A method for constructing oligosporic arthrospores that spontaneously produce predatory organs

Abstract

The present invention provides a method for constructing a oligospora spore that spontaneously produces a predatory organ, belonging to the field of molecular biology technology. The method comprises: sequentially connecting a promoter, a target gene, a GFP sequence, a hygromycin selection marker, and a terminator, and constructing the entire construct in a pCE-Zero vector; then using primer 1 for PCR amplification to obtain a fluorescent conversion fragment; preparing oligospora spore protoplasts, and transforming the fluorescent conversion fragment into the oligospora spore protoplasts; and screening for positive transformants. The oligospora spores obtained by this method can spontaneously produce a predatory organ, greatly advance the response to nematodes, and have a better control effect on nematodes.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a method for constructing oligosporic arthrospores that spontaneously produce predatory organs. Background Art

[0002] Diseases caused by plant parasitic nematodes are widespread worldwide, resulting in significant annual agricultural losses. Chemical nematode control has long been considered an effective method, but the high toxicity and residual effects of these pesticides pose serious risks to agricultural products and human health. Biological control, a promising method, has demonstrated significant advantages.

[0003] Nematode-controlling fungi are numerous and widely distributed in nature. In the presence of nematodes, they transform from saprotrophic to predatory, playing a crucial role in regulating the balance of pathogenic nematode populations within ecosystems. Based on how they infect nematodes, they can be categorized as nematode-trapping, endoparasitic, toxin-producing, and opportunistic fungi. Different species of nematode-controlling fungi acquire nutrients in distinct ways. Most can live both saprotrophically and parasitically with nematodes, surviving in organic matter and transitioning to a parasitic lifestyle in the presence of nematodes, producing a variety of specialized hyphal structures. To capture nematodes, nematode-trapping fungi can differentiate their vegetative hyphae into various trapping structures, such as knotless hyphae, three-dimensional webs, sticky branches, contractile rings, sticky balls, and non-contractile rings. These diverse trapping structures enhance their ability to capture nematodes, making them a popular research topic.

[0004] Arthrobotrys oligospora, a fungus with a worldwide distribution, forms a sticky, three-dimensional web to trap nematodes under starvation conditions. It is among the most abundant fungi and has demonstrated a high ability to trap nematodes in diverse environments, even in soils contaminated by heavy metals. Therefore, it is often used as a model strain for trap formation and nematode-fungal interactions. The process by which Arthrobotrys oligospora traps nematodes is complex. First, nematodes of similar growth conditions are added. With prolonged induction, the mycelium gradually changes morphology, forming a trap. It also secretes a sticky substance to adhere to the nematodes, producing hydrolytic enzymes. The mycelium then slowly invades the nematode, forming an invasion spike or invasion ball, which then gradually produces assimilated mycelium, ultimately digesting and decomposing the nematode. Therefore, in the field of biocontrol, compared with ordinary strains, if a strain of Articularia oligosporida that can spontaneously produce traps can be constructed, the response to nematodes may be greatly advanced, achieving better prevention effects. Therefore, constructing a strain of Articularia oligosporida that can spontaneously produce traps is urgently needed for production practice. Summary of the Invention

[0005] In order to solve the problem of biological control of nematodes, the present invention provides a method for constructing oligosporic arthrospores that can spontaneously produce predatory organs. The oligosporic arthrospores obtained by this method can spontaneously produce predatory organs, greatly advance the response to nematodes, and have a better control effect on nematodes.

[0006] The present invention is achieved through the following technical solutions:

[0007] A method for constructing oligosporic arthrospores that spontaneously produce predatory organs, the method comprising:

[0008] The promoter, target gene, GFP sequence, hygromycin selection marker and terminator were connected in sequence and constructed into the pCE-Zero vector. Then, primer 1 was used for PCR amplification to obtain the fluorescent conversion fragment.

[0009] preparing Arthrodesporia oligosporida protoplasts, and transforming the fluorescent transformation fragment into the Arthrodesporia oligosporida protoplasts;

[0010] Screen out positive transformants;

[0011] Among them, the nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the target gene is shown in SEQ ID NO.2, the nucleotide sequence of the GFP sequence is shown in SEQ ID NO.3, the nucleotide sequence of the hygromycin selection marker is shown in SEQ ID NO.4, and the nucleotide sequence of the terminator is shown in SEQ ID NO.5.

[0012] Furthermore, the primer 1 includes a primer 1-F and a primer 1-R, the nucleotide sequence of the primer 1-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer 1-R is shown in SEQ ID NO.7.

[0013] Furthermore, the promoter, target gene, GFP sequence, hygromycin selection marker and terminator are sequentially connected and constructed into a pCE-Zero vector, and then PCR amplification is performed using primer 1 to obtain a fluorescent conversion fragment, which specifically includes:

[0014] The promoter, target gene, GFP sequence, hygromycin selection marker and terminator were PCR amplified separately. The PCR amplification products were connected in sequence according to the order of promoter, target gene, hygromycin selection marker and terminator and constructed as a whole into the pCE-Zero vector. PCR amplification was then performed using primer 1, and the fluorescent conversion fragment was recovered by gel recovery.

[0015] Furthermore, the preparation of the protoplasts of Arthrodes oligosporus and the transformation of the fluorescent conversion fragment into the protoplasts of Arthrodes oligosporus specifically include:

[0016] The protoplasts of Arthritis oligosporida are prepared by using snail enzyme and cellulase, and the fluorescent transformation fragment is transformed into the protoplasts of Arthritis oligosporida by mediating the PEG / CaCl2 method. Further, the positive transformants are screened out, specifically comprising:

[0017] Positive transformants were selected based on the hygromycin selection marker.

[0018] Furthermore, after positive transformants are screened out, the positive transformants are subjected to spore production culture to obtain positive transformed sporozoites.

[0019] Based on the same inventive concept, the present application also provides a oligosporic arthrocystis that spontaneously produces a predatory organ, and the oligosporic arthrocystis that spontaneously produces a predatory organ is prepared by the above-mentioned method for constructing an oligosporic arthrocystis that spontaneously produces a predatory organ.

[0020] Based on the same inventive concept, the present application also provides a method for constructing oligosporic spores that spontaneously produce predatory organs and its application in the preparation of nematode biological control agents.

[0021] Based on the same inventive concept, the present application also provides an application of oligosporic spores that spontaneously produce predatory organs in the preparation of nematode biological control agents.

[0022] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0023] 1. The present invention provides a method for constructing oligosporic spores that spontaneously produce predatory organs. The fluorescent conversion fragment is transformed into oligosporic spore protoplasts. The resulting oligosporic spores can spontaneously produce predatory organs, providing a new approach for biological control of nematodes.

[0024] 2. The present invention discloses a oligosporic spore that spontaneously produces a predatory organ. The oligosporic spore can spontaneously produce a predatory organ without the need for nematode induction, significantly improving the response efficiency of the oligosporic spore to nematodes and being more sensitive in nematode prevention and control, providing a new approach for biological control of nematodes. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following is a brief introduction to the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 This is a micrograph of the hyphae of H2B-GFP-positive transformants spontaneously forming traps on WA plates.

[0027] Figure 2 This is an enlarged view of the trap of H2B-GFP positive transformants.

[0028] Figure 3 This is a micrograph of the subculture of H2B-GFP positive transformants. DETAILED DESCRIPTION

[0029] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0030] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0032] The following is a detailed description of the method for constructing oligosporic arthrospores that spontaneously produce predatory organs in the present application in combination with examples and experimental data.

[0033] Example 1

[0034] A method for constructing oligosporic arthrospores that spontaneously produce predatory organs comprises the following steps:

[0035] 1) Construction of a fluorescent conversion fragment: The promoter-target gene-GFP sequence-hygromycin selection marker-terminator were PCR amplified separately, ligated in this order, and constructed as a whole into the pCE-Zero vector (ClonExpress Ultra OneStep Cloning Kit, Vazyme, Nanjing). Subsequently, the fluorescent conversion fragment was amplified using primer 1, and the fluorescent conversion fragment was obtained after gel recovery. The fluorescent conversion fragment comprises the promoter-target gene-GFP sequence-hygromycin selection marker-terminator, and its nucleotide sequence is shown in SEQ ID NO. 8.

[0036] The promoter primarily initiates expression of the target gene at the protein level; the target gene targets a specific location within the mycelium, and the GFP sequence visualizes this location using green fluorescence. The hygromycin selection marker screens for positive transformants successfully introduced into protoplasts, reducing the probability of false positives; and the terminator terminates translation at the protein level. Once this fluorescent translation fragment sequence is introduced into the protoplasts, it translates into the target gene—GFP protein—in the mycelium, visualizing the location.

[0037] The applicant discovered that histone H2B, as a core component of nucleosomes, regulates the transcription and protein translation of a large number of genes, and the production of the oligosporous spore trap is subject to this extensive regulation. On the other hand, histone H2B modification, as part of epigenetic modification, its methylation, acetylation, phosphorylation, ubiquitination and other modifications make gene functions diverse without changing DNA. The trap is the product of gene regulation expressed in a specific time and space.

[0038] Specifically, we hypothesize the mechanism of spontaneous trap production as follows: We propose that dynamic monoubiquitination plays a key role in the morphological plasticity of the hyphae to traps in Arthrospora oligospora. Specifically, during the hypha-trap transition, ubiquitination and deubiquitination of H2B are regulated by E3 ubiquitin ligases and deubiquitinases, respectively. Histone monoubiquitination (H2Bub) remains low in the normal hyphal state but increases significantly during the hypha-trap transition. Our GFP-tagged histone H2B, similar to overexpressing H2B in hyphae, significantly increases H2B monoubiquitination levels in hyphae, leading to spontaneous trap production. Interestingly, previous studies have shown that H2Bub expression levels are associated with programmed hyphal activation. H2B ubiquitination and deubiquitination are dynamically regulated by the E3 ligase Bre1 and the deubiquitinase Ubp8 during the reversible hyphal morphological transition in yeast. The functions of Bre1 and Ubp8 in hyphae-specific gene (HSG) regulation appear to be direct, as they are both recruited to HSG coding regions during hyphal induction. The sequential recruitment of Bre1 and Ubp8 to HSG coding regions is important for the initiation and maintenance of HSG expression. Similarly, the transition from hyphae to traps in A. oligosporum involves a morphological transition, leading us to speculate that H2B ubiquitination may mediate this process. This application is the first to link H2B ubiquitination to morphological transitions and infectivity in nematophagous fungi, suggesting potential biocontrol applications.

[0039] Specifically, the promoter-target gene-GFP sequence-hygromycin selection marker-terminator were PCR amplified separately, connected in this order, and then constructed into the pCE-Zero vector as a whole, including:

[0040] (1) After the five fragments were amplified and recovered using primers for PCR, their concentrations were measured.

[0041] (2) The optimal amount of cloning vector pCE-Zero used = [0.02 × number of cloning vector base pairs 3957] = 79.14 ng

[0042] The optimal amount of promoter-target gene fragment used = [0.02 × number of base pairs of fragment 1624] = 32.48 ng

[0043] The optimal amount of GFP fragment to be used = [0.02 × number of base pairs of the fragment 720] = 14.4 ng

[0044] The optimal amount of hygromycin selection marker fragment = [0.02 × number of base pairs of fragment 1835] = 36.7 ng

[0045] The optimal amount of terminator fragment used = [0.02 × number of base pairs of fragment 1002] = 20.04 ng

[0046] (3) Add the volume corresponding to each fragment according to the required mass, then add 5 μl of 2× ClonExpress Mix to the PCR tube, and finally add ddH2O to make the total volume 10 μl.

[0047] (4) Place the PCR tube in a PCR instrument and react at 50°C for 15 minutes; finally, reduce the temperature to 4°C.

[0048] Primer 1 amplifies the fluorescent conversion fragment including:

[0049] (1) After extracting the plasmid from the pCE-Zero vector containing the five fragments, the plasmid was diluted and used as a template (concentration of 200 ng / μl).

[0050] (2) Amplification was performed using a 25 μl PCR system (Vazyme, P505), which consisted of: 0.5 μl dNTP Mix, 1 μl primer 1-F, 1 μl primer 1-R, 0.5 μl Phanta Max Super-Fidelity DNA Polymerase, 1 μl template plasmid, 12.5 μl 2× Phanta Max Buffer, and 8.5 μl ddH2O.

[0051] (3) PCR reaction conditions are:

[0052] (4) PCR product gel recovery

[0053] The target fragment size is 5190bp. After running the gel, the corresponding band was excised and 100μl of sol buffer was added per 0.1g of gel block weight. The gel was then incubated in a 55°C water bath. Finally, all the liquid was loaded onto the column for recovery and eluted with ddH2O. The product concentration was determined, with a suitable concentration of 500ng / μl. 0.12g of snailase and 0.12g of cellulase were dissolved in 16mL of MN solution (0.3mol NaCl, 0.3mol MgSO4 dissolved in 1L ddH2O). After membrane filtration, an appropriate amount of Arthrospora oligosporida hyphae cultured in TG liquid medium was added and enzymatic digestion was carried out at 28°C and 180rpm for 3h.

[0054] Excess mycelia were filtered through 6 layers of sterile filter paper, and protoplasts were collected by centrifugation at 5000 rpm. The protoplasts were washed twice with STC buffer (18.21 g / 100 ml D-Sorbitol, 0.555 g / 100 ml CaCl2, 0.605 g / 100 ml Tris-HCl) and then transformed into fluorescent fragments using a PEG / CaCl2-mediated method.

[0055] Specifically, the fluorescent fragments were converted using a PEG / CaCl2-mediated method:

[0056] (1) The Arthrospora oligosporida blocks cultured on PDA for 4-5 days were inoculated into TG medium, cultured at 28°C for 24 h, cultured on a shaking platform at 180 rpm for 12 h, and the mycelia were collected by filtration using sterilized 4-layer filter paper.

[0057] (2) Place the mycelium in the enzymatic hydrolysis solution and perform enzymatic hydrolysis at 30°C and 150 rpm for 4-5 hours. Observe the number of protoplasts under a microscope.

[0058] (3) Filter through 6 layers of sterilized filter paper to obtain protoplasts.

[0059] (4) Protoplasts were collected by centrifugation at 6000 rpm for 5 min at 4°C and washed three times with STC solution in an ice bath.

[0060] (5) Resuspend the protoplasts in 100 μL of STC, add 35 μL of the recovered fragments, mix gently, and let stand on ice for 30 min.

[0061] (6) Add 1 mL of PTC solution (STC buffer: 60% PEG4000 = 1:2 V / V), gently invert to mix, and then place at 28°C for 20 min.

[0062] (7) Spread the reaction solution on TB3 plates, 100 μL per plate, and incubate at 28°C overnight.

[0063] (8) A layer of TB3 medium supplemented with 100 mg / mL hygromycin was spread on the previous plate for screening of resistant colonies.

[0064] (9) After culturing at 28°C for 5-7 days, resistant colonies will grow.

[0065] Finally, green fluorescent positive transformants (ie, H2B-GFP positive transformants) were screened on plates containing hygromycin.

[0066] like Figure 1 As shown, the positive transformants were inoculated on WA plates and observed using bright field and green fluorescence. Figure 2 A shows the formation of traps on hyphae, observed by bright field and green fluorescence respectively; Figure 2 B is the observation of green fluorescence of the trap, where it can be clearly observed that the green fluorescence is distributed in a dot-like manner.

[0067] Example 2

[0068] A method for constructing oligosporic arthrospores that spontaneously produce predatory organs comprises the following steps:

[0069] Construction of fluorescent conversion fragment: Promoter-target gene-hygromycin selection marker-terminator were PCR amplified separately, connected in this order and constructed as a whole into pCE-Zero vector. Then, the fluorescent conversion fragment was amplified with primer 1 and the fluorescent conversion fragment was obtained after gel recovery.

[0070] Dissolve 0.12 g of snail enzyme and 0.12 g of cellulase in 16 mL of MN solution (0.3 mol NaCl, 0.3 mol MgSO4 dissolved in 1 L ddH2O), filter with a membrane, add an appropriate amount of oligosporic mycelium cultured in TG liquid medium, and perform enzymatic hydrolysis at 28°C and 180 rpm for 3 h.

[0071] Excess mycelia were filtered through 6 layers of sterile filter paper, and protoplasts were collected by centrifugation at 5000 rpm. The protoplasts were washed twice with STC and then transformed into fluorescent fragments using a PEG / CaCl2-mediated method.

[0072] Finally, green fluorescent positive transformants were screened on plates containing hygromycin.

[0073] The positive transformants were inoculated onto CMY plates and cultured for 7-10 days. After a large number of spores were produced, the spores were washed off with sterile water, filtered with six layers of sterile lens paper, and the filtrate was centrifuged to collect the spores.

[0074] Spread the spores on a water agar plate and culture at 28°C for 4 days. The strain will spontaneously produce traps.

[0075] Example 3

[0076] A method for constructing oligosporic arthrospores that spontaneously produce predatory organs comprises the following steps:

[0077] Construction of fluorescent conversion fragment: Promoter-target gene-hygromycin selection marker-terminator were PCR amplified separately, connected in this order and constructed as a whole into pCE-Zero vector. Then, the fluorescent conversion fragment was amplified with primer 1 and the fluorescent conversion fragment was obtained after gel recovery.

[0078] Dissolve 0.12 g of snail enzyme and 0.12 g of cellulase in 16 mL of MN solution (0.3 mol NaCl, 0.3 mol MgSO4 dissolved in 1 L ddH2O), filter with a membrane, add an appropriate amount of oligosporic mycelium cultured in TG liquid medium, and perform enzymatic hydrolysis at 28°C and 180 rpm for 3 h.

[0079] Excess mycelia were filtered through 6 layers of sterile filter paper, and protoplasts were collected by centrifugation at 5000 rpm. The protoplasts were washed twice with STC and then transformed into fluorescent fragments using a PEG / CaCl2-mediated method.

[0080] Finally, green fluorescent positive transformants were screened on plates containing hygromycin.

[0081] The positive transformants were inoculated onto CMY plates and cultured for 7-10 days. After a large number of spores were produced, the spores were washed off with sterile water, filtered with six layers of sterile lens paper, and the filtrate was centrifuged to collect the spores.

[0082] Spread the spores on a water agar plate and culture at 28°C for 4 days. The strain will spontaneously produce traps.

[0083] Cut the fungus blocks that spontaneously produce traps and inoculate them on new water agar plates (first generation of passage). Traps can still be produced on the new mycelium.

[0084] Example 4

[0085] A method for constructing oligosporic arthrospores that spontaneously produce predatory organs comprises the following steps:

[0086] Construction of fluorescent conversion fragment: Promoter-target gene-hygromycin selection marker-terminator were PCR amplified separately, connected in this order and constructed as a whole into pCE-Zero vector. Then, the fluorescent conversion fragment was amplified with primer 1 and the fluorescent conversion fragment was obtained after gel recovery.

[0087] Dissolve 0.12 g of snail enzyme and 0.12 g of cellulase in 16 mL of MN solution (0.3 mol NaCl, 0.3 mol MgSO4 dissolved in 1 L ddH2O), filter with a membrane, add an appropriate amount of oligosporic mycelium cultured in TG liquid medium, and perform enzymatic hydrolysis at 28°C and 180 rpm for 3 h.

[0088] Excess mycelia were filtered through 6 layers of sterile filter paper, and protoplasts were collected by centrifugation at 5000 rpm. The protoplasts were washed twice with STC and then transformed into fluorescent fragments using a PEG / CaCl2-mediated method.

[0089] Finally, green fluorescent positive transformants were screened on plates containing hygromycin.

[0090] The positive transformants were inoculated onto CMY plates and cultured for 7-10 days. After a large number of spores were produced, the spores were washed off with sterile water, filtered with six layers of sterile lens paper, and the filtrate was centrifuged to collect the spores.

[0091] Spread the spores on a water agar plate and culture at 28°C for 4 days. The strain will spontaneously produce traps.

[0092] Cut the fungus blocks that spontaneously produce traps and inoculate them on new water agar plates (first generation of passage). Traps can still be produced on the new mycelium.

[0093] The first-generation bacterial block was inoculated on a new water agar plate (second-generation bacterial block), and traps could still be produced on the newly grown mycelium.

[0094] Example 5

[0095] A method for constructing oligosporic arthrospores that spontaneously produce predatory organs comprises the following steps:

[0096] Construction of fluorescent conversion fragment: Promoter-target gene-hygromycin selection marker-terminator were PCR amplified separately, connected in this order and constructed as a whole into pCE-Zero vector. Then, the fluorescent conversion fragment was amplified with primer 1 and the fluorescent conversion fragment was obtained after gel recovery.

[0097] Dissolve 0.12 g of snail enzyme and 0.12 g of cellulase in 16 mL of MN solution (0.3 mol NaCl, 0.3 mol MgSO4 dissolved in 1 L ddH2O), filter with a membrane, add an appropriate amount of oligosporic mycelium cultured in TG liquid medium, and perform enzymatic hydrolysis at 28°C and 180 rpm for 3 h.

[0098] Excess mycelia were filtered through 6 layers of sterile filter paper, and protoplasts were collected by centrifugation at 5000 rpm. The protoplasts were washed twice with STC and then transformed into fluorescent fragments using a PEG / CaCl2-mediated method.

[0099] Finally, green fluorescent positive transformants were screened on plates containing hygromycin.

[0100] The positive transformants were inoculated onto CMY plates and cultured for 7-10 days. After a large number of spores were produced, the spores were washed off with sterile water, filtered with six layers of sterile lens paper, and the filtrate was centrifuged to collect the spores.

[0101] Spread the spores on a water agar plate and culture at 28°C for 4 days. The strain will spontaneously produce traps.

[0102] like Figure 3 As shown, the fungus blocks that spontaneously produce traps were cut and inoculated on new water agar plates (first generation of passage), and traps could still be produced on the new mycelium.

[0103] The first-generation bacterial block was inoculated on a new water agar plate (second-generation bacterial block), and traps could still be produced on the newly grown mycelium.

[0104] The second-generation fungus block was inoculated on a new water agar plate (third-generation fungus), and traps could still be produced on the new mycelium.

[0105] Figure 3 In the figure, A1, A2, and A3 are micrographs of spores of the H2B-GFP strain spread on WA plates. Arrows indicate spontaneously generated traps. B1, B2, and B3 are micrographs of second-generation (first-passage) cultures, which still produce traps. C1, C2, and C3 are micrographs of third-generation (second-passage) cultures, showing the same traps at different magnifications.

[0106] Sequence 1 is the promoter sequence

[0107] Sequence 2 is the target gene sequence

[0108] Sequence 3 is the GFP sequence

[0109] Sequence 4 is the hygromycin selection marker sequence

[0110] Sequence 5 is the terminator sequence

[0111] Sequence 6 is the primer 1-F sequence

[0112] Sequence 7 is the primer 1-R sequence

[0113] Sequence 8 is the fluorescence conversion fragment sequence

[0114] Sequence 1

[0115]

[0116] Sequence 2

[0117] ATGCCACCAAAAGCCGCTGCCGAAAAGAAGCCATCCACCGCTGGCAAGGCTCCAGCTGGAAAGGCCCCAGTTGAGGAGAAGAAGGCCGGAAAGAAGACCGCCACCGCTTCTGGCGAGAAGAAGAAGAGAACAAAGGCTAGAAAGGAAACCTATTCCTCCTACATCTACAAAGGTGAGTTCTTAAAAGTTTTGAGATACGTATATTAGATACACACGAAACCCCTCAAGCATTCGCGCAACGCGTTCTCAATTCCCGAAAAGGGATACAAGGCCAATTACTAACACCCAACCGCCGATAGTCTTGAAGCAGGTCCACCCTGATACTGGTATCTCCAACCGTGCCATGTCGATTTTGAATTCGTTCGTTAATGGTAAGCAGTCCAATCTAAATCACGAATTCCAAATTCCGAACAGAATTTAATCTGATATTATTTGATAGATATCTTCGAGCGTGTTGCTACCGAGGCCTCCAAGCTTGCCGCTTACAACAAGAAGAGCACCATTTCTTCGCGCGAGATCCAGACTTCCGTCCGTCTCATCCTTCCTGGTGAATTGGCCAAGCATGCCGTCTCTGAGGGTACCAAGGCCGTTACCAAGTATTCATCTTCGTCTGCCAAAAGGCGCGCC

[0118] Sequence 3

[0119] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAG

[0120] Sequence 4

[0121]

[0122] Sequence 5

[0123]

[0124] Sequence 6

[0125] GATGGATTGGAGTAGGTTTGGTGTG

[0126] Sequence 7

[0127] GTGCAACTTAAACCCTCCGAAGTTT

[0128] Sequence 8

[0129]

[0130] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0131] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0132] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A method for constructing a oligosporic spore that spontaneously produces a predatory organ ( Arthrobotrys oligospora ), characterized in that The method comprises: The promoter, target gene, GFP sequence, hygromycin selection marker and terminator were connected in sequence and constructed into the pCE-Zero vector. Then, primer 1 was used for PCR amplification to obtain the fluorescent conversion fragment. preparing Arthrodesporia oligosporida protoplasts, and transforming the fluorescent transformation fragment into the Arthrodesporia oligosporida protoplasts; Screen out positive transformants; Among them, the nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the target gene is shown in SEQ ID NO.2, the nucleotide sequence of the GFP sequence is shown in SEQ ID NO.3, the nucleotide sequence of the hygromycin selection marker is shown in SEQ ID NO.4, and the nucleotide sequence of the terminator is shown in SEQ ID NO.

5.

2. The method for constructing oligosporic arthrospores that spontaneously produce predatory organs according to claim 1, characterized in that: The primer 1 includes primer 1-F and primer 1-R. The nucleotide sequence of the primer 1-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer 1-R is shown in SEQ ID NO.

7.

3. The method for constructing oligosporic arthrospores that spontaneously produce predatory organs according to claim 1, characterized in that: The promoter, target gene, GFP sequence, hygromycin selection marker and terminator are sequentially connected and constructed into a pCE-Zero vector. Then, primer 1 is used for PCR amplification to obtain a fluorescent conversion fragment, which specifically includes: The promoter, target gene, GFP sequence, hygromycin selection marker and terminator were PCR amplified separately. The PCR amplification products were connected in sequence according to the order of promoter, target gene, hygromycin selection marker and terminator and constructed as a whole into the pCE-Zero vector. PCR amplification was then performed using primer 1, and the fluorescent conversion fragment was recovered by gel recovery.

4. The method for constructing oligosporic spores that spontaneously produce predatory organs according to claim 1, characterized in that: The preparation of the protoplasts of Arthrodes oligosporus and the transformation of the fluorescent conversion fragment into the protoplasts of Arthrodes oligosporus specifically include: Snail enzyme and cellulase are used to prepare the protoplasts of Arthrodes oligosporus, and the fluorescent transformation fragment is transformed into the protoplasts of Arthrodes oligosporus through the mediation of PEG / CaCl2.

5. The method for constructing oligosporic spores that spontaneously produce predatory organs according to claim 1, characterized in that: The screening of positive transformants specifically includes: Positive transformants were selected based on the hygromycin selection marker.

6. The method for constructing oligosporic spores that spontaneously produce predatory organs according to claim 1, characterized in that: After positive transformants are screened, the positive transformants are subjected to spore production culture to obtain positive transformation sporozoites.

7. A oligosporic spore that spontaneously produces a predatory organ, characterized in that: The oligosporic arthrospore that spontaneously produces a predatory organ is prepared by a method for constructing an oligosporic arthrospore that spontaneously produces a predatory organ according to any one of claims 1 to 6.

8. Use of the method for constructing oligosporic spores capable of spontaneously producing predatory organs according to any one of claims 1 to 6 in the preparation of a nematode biological control agent.

9. Use of the oligosporic spores that spontaneously produce predatory organs as claimed in claim 7 in the preparation of a nematode biological control agent.

Images