carried out by centrifuging the culture medium at a low speed to remove biomass and separating the obtained supernatant by ion exchange chromatography.
[0038] According to one embodiment of the present invention, the step of recovering L-citrulline may include a process of purifying L-citrulline.
[0039] Beneficial effects
[0040] The Corynebacterium glutamicum mutant strain according to the present invention is capable of producing L-citrulline at a high yield and high concentration because the activity of the transporter expressed by the NCgl2816 gene therein has been weakened or inactivated. Detailed description of the invention
[0041] Hereinafter, the present invention will be described in more detail. However, these descriptions are provided only for illustrative purposes to help understand the present invention, and the scope of the present invention is not limited by these illustrative descriptions.
[0042] Example 1. Analysis of transcriptome-level changes in citrulline-producing strains
[0043] 1-1. Cell collection
[0044] To analyze transcriptome-level changes in citrulline-producing strains, cell collection was carried out when changes occurred during the growth stages of each strain.
[0045] First, a Corynebacterium glutamicum mutant strain (see Korean Patent Application No. 10-2019-0151321, hereinafter referred to as "CT4") which has enhanced ornithine carbamoyltransferase and carbamoyl phosphate synthase activities to overproduce citrulline and a wild-type Corynebacterium glutamicum strain (ATCC13032) were each inoculated in a citrulline seed medium and cultured at 30 °C for 10 hours, and then 250 mL of each culture was inoculated in a 5-L medium. When the glucose contained in the initial medium was completely depleted, additional medium was added. At 13, 28, 35, and 68 hours after inoculation, cells were collected and used to prepare transcriptome analysis samples. The composition of the medium used in this experiment is shown in Table 1 below.
[0046] [Table 1]
[0047]
[0048] 1-2. Preparation of transcriptome analysis samples
[0049] After collecting cells in Example 1-1 above, the cultured cells were prepared at the same concentration, and RNA was extracted from them using an Rneasy Mini kit (QIAGEN, Germany) according to the manufacturer's instructions. The extracted RNA was stored in liquid nitrogen, and whole-genome transcriptome analysis was performed by Macrogen Co., Ltd.
[0050] 1-3. Selection of effective candidate genes
[0051] Based on the results of the whole-genome transcriptome analysis of Corynebacterium glutamicum performed in Example 1-2 above, first, 40 candidate genes were selected from permeases and transporters, whose RPKM values were greater than 1000, and whose expression levels increased rapidly in the latter half of fermentation or were at least three times higher than the expression levels in the wild-type strain. For reference, it is known that the wild-type Corynebacterium glutamicum strain (ATCC13032) has little ability to produce citrulline.
[0052] Corynebacterium glutamicum strains defective in each of the 40 genes were inoculated in a flask titer medium (see Table 2 below) and cultured at 30 °C at 200 rpm for 30 hours. After culturing was completed, each culture was diluted 100-fold with distilled water and filtered through a 0.45 μm filter, and then by using a column equipped with Dionex IonPac TMThe concentrations of L-citrulline and the by-product 6-acetylornithine in the cultures of each strain were measured by high performance liquid chromatography (HPLC) with a CS12A) and an ultraviolet detector (195 mm). Five candidate strains with low concentrations of 6-acetylornithine were further selected from the strains defective in each of the 40 candidate genes. The concentrations of L-citrulline and 6-acetylornithine in the cultures of the wild-type strain and the five selected candidate strains are shown in Table 3 below.
[0053] [Table 2]
[0054]
[0055] [Table 3]
[0056]
[0057]
[0058] As a result, it was shown that in the NCgl2816 gene-deficient strain, the production of L-citrulline was the highest, and at the same time, the production of 6-acetylornithine was the lowest. Therefore, the NCgl2816 gene was selected as the gene to be deleted for enhancing the production of L-citrulline in the strain.
[0059] Example 2. Construction of an NCgl2816 gene-deleted mutant strain
[0060] 2-1. Construction of the vector
[0061] The wild-type Corynebacterium glutamicum strain (ATCC13032) was used to construct the Corynebacterium glutamicum mutant strain.
[0062] First, chromosomal DNA was extracted from the wild-type strain using a Wizard Genomic DNA Purification Kit (Promega, USA). Using the extracted DNA as a template, PCR was performed with each of the sets of primers 1 and 2 and the sets of primers 3 and 4. The obtained PCR products were amplified again by cross-PCR using the set of primers 1 and 4, and were then inserted into the HindIII and XbaI restriction enzyme sites of the recombinant vector pK19mobSacB. The resulting vector was named vector pK19ms / △NCgl2816. For the construction of the vector, the primers shown in Table 4 were used.
[0063] [Table 4]
[0064] Primer Sequence (5′→3′) SEQ ID NO. Primer 1 tgatttacgccaagctccttatccg 3 Primer 2 ggaggggttttacttagattggtgacctcttctctgaaac 4 Primer 3 gtttcagagaagaggtcaccaatctaagtaaaacccctcc 5 Primer 4 ccggggatcctctagcgac 6
[0065] Using the above primers, PCR was performed under the following conditions. PCR was carried out in a reaction solution containing the following using a thermal cycler (TP600, TAKARA BIO Inc., Japan): 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 pM oligonucleotide, 10 ng of chromosomal DNA of Corynebacterium glutamicum (C. glutamicum) ATCC13032 as a template, and 1 unit of PrimeSTAR Max DNA polymerase (Takara, Japan). The PCR was carried out for 25 to 30 cycles, and each cycle consisted of: (i) denaturation at 94 °C for 30 seconds, (ii) annealing at 58 °C for 30 seconds, and (iii) extension at 72 °C for 1 to 2 minutes (polymerization time was 2 minutes / kb).
[0066] The gene fragment prepared as described above was cloned into the pK19mobSacB vector by self-assembly cloning. The vector was transformed into Escherichia coli (E. coli) DH5α, and then it was plated on an LB-agar plate containing 50 μg / ml kanamycin and cultured at 37 °C for 24 hours. The finally formed colonies were isolated and checked for the accurate presence of the insert in the vector. Next, the vector was isolated and used for recombination of the Corynebacterium glutamicum strain.
[0067] As a general procedure in the above method, the corresponding gene was amplified from the genomic DNA of Corynebacterium glutamicum ATCC13032 by PCR, inserted into the pK19mobSacB vector by the self-assembly cloning method according to the strategy, and the resulting plasmid was selected in Escherichia coli DH5α. In this case, in order to insert the amplified gene into the pK19mobSacB vector, a DNA ligation kit (Takara, Japan) and restriction enzymes HindIII and XbaI (NEB, England) were used according to the buffer and protocol provided by the manufacturer.
[0068] 2-2. Construction of mutant strains
[0069] A Corynebacterium glutamicum mutant strain was constructed by introducing the pK19ms / ΔNCgl2816 vector constructed in Example 2-1 above into the mutant strain CT4 as the parental strain.
[0070] Specifically, first, the parental strain was cultured in 100 ml of RG medium (containing 10 g / L beef extract, 40 g / L BHI, and 30 g / L sorbitol), and 2.5 g / L glycine, 400 mg / L isoniazid, and 0.1 ml / L Tween 80 were added to the same medium. Next, the seed culture was inoculated so that the OD 610The value reached 0.3, and then it was cultured at 30 °C at 180 rpm for 3 to 5 hours to make the OD 610 value reach 1.6 to 1.8. The culture was kept on ice for 30 minutes and then centrifuged at 3500 rpm at 4 °C for 15 minutes. Next, the supernatant was discarded, and the precipitated parental strain was washed 4 times with a 10% glycerol solution and finally resuspended in 0.5 ml of 10% glycerol solution. Electroporation was performed using a Bio-Rad electroporator. The competent cells prepared by the above method were placed in an electroporation cuvette (0.2 mm), and the pK19ms / ΔNCgl2816 vector was added thereto, and then electroporation was performed under the conditions of 2.5 kV, 200 Ω, and 12.5 μF. Immediately after the electroporation was completed, 1 ml of regeneration medium (containing 18.5 g / l brain heart infusion and 0.5 M sorbitol) was added to the cells, and then the cells were heat-treated at 46 °C for 6 minutes. Next, the cells were cooled at room temperature, transferred to a 15 ml capped tube, incubated at 30 °C for 2 hours, and plated on a solid medium (containing 40 g / L brain heart infusion, 30 g / L D-sorbitol, 10 g / L beef extract, and 20 g / L agar) containing 30 μg / ml kanamycin. The cells were cultured at 30 °C for 2 days to obtain colonies. Among the colonies in which the first homologous recombination was induced, the colonies in which the amplification was determined by PCR using primers 1 and 4 in Table 4 above under the same conditions as in Example 2-1 were selected as the first recombinant strains and cultured in 2YT liquid medium (containing 16 g / L tryptone, 10 g / L yeast extract, and 5 g / L NaCl) for 12 hours. Next, the cultured colonies were plated on 2YT-10% sucrose solid medium (containing 16 g / L tryptone, 10 g / L yeast extract, 5 g / L NaCl, and 100 g / L sucrose) to induce the second homologous recombination, thereby removing the antibiotic marker. The colonies cultured on the 2YT-10% sucrose solid medium were adhered to the 2YT-Km medium (containing 16 g / L tryptone, 10 g / L yeast extract, 5 g / L NaCl, and 30 μg / ml kanamycin), and finally the strains that were not resistant to kanamycin and could grow in the 10% sucrose medium were selected. PCR was performed using primers 1 and 4 shown in Table 4 above under the same conditions as in Example 2-1, and finally it was checked whether the NCgl2816 gene was removed, and the NCgl2816 gene deletion strain was named CT5.
[0071] Example 3. Evaluation of the L-citrulline productivity of the NCgl2816 gene deletion mutant strain
[0072] The L-citrulline productivities of the Corynebacterium glutamicum mutant strain (CT4) that overproduces citrulline and is used as the parental strain and the NCgl2816 gene deletion strain (CT5) constructed in Example 2 were compared.
[0073] Each strain was inoculated into the citrulline seed medium and cultured at 30 °C for 10 hours. Then, 250 mL of each culture was inoculated into a 5-L medium. When the glucose contained in the initial medium was completely depleted, additional medium was added. The composition of the medium used in this experiment is shown in Table 1 above. After the cultivation was completed, each culture was diluted 100-fold with distilled water and filtered through a 0.45-μm filter, and then the concentrations of L-citrulline and the by-product 6-acetylornithine in each strain culture were measured using high-performance liquid chromatography (HPLC) equipped with a column (Dionex IonPac TM CS12A) and an ultraviolet detector (195 mm). The results are shown in Table 5 below.
[0074] [Table 5]
[0075] Strain L-Citrulline (%) 6-Acetylornithine (%) CT4 8.56 1.6 CT5 8.73 0.7
[0076] As shown in Table 5 above, it was determined that compared with the L-citrulline productivity of the previously developed mutant strain CT4, the L-citrulline productivity of the Corynebacterium glutamicum mutant strain CT5 with the NCgl2816 gene deletion was increased by about 2%, while the production of the by-product 6-acetylornithine was reduced by about 44%. These results indicate that when the activity of the protein expressed by the NCgl2816 gene is weakened or inactivated, the L-citrulline productivity of the strain can be increased and the production of by-products can also be reduced, and thus the strain is capable of producing L-citrulline with high purity.
[0077] So far, the present invention has been described with reference to some preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential features thereof. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is defined by the claims rather than the above description, and all differences within the equivalent scope should be construed as being included in the present invention. <110> DAESANG CORPORATION <120> Corynebacterium glutamicum mutant with enhanced L-citrulline productivity, and method for producing L-citrulline using the same <130> PX210021PCT <150> KR 10-2020-0127021 <151> 2020-09-29 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 1302 <212> DNA <213> Artificial Sequence <220> <223> NCgl2816 <400> 1 atgacaaccg cagtagatca aaactcaccg cccaagcagc aactcaacaa gcgcgtcctg 60 ctgggcagct tgagtggcag cgttatcgaa tggttcgact tcctggttta cggaaccgtc 120 gccgcgctgg tcttcaacaa gatgtacttc cccagcggca acgagttcct ctccacaatc 180 ctggcgtacg catccttctc cctgaccttc ttcttccgcc ccattggtgg cgtcatcttc 240 gcccacatcg gcgaccgcat tgggcgtaag aagaccctgt tcatcacctt gatgctcatg 300 ggtggcggca ccgtcgccat tggtttgctg cccgactaca acgccatcgg catttgggca 360 ccaatccttc tgatgttcct ccgcattttg cagggcatcg gaattggcgg cgaatggggt 420 ggcgcactgc tcctggcata cgaatacgct ccaaagaagc agcgtgggct ctacggcgca 480 gttcctcaaa tgggcatttc cctgggcatg ctgcttgcag ctggcgtgat ctctctgctc 540 accctcatgc cggaagatca gttcctcacc tggggctggc gcatcccatt cgtcggatcc 600 atcctcctag tgttcatcgg cctgttcatc cgaaacggcc ttgatgaaac ccccgagttc 660 aagcgtatcc gcgattccgg ccagcaggta aagatgcctc tgaaggaagt tctgaccaag 720 tactggccag ccgttctggt ctccatcggc gcaaaagctg ccgagaccgg ccccttctac 780 atcttcggca cctacatcgt tgcttacgca accaacttcc tgaacatccg cgacaacatt 840 gtccttctgg cagttgcttg cgccgccctc gttgccacca tctggatgcc actgttcgga 900 tccttctccg accgcgtcaa ccgtgcagtg ctctacagga tctgtgcatc cgcaaccatc 960 gtgctgattg tcccttacta cttggtcctc aacaccggcg aaatttgggc actgtttatc 1020 actaccgtga ttggcttcgg catcctctgg ggtagcgtca acgcaatcct cggaaccgtc 1080 atcgcagaaa acttcgcacc tgaggtccgc tacaccggcg ctaccctggg ttaccaagtc 1140 ggagcagcac tcttcggcgg taccgcaccc attatcgcag catggctgtt cgaaatctcc 1200 ggcggacaat ggtggccaat cgccgtctac gtcgctgcat gttgccttct ctctgtgatc 1260 gcctcgttct tcatccaacg cgtcgcgcac caagagaact aa 1302 <210> 2 <211> 433 <212> PRT <213> Artificial Sequence <220> <223> NCgl2816 <400> 2 Met Thr Thr Ala Val Asp Gln Asn Ser Pro Pro Lys Gln Gln Leu Asn 1 5 10 15 Lys Arg Val Leu Leu Gly Ser Leu Ser Gly Ser Val Ile Glu Trp Phe 20 25 30 Asp Phe Leu Val Tyr Gly Thr Val Ala Ala Leu Val Phe Asn Lys Met 35 40 45 Tyr Phe Pro Ser Gly Asn Glu Phe Leu Ser Thr Ile Leu Ala Tyr Ala 50 55 60 Ser Phe Ser Leu Thr Phe Phe Phe Arg Pro Ile Gly Gly Val Ile Phe 65 70 75 80 Ala His Ile Gly Asp Arg Ile Gly Arg Lys Lys Thr Leu Phe Ile Thr 85 90 95 Leu Met Leu Met Gly Gly Gly Thr Val Ala Ile Gly Leu Leu Pro Asp 100 105 110 Tyr Asn Ala Ile Gly Ile Trp Ala Pro Ile Leu Leu Met Phe Leu Arg 115 120 125 Ile Leu Gln Gly Ile Gly Ile Gly Gly Glu Trp Gly Gly Ala Leu Leu 130 135 140 Leu Ala Tyr Glu Tyr Ala Pro Lys Lys Gln Arg Gly Leu Tyr Gly Ala 145 150 155 160 Val Pro Gln Met Gly Ile Ser Leu Gly Met Leu Leu Ala Ala Gly Val 165 170 175 Ile Ser Leu Leu Thr Leu Met Pro Glu Asp Gln Phe Leu Thr Trp Gly 180 185 190 Trp Arg Ile Pro Phe Val Gly Ser Ile Leu Leu Val Phe Ile Gly Leu 195 200 205 Phe Ile Arg Asn Gly Leu Asp Glu Thr Pro Glu Phe Lys Arg Ile Arg 210 215 220 Asp Ser Gly Gln Gln Val Lys Met Pro Leu Lys Glu Val Leu Thr Lys 225 230 235 240 Tyr Trp Pro Ala Val Leu Val Ser Ile Gly Ala Lys Ala Ala Glu Thr 245 250 255 Gly Pro Phe Tyr Ile Phe Gly Thr Tyr Ile Val Ala Tyr Ala Thr Asn 260 265 270 Phe Leu Asn Ile Arg Asp Asn Ile Val Leu Leu Ala Val Ala Cys Ala 275 280 285 Ala Leu Val Ala Thr Ile Trp Met Pro Leu Phe Gly Ser Phe Ser Asp 290 295 300 Arg Val Asn Arg Ala Val Leu Tyr Arg Ile Cys Ala Ser Ala Thr Ile 305 310 315 320 Val Leu Ile Val Pro Tyr Tyr Leu Val Leu Asn Thr Gly Glu Ile Trp 325 330 335 Ala Leu Phe Ile Thr Thr Val Ile Gly Phe Gly Ile Leu Trp Gly Ser 340 345 350 Val Asn Ala Ile Leu Gly Thr Val Ile Ala Glu Asn Phe Ala Pro Glu 355 360 365 Val Arg Tyr Thr Gly Ala Thr Leu Gly Tyr Gln Val Gly Ala Ala Leu 370 375 380 Phe Gly Gly Thr Ala Pro Ile Ile Ala Ala Trp Leu Phe Glu Ile Ser 385 390 395 400 Gly Gly Gln Trp Trp Pro Ile Ala Val Tyr Val Ala Ala Cys Cys Leu 405 410 415 Leu Ser Val Ile Ala Ser Phe Phe Ile Gln Arg Val Ala His Gln Glu 420 425 430 Asn <210> 3 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer 1 <400> 3 tgatttacgc caagctcctt atccg 25 <210> 4 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primer 2 <400> 4 ggaggggttt tacttagatt ggtgacctct tctctgaaac 40 <210> 5 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primer 3 <400> 5 gtttcagaga agaggtcacc aatctaagta aaacccctcc 40 <210> 6 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primer 4 <400> 6 ccggggatcc tctagcgac 19
Claims
1. Use of a mutant strain of Corynebacterium glutamicum for producing L-citrulline, wherein the activity of the protein expressed by the NCgl2816 gene in the mutant strain has been weakened or inactivated.
2. The use according to claim 1, wherein the NCgl2816 gene consists of the nucleotide sequence of SEQ ID NO:
1.
3. The use according to claim 1, wherein all or a part of the NCgl2816 gene is inserted, replaced or deleted.
4. A method for producing L-citrulline, which comprises the following steps: a) Culturing a mutant strain of Corynebacterium glutamicum in which the activity of the protein expressed by the NCgl2816 gene has been weakened or inactivated in a culture medium; and b) Recovering L-citrulline from the cultured mutant strain or from the culture medium for culturing the mutant strain.
Citation Information
Patent Citations
Method for producing L-amino acid
KR101053429B1
An L-amino acid-producing bacterium and a method for producing an L-amino acid
KR101102263B1
Easy portable pet waterer
KR1020200127021A