A pyruvic acid-producing Yarrowia lipolytica engineered bacterium WSMHP, construction method and application thereof

Abstract

The invention discloses a pyruvate-producing Yarrowia lipolytica engineering bacterium, a construction method and an application thereof. The Yarrowia lipolytica engineering bacterium WSMHP is obtained by replacing the oxaloacetate transporter encoding gene in the Yarrowia lipolytica genome with the oxaloacetate transporter encoding gene in the Yarrowia lipolytica genome. Oac1p Knockout and overexpression of pyruvate carboxylase encoding gene Pyc2 and phosphoenolpyruvate carboxykinase encoding gene Pck1 Compared with the starting strain Yarrowia lipolytica starting strain YW100‑1, the pyruvate production of the Yarrowia lipolytica engineered bacterium WSMHP provided by the present invention increased by 39.0% to 168.9 g / L when glycerol was used as the sole carbon source, thereby providing an excellent strain for the industrial production of pyruvate.

Description

(I) Technical field

[0001] The invention relates to the technical field of bioengineering, and in particular to an engineering bacterium of Yarrowia lipolytica WSMHP, a construction method and application thereof. (II) Background technology

[0002] Pyruvic acid, as an intermediate in the microbial metabolic pathway, is also one of the important organic acids and has a wide range of effects in biochemical engineering, pharmaceuticals, food and scientific fields. In the pharmaceutical industry, pyruvic acid is an important pharmaceutical intermediate that can be used to synthesize levodopa, anti-inflammatory analgesic cincophen, anti-tuberculosis drug isoniazid calcium pyruvate, thiamidine drugs, etc. In addition, pyruvic acid salts (such as calcium pyruvate, potassium pyruvate, creatine pyruvate, etc.) are widely used in weight loss health care products. In the food industry, pyruvic acid, as a food additive, has natural antiseptic and fresh-keeping effects. In the chemical industry, ethyl pyruvate, as a skin whitening agent, can inhibit the formation of melanin in the skin and has a good skin whitening effect. In addition, pyruvic acid, as a precursor of a new generation of biofuels, has a rapidly growing market demand at home and abroad and has a broad application value.

[0003] At present, the methods for producing pyruvic acid mainly include chemical synthesis, enzyme conversion, and microbial fermentation. The chemical synthesis method mainly uses tartaric acid as a raw material to chemically synthesize pyruvic acid, but this method is highly polluting and costly, and industrial production is limited. The enzyme conversion method mainly uses the dehydrogenase system in microorganisms to convert lactic acid into pyruvic acid, but this method has a low conversion rate and high cost, and has not yet been industrialized. The microbial fermentation method mainly uses microorganisms to directly produce pyruvic acid through microbial fermentation with cheap carbon sources such as glucose or glycerol. At present, the strains used in the microbial fermentation method include Saccharomyces cerevisiae, Escherichia coli, Torulopsis glabrata, Yarrowia lipolytica, etc. Compared with the chemical synthesis method and the enzyme conversion method, it has the advantages of less pollution, high conversion rate, and low cost, and is also the main method of industrialization.

[0004] Earlier, we found that Yarrowia lipolytica YW100-1 has a very good pyruvate production capacity. This is because it strengthens the glycerol-3-phosphate pathway and the dihydroxyacetone pathway to accelerate the decomposition of glycerol, while weakening the glycerol synthesis pathway. However, studies have shown that the synthesis of pyruvate is accompanied by the production of ATP. High concentrations of ATP in the cell body inhibit the rate of glycolysis, resulting in the inability to further increase the accumulation of intracellular pyruvate. Therefore, how to increase pyruvate production has become an urgent problem that needs to be solved. (III) Summary of the invention

[0005] The invention aims to provide an engineered Yarrowia lipolytica strain WSMHP with high pyruvate production, and a construction method and application thereof. The invention overexpresses pyruvate carboxylase (encoded by gene Pyc2) and phosphoenolpyruvate carboxyl kinase (encoded by gene Pck1) to construct an ATP consumption circulation system, and simultaneously knocks out the gene Oac1p (YALI0E04048p) encoding the oxaloacetate transporter to prevent oxaloacetate from entering mitochondria to participate in the tricarboxylic acid cycle, thereby realizing a large amount of pyruvate accumulation in cells, and providing an excellent strain for the industrial production of pyruvate.

[0006] The technical solution adopted by the present invention is:

[0007] The invention provides a Yarrowia lipolytica engineered bacterium WSMHP with high pyruvate production. The Yarrowia lipolytica engineered bacterium WSMHP is formed by knocking out an oxaloacetate transporter encoding gene Oac1p in the Yarrowia lipolytica genome and simultaneously over-expressing a pyruvate carboxylase encoding gene Pyc2 and a phosphoenolpyruvate carboxylation kinase encoding gene Pck1.

[0008] Preferably, the nucleotide sequence of the oxaloacetate transporter encoding gene Oac1p is shown as SEQ ID NO.9; the nucleotide sequence of the pyruvate carboxylase encoding gene Pyc2 is shown as SEQ ID NO.2, and the nucleotide sequence of the phosphoenolpyruvate carboxykinase encoding gene Pck1 is shown as SEQ ID NO.4.

[0009] SEQ ID NO.9

[0010] ATGGCCGTTATTCTGGATAAGCAAAAGAAACAGCCACCCAAGCAAATCTCCACTCTCGGCGGATTTGTGGCGGGTGCTATCGCTGCCTGTGGAGCCGTCACAGTCACTAACCCGATCGAGTTGGTGAAGACCCGAATGCAGCTGCAGGGAGAGCTGGCTGCTCGAGGAGAGGCCAAGAAGGTCTACACAAGCCCCCTACAGGCTCTGGTGAAGATCTACAAGTCCGAGGGAATCAAGGGTCTCCAGTCCGGACTCTTCAGTGCATACGTCTATCAGATCGGTCTCAATGGTTGCCGACTGGGCTTGTATGAGCCCACCAGAAAGGTGATTGCCAACGTTTGCAACATTGATCTGAACAAAGAGAACCCCGTTGGTCTCAACGTGGCCTCTGGTGCCATCTCTGGTATCATGGGAGCCGTGGCCGGATCCCCCTTCTACCTGATCAAGACTCGACAGCAGTCTTACTCTCCTGCATTCAAGGTCGGAGCGCAGACCTACTACAAGTCCATCGGCGACGGATTCCGACAGATCTACGGAGCAGAGGGCTTCAAGGGTCTGTACCGAGGAGTTGACGCTGCTATTCTGAGAACTGGTGCTGGATCTTCTGTCCAGCTCCCCATCTATAACTGGGCCAAGGAGCTTCTGCTCAAGCACCACATCACCGATCCCGGAGCCTCCACCCATCTGGTTGCATCTGCCATGTCTGGTCTCGGAGTTGCTGTCGTCATGAACCCCTGGGACGTTCTCATGACCCGAATGTACAACCAGAAAGGCAACATGTACAAGAATCCCTTTGACTGTCTGATGAAGACCGTGTCCATCGAGGGACCGTTTGCTCTGTATAAGGGTTTCGGGGCCCATCTACTGCGAATTGCACCCCACACCATTTTGACCCTCATGTTCATGGAACAGACCATGAAGTGGGTCAAGTGGTTTGAGGGCGTTCCCTTTTAA

[0011] Preferably, the Yarrowia lipolytica is Yarrowia lipolytica YW100-1, which has been disclosed in a patent application (publication number: CN110499259A, publication date November 26, 2019).

[0012] Preferably, the Yarrowia lipolytica engineered strain WSMHP is constructed according to the following steps:

[0013] (1) Replacing the original nutritional deficiency marker gene Leu of the plasmid pCRISPRyl with the hygromycin resistance gene HPH to obtain the CRISPR-HPH plasmid;

[0014] (2) Design the gRNA sequence according to the target gene Oac1p (NC_006071.1), use the 20 bp gRNA sequence as the homology arm of the primer, use CRISPR-HPH as a template for full plasmid amplification, and insert the gRNA sequence into SCR1 tRNA Promoter expression site, to obtain CRISPR-HPH-Oac1p gRNA plasmid; the gRNA sequence is shown in SEQ ID NO.8;

[0015] (3) Using the Yarrowia lipolytica YW100-1 genome as a template, the 1 kb base sequence upstream of the Oac1p gene (abbreviated as 5'oac1p), the promoter pEXP1 fragment and the 1 kb base sequence downstream of the Oac1p gene (abbreviated as 3'oac1p) were amplified respectively; using the Saccharomyces cerevisiae BY4741 genome as a template, the Pyc2 and Pck1 genes from Saccharomyces cerevisiae BY4741 were amplified; using the plasmid JMP113 as a template, the promoter Loxp-URA3-loxp-pTEF fragment was amplified; and two large fragments, 5'oac1p-Loxp-URA3-loxp-pTEF-5'Pyc2 and 3'Pyc2-pEXP1-Pck1-3'Oac1p, were obtained by overlapping extension PCR, which were similar to the Pyc2 gene and CRISPR-HPH-Oac1p. gRNA plasmids are electro-transfected into Yarrowia lipolytica (preferably YW100-1) to obtain Yarrowia lipolytica engineered bacteria after homologous recombination, which is recorded as Yarrowia lipolytica engineered bacteria W SMHP.

[0016] The present invention also provides an application of the Yarrowia lipolytica engineered bacteria WSMHP in fermenting glycerol to prepare pyruvic acid. The fermentation adopts a shake flask fermentation method as follows: the Yarrowia lipolytica engineered bacteria WSMHP is inoculated into a YPD medium, cultured at 30°C and 200rpm for 24h, and the culture solution is heated to an initial cell concentration of OD 600 = 0.5 was inoculated into YNG medium containing 50 g / L glycerol and fermented at 30°C and 200 rpm until OD 600When the pH value is 4.0-5.0 (preferably 4.5), a fermentation broth containing pyruvic acid is obtained, and the pyruvic acid is separated and purified to obtain the pyruvic acid; the mass composition of the YPD liquid culture medium is: 10 g / L yeast extract, 20 g / L glucose, 20 g / L peptone, the solvent is deionized water, and the pH value is natural; the mass composition of the YNG culture medium is: 6.7 g / L YNB (a yeast basic nitrogen source containing ammonium sulfate and no amino acids), the solvent is deionized water, and the pH is adjusted to 4.0 with a Na2HPO4-citrate buffer.

[0017] The fermentation method adopts a fermentation tank fermentation method: inoculating the Yarrowia lipolytica engineered bacteria WSMHP into a fermentation medium containing 60g / L glycerol, fermenting in the fermentation tank under the conditions of 30-32°C, pH value 4-4.5, and dissolved oxygen content 40-50%, obtaining a fermentation liquid containing pyruvic acid, separating and purifying, and obtaining pyruvic acid; the fermentation medium composition is: 10g / L (NH4)2SO4, 1.4g / L MgSO4·7H2O, 2g / L KH2PO4, 0.8g / L CaCl2, 0.5g / L NaCl, 1μg / L vitamin B1, the solvent is deionized water, and the pH value is natural.

[0018] Preferably, during fermentation in the fermenter, glycerol is added in batches, with 60 g / L added for the first time. When the glycerol concentration is lower than 20 g / L, glycerol is added in batches, with 40 g / L added each time, preferably 2-3 times.

[0019] Furthermore, before the fermentation in the fermenter, the Yarrowia lipolytica WSMHP is first activated and seeded, and then the seed solution is inoculated into the fermentation medium at an inoculation volume of 10%, wherein the activation and seeding are as follows: the Yarrowia lipolytica WSMHP is inoculated into the YPD liquid medium, cultured overnight at 30°C, the culture solution is transferred to the seed medium containing 2g / L glycerol at an inoculation volume of 6-7%, and cultured in a shake flask at 30°C for 18h to obtain the seed solution; the seed medium includes: 0.4g / L tryptone, 0.2g / L yeast extract, 0.24g / L KH2PO4, 1.7g / L K2HPO4·3H2O, the solvent is distilled water, and the pH value is natural. The mass composition of the YPD liquid medium includes: 10g / L yeast extract, 2g / L glucose, 2g / L peptone, the solvent is deionized water, and the pH value is natural.

[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0021] Compared with the original Yarrowia lipolytica original strain YW100-1, the Yarrowia lipolytica engineered strain WSMHP provided by the invention has a pyruvic acid yield increased by 39.0% to 168.9 g / L when glycerol is used as the sole carbon source, thereby providing an excellent strain for the industrial production of pyruvic acid. (IV) Description of the drawings

[0022] Figure 1 The pyruvate production and residual glycerol content of the engineered strain WSMHP and the starting strain YW100-1 were compared in shake flask fermentation of Yarrowia lipolytica.

[0023] Figure 2 Comparison of pyruvate production between engineered Yarrowia lipolytica strain WSMHP and starting strain YW100-1 cultured in a 20L fermenter. (V) Specific implementation methods

[0024] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto: The methods in the following embodiments are all well-known methods unless otherwise specified.

[0025] The mass composition of YPD liquid culture medium is: 10g / L yeast extract, 2g / L glucose, 2g / L peptone, the solvent is deionized water, and the pH value is natural.

[0026] YPD solid medium is prepared by adding 2 g / L agar to YPD liquid medium.

[0027] The mass composition of YNG medium is as follows: 6.7 g / L amino-free yeast nitrogen source (YNB, a yeast basic nitrogen source containing ammonium sulfate and no amino acids), the solvent is deionized water, and the pH is adjusted to 4.0 with Na2HPO4-citric acid buffer.

[0028] LB liquid medium mass composition: 10g / L peptone, 5g / L yeast extract, 5g / L sodium chloride, solvent is distilled water, pH value is natural. LB plate is LB liquid medium with 2g / L agar added.

[0029] Example 1: Construction of the engineered strain WSMHP of Yarrowia lipolytica that produces high pyruvate

[0030] 1. Construction of CRISPR-HPH plasmid

[0031] Amplification of hygromycin resistance gene (Hph): By designing primers WSM2020067 and WSM2020068 in Table 1, using pMS82 as a template (purchased from Addgene; https: / / www.addgene.org / 68110 / ), the Hph fragment was amplified with a size of approximately 1.8 kb and a nucleotide sequence as shown in SEQ ID NO.5.

[0032] SEQ ID NO.5

[0033] GACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATG

[0034] TGACTGTCGCCCGTACATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACATTTTG

[0035] ATGGCCGCACGGCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCTGCGAGCAGGGAAA

[0036] CGCTCCCCTCACAGACGCGTTGAATTGTCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAG

[0037] GTTAGGATTTGCCACTGAGGTTCTTCTTTCATATACTTCCTTTTAAAATCTTGCTAGGATACAG

[0038] TTCTCACATCACATCCGAACATAAACAACCATGGGTAAAAAGCCTGAACTCACCGCGACGTC

[0039] TGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAG

[0040] GGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAA

[0041] TAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCT

[0042] CCCGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCC

[0043] GCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCA

[0044] GCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTC

[0045] GGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATT

[0046] GCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGC

[0047] GCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTG

[0048] CACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGA

[0049] CTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGC

[0050] CGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGC

[0051] AGGATCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTT

[0052] GGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT

[0053] CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGA

[0054] TGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCA

[0055] AAGGAATAATCTCGAGTCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACAT

[0056] CCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTA

[0057] TAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGC

[0058] GTGTACGCATGTAACATTATACTGTTGAAAAGCTGTGGTATGGTGCACTCTCAGTACAATCTG

[0059] CTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGAC

[0060] GGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATG

[0061] TGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTA.

[0062] Amplification of pCRISPRyl plasmid backbone: By designing primers WSM2020065 and WSM2020066 in Table 1, using pCRISPRyl plasmid (purchased from addgene, https: / / www.addgene.org / 70007 / ) as a template, the pCRISPRyl plasmid backbone fragment was amplified with a size of approximately 9424 bp.

[0063] The Hph fragment and pCRISPRyl plasmid backbone fragment obtained above were recovered using a gel recovery kit (purchased from Beijing Bioray Biotechnology Co., Ltd.), and then a one-step cloning kit (purchased from Nanjing Novozyme Biotechnology Co., Ltd.) was used to form a circular plasmid.

[0064] Cloning system: 2μL 5×CE MultiS buffer, 3μL Hph fragment, 2μL pCRISPRly plasmid backbone fragment, 1μL ExnaseTM MultiS enzyme, 2μL distilled water. React at 37℃ for half an hour, place on ice for 5 minutes, take 10μL and add it to 100μL E. coli DH5α competent cells and ice bath for 30 minutes. Heat shock at 42℃ for 30 seconds, immediately place on ice for 2 minutes. Add 1mL LB liquid culture medium and incubate at 200rpm and 37℃ for 1 hour. Collect the bacterial liquid by centrifugation and apply it on an LB plate containing 100mg / mL ampicillin. After growing transformants at 37℃ overnight, use primers YW202009+WSM2020069 in Table 1 for identification, and PCR screens 4 positive single colonies. The positive clones were inoculated into LB liquid culture medium and cultured at 37℃ for 8h. The positive clone plasmids were extracted for sequencing verification. The sequencing results showed that the CRISPR-HPH plasmid was successfully constructed.

[0065] The PCR amplification conditions of the HPH gene and pCRISPRyl plasmid backbone were as follows: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 58°C for 10 seconds, extension at 72°C for 3 minutes each (30 cycles), and extension at 72°C for another 10 minutes.

[0066] Table 1 Primer list

[0067]

[0068] 2. Construction of CRISPR-HPH-Oac1p gRNA

[0069] according to https: / / chopchop.cbu.uib.no / , designed the optimal gRNA sequence of Oac1p (NC_006071.1) gene, gRNA: TCACAGTCACTAACCCGATC (SEQ ID NO.8).

[0070] Design primers WSM2020078 and WSM2020079 containing the gRNA sequence in Table 2, use the CRISPR-HPH plasmid constructed in step 1 as a template, perform full plasmid amplification, and insert the gRNA sequence into SCR1 tRNA Promoter expression site, obtain CRISPR-HPH-Oac1p gRNA linearized plasmid. After PCR, first treat with dpn1 and then use purification kit ( PCR Purification Kit was purchased from Novozyme Biotechnology Co., Ltd. for purification. Without running electrophoresis, 10 μL was directly transferred into E. coli DH5a competent cells, and 1 mL of LB liquid medium was added. The cells were incubated at 200 rpm and 37°C for 1 hour. The bacterial liquid was collected by centrifugation and smeared on an LB plate containing 100 mg / mL ampicillin. After the transformants were grown at 37°C overnight, a single colony was picked and added to the LB liquid medium. The transformants were cultured at 37°C for 8 hours. The self-repair ability of E. coli was used to obtain positive transformants. The plasmid was extracted and sent for sequencing to confirm that the gRNA sequence was correctly inserted into the site, and finally the CRISPR-HPH-Oac1p gRNA plasmid was obtained.

[0071] Table 2 Primer list

[0072]

[0073] 3. Construction of Yarrowia lipolytica WSMHP

[0074] (1) Gene fragment amplification

[0075] Amplification of 5'Oac1p: 5'Oac1p was amplified using primers YW924+YW925 in Table 3 and the genome of Yarrowia lipolytica YW100-1 (Publication No.: CN110499259A) as a template. The size of the amplified 5'Oac1p was about 1 kb, and the nucleotide sequence was shown in SEQ ID NO.6.

[0076] SEQ ID NO.6

[0077] AGAGTCGAACGCAGTTGCTCTTCCACAGGCTGCACACTCTCGATGGTCGCGATCCAGGGTTT

[0078] CGGAATAAATAGAGTTATGCATTTCTCGGTGTTTTTTTCGGTTACTGGACACACTATATGTCGC

[0079] TTCAAGTGTGGGGAAACGACGGCATTTTGCGACTTCAGGAATTCAAACACTCAGAGCTAC

[0080] AGGAAGAGGTAGGAAAGCTGCATGCGTGGGGATAAAGAAAAGAACTACTTCCGGAGTTGAT

[0081] TCTCTACTACATAATTTACAGACTGATAATAATTAACTCATTTGTGTGTCACAGGAGGCCTTTT

[0082] CCATAAGAAAGCTTGCATGTCACTTGACAGGGCTGAAAGTGCCAGACAGTGTACAGTACATC

[0083] CTGTACGTACATACATTTTACAAGTAGAACTAACAACGGTCTTCCGGCTATACAAGGGAAAA

[0084] AAAGGAACAATGAGCCATGTCAAAGAAATGGGGAAAAAACAAGCGGTGGATTAAAGGTTCT

[0085] AAATGGAAAATTATAGGCTCCATCAGACAACCGGAACTAATAACAACCATTACCAATACGAC

[0086] CCCCGATATCGCATACCTCTGGCAAGCGGCATCGGCCCCCTTACTATGCCGTACCGCTATCTC

[0087] CGGTTGCCGACATCGCCTATCATAACGCTGCAACCATAGTTAGAGCCTAAGAGTCACCCCCA

[0088] GACAAAGTAAAGCTTGGGTGGTGAAAAATGATGCAAGTTGGCACGGACCTAAATTATCGAA

[0089] ACCCGAAGCGCTTCTTAGCATCTTATTCACTCGCACCCATCTTCCCGACGCATCACCCAAGGA

[0090] CTTGACACGTCTAGTTCACCTCTTCTAACGACACAGACCCTTCTTTCCGTTAACTCCGGTTCC

[0091] GCTCACCAGATCAGGAAAGCAAGTCCGAAGTAATAAAACCTCGACGACTTCCACTTTCACGCTACACACTACACACACACC。

[0092] Amplification of Loxp-Ura3-loxp-pTEF: Using primers YW926+YW927 in Table 3 and JMP113 plasmid as template, Loxp-URA3-loxp-pTEF was amplified with a size of about 1.7 kb and a nucleotide sequence as shown in SEQ ID NO.1.

[0093] SEQ ID NO.1

[0094]

[0095] Amplification of 5'Pyc2: 5'Pyc2 was amplified using primers YW928+YW1000 in Table 3 and the genome of Saccharomyces cerevisiae BY4741 (GCA_000766575.2) as a template. The size of the amplified 5'Pyc2 was about 0.6 kb, and the nucleotide sequence was shown in 1-599 bp in SEQ ID NO.2.

[0096] Amplification of Pyc2: Pyc2 was amplified using primers YW928+YW962 in Table 3 and the genome of Saccharomyces cerevisiae BY4741 as a template. The size of the amplified Pyc2 was about 4.1 kb and the nucleotide sequence was shown in SEQ ID NO.2.

[0097] SEQ ID NO.2

[0098]

[0099] Amplification of 3'Pyc2: 3'Pyc2 was amplified using primers YW936+YW962 in Table 3 and the genome of Saccharomyces cerevisiae BY4741 as a template. The size of the amplified 3'Pyc2 was about 0.5 kb, and the nucleotide sequence was shown as 3600-4100 bp in SEQ ID NO.2.

[0100] Amplification of promoter pEXP1: pEXP1 was amplified using primers YW963+YW964 in Table 3 and the Yarrowia lipolytica YW100-1 genome as a template. The size of the amplified pEXP1 was about 1 kb and the nucleotide sequence was shown in SEQ ID NO.3.

[0101] SEQ ID NO.3

[0102] GGAGTTTGGCGCCCGTTTTTTCGAGCCCCACACGTTTCGGTGAGTATGAGCGGCGGCAGATTCGAGCGTTTCCGGTTTCCGCGGCTGGACGAGAGCCCATGATGGGGGCTCCCACCACCAGCAATCAGGGCCCTGATTACACACCCACCTGTAATGTCATGCTGTTCATCGTGGTTAATGCTGCTGTGTGCTGTGTGTGTGTGTTGTTTGGCGCTCATTGTTGCGTTATGCAGCGTACACCACAATATTGGAAGCTTATTAGCCTTTCTATTTTTTCGTTTGCAAGGCTTAACAACATTGCTGTGGAGAGGGATGGGGATATGGAGGCCGCTGGAGGGAGTCGGAGAGGCGTTTTGGAGCGGCTTGGCCTGGCGCCCAGCTCGCGAAACGCACCTAGGACCCTTTGGCACGCCGAAATGTGCCACTTTTCAGTCTAGTAACGCCTTACCTACGTCATTCCATGCATGCATGTTTGCGCCTTTTTTCCCTTGCCCTTGATCGCCACACAGTACAGTGCACTGTACAGTGGAGGTTTTGGGGGGGTCTTAGATGGGAGCTAAAAGCGGCCTAGCGGTACACTAGTGGGATTGTATGGAGTGGCATGGAGCCTAGGTGGAGCCTGACAGGACGCACGACCGGCTAGCCCGTGACAGACGATGGGTGGCTCCTGTTGTCCACCGCGTACAAATGTTTGGGCCAAAGTCTTGTCAGCCTTGCTTGCGAACCTAATTCCCAATTTTGTCACTTCGCACCCCCATTGATCGAGCCCTAACCCCTGCCCATCAGGCAATCCAATTAAGCTCGCATTGTCTGCCTTGTTTAGTTTGGCTCCTGCCCGTTTCGGCGTCCACTTGCACAAACACAAACAAGCATTATATATAAGGCTCGTCTCTCCCTCCCAACCACACTCACTTTTTTGCCCGTCTTCCCTTGCTAACACAAAAGTCAAGAACACAAACAACCACCCCAACCCCCTTACACACAAGACATATCTACAG。

[0103] Amplification of Pck1: Pck1 was amplified using primers YW65+YW933 in Table 3 and the genome of Saccharomyces cerevisiae BY4741 as a template. The size of Pck1 was about 2.1 kb and the nucleotide sequence was shown in SEQ ID NO.4.

[0104] SEQ ID NO.4

[0105]

[0106] Amplification of 3'Oac1p: 3'Oac1p was amplified using primers YW934+YW935 in Table 3 and the Yarrowia lipolytica YW100-1 genome as a template. The size of the amplified ...

[0107] SEQ ID NO.7

[0108]

[0109] (2) Fusion fragment

[0110] Fusion PCR was used to construct 5'oac1p-Loxp-Ura3-loxp-pTEF-5'Pyc2 and 3'Pyc2-pEXP1-Pck1-3'Oac1p fragments. Taking the 5'oac1p-Loxp-Ura3-loxp-pTEF-5'Pyc2 fragment as an example, the specific operation is as follows:

[0111] Fusion PCR was amplified by two rounds of PCR. In the first round, the amplification system was 25 μL: 12.5 μL of 2X PrimeSTARMax DNA polymerase (purchased from Beijing Bao Ri Yi Yi Biological Co., Ltd.), 5'oac1p, Loxp-Ura3-loxp-pTEF and 5'Pyc2 fragments mixed in a molar ratio of 1:3:1, distilled water was added to 25 μL, pre-denaturation at 95°C for 3 minutes, denaturation at 98°C for 10 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 2 minutes (15 cycles), and extension at 72°C for another 10 minutes. Second round: The amplification system is 50 μL: 25 μL of 2X PrimeSTARMax DNA polymerase, 2 μL of the PCR product obtained in the first step, 1 μL YW924+1 μL YW1000, and distilled water to 50 μL, pre-denaturation at 95°C for 3 minutes, denaturation at 98°C for 10 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 2 minutes (30 cycles), and extension at 72°C for another 10 minutes.

[0112] (3) Preparation of competent cells of Yarrowia lipolytica YW100-1 (△ku70):

[0113] The Ku70 gRNA sequence was selected as ATATCGCCGCAAGATTACAC (SEQ ID NO.10) through the website (http: / / chopchop.cbu.uib.no / ). Using the CRISPR-Hph plasmid as a template, the primers WSM2020070 and WSM2020071 in Table 3 were designed, and the CRISPR-Hph-Ku70 gRNA plasmid was obtained according to the method in Example 1. The CRISPR-Hph-Ku70 gRNA was transformed into Yarrowia lipolytica YW100-1 competent cells, spread on a YPD solid plate containing 100 mg / mL hygromycin resistance, and cultured in a constant temperature incubator at 30°C for 72 hours, and the positive transformants were selected for culture.

[0114] Pick the positive transformant colony prepared in the previous step into a 5 mL YPD test tube and culture it overnight in a shaker at 30°C and 200 rpm. Transfer it to a shake flask containing 50 mL YPD medium and control the initial OD 600The culture medium was placed in a shaker at 30°C and 200 rpm for 4-5 hours until the OD 600 0.8~1. Transfer the above bacterial solution to a 50mL sterile centrifuge tube, centrifuge at 5000rpm for 10 minutes, and discard the supernatant. Add 6ml 1M sorbitol aqueous solution, 1ml 1.5M LiAc aqueous solution, 1ml 1M Tris-HCl with pH=7, 270μl 1M dithiothreitol aqueous solution and 1.73ml ddH2O, and ice bath for one hour. Centrifuge the above reaction solution at 5000rpm and 4℃ for 10 minutes, and discard the supernatant. Resuspend the above bacteria with 5mL 1M sorbitol aqueous solution, centrifuge at 5000rpm and 4℃ for 10 minutes, and discard the supernatant. Repeat the above steps twice. Resuspend the above bacteria with 50μL 1M sorbitol aqueous solution to obtain Yarrowia lipolytica YW100-1 (△ku70) competent cells, and distribute them into 1.5mL sterile centrifuge tubes, with 50μL competent cells in each tube.

[0115] (4) Construction of engineered bacteria

[0116] 5'oac1p-Loxp-Ura3-loxp-pTEF-5'Pyc2, Pyc2 and 3'Pyc2-pEXP1-Pck1-3'Oac1p were transformed into the competent cells of Yarrowia lipolytica YW100-1 (△ku70) by electroporation at an addition amount of 100 ng / kb with 500 ng CRISPR-HPH-Oac1p gRNA plasmid, coated with YND solid medium containing 100 mg / mL hygromycin, and inverted cultured at 30°C for 2-3 days. The transformants were identified by PCR using primers YW968+YW937, and the PCR products were sequenced to obtain positive transformants, which were named Yarrowia lipolytica WSMHP.

[0117] Table 3 Primer list

[0118]

[0119] Example 2: Comparison of shake flask fermentation of Yarrowia lipolytica engineered strain WSMHP and Yarrowia lipolytica YW100-1

[0120] The engineered strain of Yarrowia lipolytica WSMHP and the starting strain of Yarrowia lipolytica YW100-1 were inoculated into YPD liquid medium, respectively, and cultured in a 250 mL Erlenmeyer flask at 30 °C and 200 rpm for 24 h. The culture solution was heated to an initial cell concentration of OD 600 =0.5 were inoculated into YNG medium containing 50 g / L glycerol, and three groups of parallel analysis were performed for each strain. The culture was fermented at 30°C and 200 rpm for 16 h until OD 600When the pH was 4.5, 10 mL of the fermentation broth was taken and centrifuged at 6000 rpm for 5 min. The supernatant was collected and the concentrations of pyruvic acid and glycerol were determined by high performance liquid chromatography. The results are shown in Table 1. Figure 1 .

[0121] HPLC determination conditions: Waters 1525 Agilent Hi-Plex H column (7.7 mm*300 mm, 8 μm), mobile phase: 5 mM sulfuric acid aqueous solution; flow rate: 0.6 ml / min; injection temperature: 28°C; injection volume: 10 μl.

[0122] Figure 1 As shown in the figure, after fermentation of YW100-1 in YNG medium for 16 hours, the pyruvic acid production was about 5.95 g / L, and the residual glycerol content was about 7.4 g / L. The pyruvic acid production of the engineered bacteria WSMHP was about 7.85 g / L, and the residual glycerol content was about 5.4 g / L. It can be seen that the pyruvic acid production of the engineered bacteria WSMHP fermentation was significantly higher than that of the starting bacteria YW100-1.

[0123] Example 3: Comparison of pyruvic acid production by the engineered strain of Yarrowia lipolytica WSMHP and the starting strain Yarrowia lipolytica YW100-1 in a 20 L fermenter

[0124] Seed culture medium: 0.4 g / L tryptone, 0.2 g / L yeast extract, 0.24 g / L KH2PO4, 1.7 g / L K2HPO4·3H2O, solvent is distilled water, pH value is natural.

[0125] The fermentation medium composition: 10g / L (NH4)2SO4, 1.4g / L MgSO4·7H2O, 2g / L KH2PO4, 0.8g / LCaCl2, 0.5g / L NaCl, 1μg / L vitamin B1, the solvent is distilled water, and the pH value is natural.

[0126] The Yarrowia lipolytica engineered bacteria WSMHP and the starting strain Yarrowia lipolytica YW100-1 were inoculated into YPD liquid medium, cultured overnight at 30°C, and then 200ml of the culture solution was transferred to 3L of seed culture medium containing 2g / L glycerol, cultured in a shake flask at 30°C for 18h, and the seed solution was inoculated into a 20L fermenter containing 12L of fermentation medium containing 60g / L glycerol at a volume concentration of 10% inoculation amount, and fermented for 1h. During the entire fermentation process, 20% NaOH was used to adjust the pH value to 4.0, the dissolved oxygen content was maintained at about 40%, and the fermentation temperature was controlled at 30°C. For the starting strain Yarrowia lipolytica YW100-1, when the residual glycerol concentration in the fermenter was lower than 20g / L, glycerol was added twice, 40g / L was added each time, and a total of 1680g of glycerol was added. For the engineered bacteria WSMHP, when the residual glycerol concentration in the fermenter was lower than 20 g / L, glycerol was added three times, 40 g / L each time, for a total of 2160 g of glycerol.

[0127] The process of glycerol fermentation to produce pyruvate by the two strains is as follows Figure 2 As shown. After 120h of fermentation of the starting strain, the pyruvic acid production reached a maximum value of 121.2g / L, and the pyruvic acid / glycerol conversion rate was about 0.865g / g. After 120h of fermentation of the engineered bacteria WSMHP, the pyruvic acid production reached a maximum value of 168.9g / L, and the pyruvic acid / glycerol conversion rate reached 0.93g / g. Compared with the starting bacteria, the fermentation pyruvic acid production of the engineered bacteria WSMHP increased by 39.0%, and was significantly higher than the highest yields reported by other genetically engineered bacteria. This shows that the Yarrowia lipolytica engineered bacteria WSMHP can provide an excellent strain for the industrial production of pyruvic acid.

Claims

1. A pyruvic acid-producing Yarrowia lipolytica engineered bacterium WSMHP, characterized in that: The Yarrowia lipolytica engineered bacterium WSMHP is a Yarrowia lipolytica YW100-1 genome gene encoding an oxaloacetate transporter. Oac1p Knockout and overexpression of pyruvate carboxylase encoding gene Pyc2 and phosphoenolpyruvate carboxykinase encoding gene Pck1 Obtained; The oxaloacetate transporter encoding gene Oac1p The nucleotide sequence is shown in SEQ ID NO.9; the pyruvate carboxylase encoding gene Pyc2 The nucleotide sequence is shown in SEQ ID NO.2, the gene encoding phosphoenolpyruvate carboxykinase Pck1 The nucleotide sequence is shown in SEQ ID NO.

4.

2. The Yarrowia lipolytica engineered bacterium WSMHP according to claim 1, characterized in that The Yarrowia lipolytica engineered bacteria WSMHP is constructed according to the following steps: (1) Replace the original nutritional deficiency marker gene Leu of the plasmid pCRISPRyl with the hygromycin resistance gene HPH , obtain CRISPR-HPH plasmid; (2) According to the target gene Oac1p Design the gRNA sequence, use the 20 bp gRNA sequence as the homology arm of the primer, use CRISPR-HPH as a template for full plasmid amplification, and insert the gRNA sequence into SCR1 tRNA Promoter expression site, to obtain CRISPR-HPH-Oac1p gRNA plasmid; the gRNA sequence is shown in SEQ ID NO.8; (3) Using the genome of Yarrowia lipolytica YW100-1 as a template, amplify Oac1p 1kb base sequence upstream of the gene, promoter pEXP1 Fragments and Oac1p The 1 kb base sequence downstream of the gene; the genome of Saccharomyces cerevisiae BY4741 was used as a template to amplify the Pyc2 and Pck1 Gene; promoter amplified using plasmid JMP113 as template Loxp-URA3- loxp-pTEF Fragment; Obtained by overlap extension PCR 5 ' oac1p-Loxp-URA3-loxp-pTEF-5 ' Pyc2 and 3 ， Pyc2- pEXP1-Pck1-3 ， Oac1p Two large fragments, Pyc2 The gene and CRISPR-HPH-Oac1p gRNA plasmid were electroporated into Yarrowia lipolytica to obtain the homologous recombinant Yarrowia lipolytica engineered strain WSMHP.

3. Use of the engineered Yarrowia lipolytica WSMHP according to claim 1 in the production of pyruvic acid by fermenting glycerol.

4. The use according to claim 3, characterized in that The fermentation method adopts the shaking flask fermentation method, specifically: the engineered Yarrowia lipolytica WSMHP is inoculated into the YPD liquid culture medium, cultured at 30°C and 200rpm for 24h, and the culture liquid is heated to an initial cell concentration of OD 600 = 0.5 was inoculated into YNG medium containing 50 g / L glycerol and fermented at 30°C and 200 rpm until OD 600 When the pH value is 4.0-5.0, a fermentation liquid containing pyruvic acid is obtained, and the pyruvic acid is obtained by separation and purification; The mass composition of YPD liquid culture medium is: 10 g / L yeast extract, 20 g / L glucose, 20 g / L peptone, the solvent is deionized water, and the pH value is natural; the mass composition of YNG culture medium is: 6.7 g / L YNB, the solvent is deionized water, and the pH is adjusted to 4.0 with Na2HPO4-citrate buffer.

5. The use according to claim 3, characterized in that The fermentation adopts a fermentation tank fermentation method, specifically: inoculating the Yarrowia lipolytica engineered bacteria WSMHP into a fermentation medium containing 60g / L glycerol, fermenting in the fermentation tank under the conditions of 30-32°C, pH value 4-4.5, and dissolved oxygen content 40-50%, obtaining a fermentation liquid containing pyruvic acid, separating and purifying, and obtaining pyruvic acid; the fermentation medium composition is: 10 g / L (NH4)2SO4, 1.4 g / L MgSO4·7H2O, 2 g / L KH2PO4, 0.8 g / LCaCl2, 0.5 g / L NaCl, 1 μg / L vitamin B1, the solvent is deionized water, and the pH value is natural.

6. The use according to claim 5, characterized in that During fermentation in the fermenter, glycerol was added in batches, with 60 g / L added for the first time. When the glycerol concentration was lower than 20 g / L, glycerol was added in batches, with 40 g / L added each time.

7. The use according to claim 5, characterized in that Before fermentation in the fermenter, the Yarrowia lipolytica engineered bacteria WSMHP is firstly subjected to activation culture and seed expansion culture, and then the seed liquid is inoculated into the fermentation medium at an inoculation amount of 10% by volume, wherein the activation culture and seed expansion culture are as follows: the Yarrowia lipolytica engineered bacteria WSMHP is inoculated into a YPD liquid culture medium, cultured overnight at 30°C, the culture liquid is transferred to a seed culture medium containing 2 g / L glycerol at an inoculation amount of 6-7% by volume, and cultured in a shaking flask at 30°C for 18 hours to obtain the seed liquid; the seed culture medium comprises: 0.4 g / L tryptone, 0.2 g / L yeast extract, 0.24 g / L KH2PO4, 1.7 g / L K2HPO4·3 H2O, the solvent is distilled water, and the pH value is natural; the mass composition of the YPD liquid culture medium comprises: 10 g / L yeast extract, 2 g / L glucose, 2 g / L peptone, the solvent is deionized water, and the pH value is natural.

Images