A method for increasing the production of ursolic acid and oleanolic acid by brewer's yeast

Abstract

The invention discloses a method for improving the production of ursolic acid and oleanolic acid by yeast cerevisiae, and particularly relates to fermentation production using recombinant yeast cerevisiae. The recombinant yeast at least expresses amyrin synthase CrMAS, amyrin C-28 oxidase CrAO, and a cytochrome NADPH reductase AtCPR1, knocks out malate synthase MLS1, and enhances the expression of alcohol dehydrogenase ADH2, acetate-CoA ligase 1ACS1, aldehyde dehydrogenase ALD6, squalene epoxidase ERG1, and amyrin synthase CrMAS.

Description

Technical Field

[0001] The invention relates to a method for improving the yield of ursolic acid and oleanolic acid synthesized by brewer's yeast, and belongs to the field of biotechnology. Background Art

[0002] Ursolic acid (UA) and its isomer oleanolic acid (OA) are pentacyclic triterpenoids with anticancer and antibacterial properties. The market demand for UA and OA far exceeds the current yield from plant-based extraction methods. Furthermore, plant-based extraction methods are time-consuming, have low recovery rates, and are expensive. By systematically optimizing the metabolic pathways for their synthesis, the use of microbial cell factories for their production has emerged as a promising approach. Summary of the Invention

[0003] To solve the above problems, the present invention provides a method for producing ursolic acid and oleanolic acid using a microbial cell factory. The method provides a basis for material production by introducing synthetic genes, and then increases the yield of ursolic acid and oleanolic acid by means of knockout, enhanced expression, etc., with the effect being significantly better than existing reports.

[0004] The first object of the present invention is to provide a cerevisiae yeast with improved ursolic acid and oleanolic acid production, wherein the cerevisiae yeast expresses amyrin synthase CrMAS, amyrin C-28 oxidase CrAO and a cytochrome-NADPH-reductase AtCPR1, knocks out malate synthase MLS1, and enhances the expression of alcohol dehydrogenase ADH2, acetate-CoA ligase 1ACS1, aldehyde dehydrogenase ALD6, squalene epoxidase ERG1 and amyrin synthase CrMAS.

[0005] Furthermore, the Saccharomyces cerevisiae adopts promoter P HXT1 Replace the original promoter P of lanosterol synthase ERG7 ERG7 .

[0006] Furthermore, the Saccharomyces cerevisiae expresses the fusion protein PLN1-CrAO-AtCPR1.

[0007] Furthermore, the Saccharomyces cerevisiae enhances the expression of NADH kinase POS5.

[0008] Furthermore, the yeast Saccharomyces cerevisiae increases at least one copy number of alcohol dehydrogenase ADH2, acetate-CoA ligase 1ACS1, aldehyde dehydrogenase ALD6, squalene epoxidase ERG1, fusion protein PLN1-CrAO-AtCPR1 and NADH kinase POS5.

[0009] Furthermore, the yeast Saccharomyces cerevisiae has at least two copies of amaranthol synthase CrMAS increased.

[0010] Furthermore, the Gene ID of the amyl alcohol synthase CrMAS is JN991165.1, the Gene ID of the amyl alcohol C-28 oxidase CrAO is AEX07772.1, the nucleotide sequence of the cytochrome-NADPH-reductase AtCPR1 is shown in SEQ ID NO.9, and the Gene ID of the malate synthase MLS1 is 855606.

[0011] Furthermore, the Gene ID of the alcohol dehydrogenase ADH2 is 855349, the Gene ID of the acetate-CoA ligase 1ACS1 is 851245, the Gene ID of the aldehyde dehydrogenase ALD6 is 856044, the Gene ID of the squalene epoxidase ERG1 is 853086, and the Gene ID of the NADH kinase POS5 is 855913. The nucleotide sequence of the fusion protein PLN1-CrAO-AtCPR1 is shown in SEQ ID NO. 1. The Gene IDs mentioned herein all refer to the NCBI platform.

[0012] Furthermore, through the promoter P GAL1 Enhanced expression of alcohol dehydrogenase ADH2, amaranth synthase CrMAS and fusion protein PLN1-CrAO-AtCPR1.

[0013] Furthermore, through the promoter P GAL7 Enhanced expression of acetate-CoA ligase 1ACS1, aldehyde dehydrogenase ALD6 and NADH kinase POS5.

[0014] Furthermore, through the promoter P TEF1 Enhanced expression of squalene epoxidase ERG1.

[0015] The second object of the present invention is to provide a method for increasing the yield of ursolic acid and oleanolic acid, comprising the step of using the above-mentioned recombinant Saccharomyces cerevisiae for fermentation.

[0016] Furthermore, the brewer's yeast is activated and cultured in a seed culture medium to obtain a seed liquid, and then the seed liquid is inoculated into a fermentation culture medium for fermentation culture.

[0017] Furthermore, the brewer's yeast is activated in a seed culture medium at 25-35°C to obtain a seed solution, and the seed solution is inoculated into a fermentation medium at an inoculation rate of 1-5%, and fermented and cultured at 25-35°C.

[0018] Furthermore, the seed culture medium is YPD culture medium.

[0019] Furthermore, the fermentation medium is soy peptone medium.

[0020] Beneficial effects of the present invention:

[0021] The present invention discloses a method for increasing the production of ursolic acid and oleanolic acid in Saccharomyces cerevisiae. The present invention firstly increases the supply of precursor acetyl-CoA by knocking out malate synthase MLS1, strengthening alcohol dehydrogenase ADH2, acetate-CoA ligase 1ACS1 and aldehyde dehydrogenase ALD6; secondly, increases the copy number of squalene epoxidase ERG1 and amyrin synthase CrMAS; then, uses promoter P HXT1 Replace the lanosterol synthase ERG7 promoter P ERG7 , and further expressed the fusion protein PLN1-CrAO-AtCPR1 and NADH kinase POS5, so that the recombinant Saccharomyces cerevisiae could synthesize 1132.9 mg / L of ursolic acid and 433.9 mg / L of oleanolic acid in a 3-L fermenter. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results show the production of ursolic acid and oleanolic acid by Saccharomyces cerevisiae strain S6 in a 3-L fermenter. DETAILED DESCRIPTION

[0023] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0024] The culture medium involved in the following examples is as follows:

[0025] SD HIS plate: YNB medium 1.7 g / L, glucose 20 g / L, L-leucine 50 mg / L, L-tryptophan 50 mg / L, uracil 50 mg / L, agar powder 15 g / L.

[0026] SD Ura plate: YNB medium 1.7 g / L, glucose 20 g / L, L-leucine 50 mg / L, L-tryptophan 50 mg / L, L-histidine 50 mg / L, agar powder 15 g / L.

[0027] YPD solid plate: 10 g / L yeast powder, 20 g / L peptone, 20 g / L glucose, 15 g / L agar powder.

[0028] The detection methods involved in the following embodiments are as follows:

[0029] Determination of ursolic acid and oleanolic acid yield:

[0030] High-performance liquid chromatography (HPLC) was performed on an Agilent 1260 using a C18 ODS column (5 μm, 250 × 4.6 mm, Thermo Fisher Scientific, Waltham, MA, USA). The mobile phase consisted of water (0.5% ammonium acetate, 0.04 mol / L hydroxypropyl-β-cyclodextrin) and pure acetonitrile in a ratio of 3:7, with a flow rate of 1 mL / min, a column temperature of 25°C, a wavelength of 210 nm, and an injection volume of 20 μL.

[0031] The preparation of the Saccharomyces cerevisiae UO2 strain involved in the following examples is as follows:

[0032] 1. Construction of Saccharomyces cerevisiae strain UO1

[0033] The specific steps are as follows:

[0034] (1) Artificially synthesized gene fragment P gal1 -CrMAS-T CYC1 (The nucleotide sequence is shown in SEQ ID NO.6);

[0035] The genome of Saccharomyces cerevisiae Y6 (from patent CN113502235A) was used as a template, and the primer sequences described in Table 1 were used to amplify the gene fragment 416d-UP with primers 416d-UP-F and 416d-UP-R;

[0036] The gene fragment 416d-DOWN was amplified using primers 416d-DOWN-F and 416d-DOWN-R;

[0037] Using plasmid pMHyLp-LEU (nucleotide sequence shown in SEQ ID NO. 7) as a template, primers 416d-loxLEU-F and 416d-loxLEU-R were used to amplify the 416d-loxLEU fragment.

[0038] (2) The four segments P in step (1) gal1 -CrMAS-T CYC1 , 416d-UP, 416d-DOWN, 416d-loxLEU were fused by PCR, and the correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment 416d-P gal1 -CrMAS-T CYC1 .

[0039] (3) Transform the fusion gene fragment from step (2) into competent Saccharomyces cerevisiae Y6 strain, culture on SD LEU plates at 28-30°C for 2-3 days, and perform single colony PCR verification using primers YZ-416d-F and YZ-416d-R described in the table below. Select a single colony with the correct band.

[0040] (4) The strain obtained in step (3) was prepared into a competent state, transformed into the PY26-Cre plasmid (nucleotide sequence SEQ ID NO. 3 in patent CN113502235A), cultured on SD Ura plates at 28-30°C for 2-3 days, and a single colony was inoculated into YPD medium and cultured for 15-24 hours. The single colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD LEU, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct recombinant Saccharomyces cerevisiae strain and was named Saccharomyces cerevisiae UO1.

[0041] UO1-related primer sequences

[0042] 416d-DOWN-F gctcgaaggctttaatttgcggcctgctccttcactattttaacatgtggaattcttg 416d-DOWN-R atatccacatcaatggctaatggcaaaac 416d-loxLEU-F ctatatgttgataattagcgttgcctcatcaggaaacagctatgaccatgattacg 416d-loxLEU-R tggatatgtatatggtggtaatgccatgttaaaacgacggccagtgccaa 416d-UP-F ggccttttgaaaagcaagcataaaagatctaaac 416d-UP-R gtaatcatggtcatagctgtttcctgatgaggcaacgctaattatcaacatatagattg YZ-416d-F ttgctatttgggaaccacctgttc YZ-416d-R caataatctatatgctcaccaatcagatttactctgc

[0043] 2. Construction of Saccharomyces cerevisiae strain UO2

[0044] (1) Artificially synthesized gene fragment P gal1 -CrAO-T TDH3 -P gal10 -AtCPR1-T CYC1 (The nucleotide sequence is shown in SEQ ID NO.8);

[0045] Using the Saccharomyces cerevisiae Y6 genome as a template, the gene fragment 208a-UP was amplified using primers 208a-UP-F and 208a-UP-R;

[0046] The gene fragment 208a-DOWN was amplified using primers 208a-DOWN-F and 208a-DOWN-R;

[0047] The 208a-LEU fragment was amplified using plasmid pMHyLp-LEU as a template and primers 208a-loxLEU-F and 208a-loxLEU-R.

[0048] (2) The four segments P in step (1) gal1 -CrAO-T TDH3 -P gal10 -AtCPR1-T CYC1 PCR was used to perform fusion PCR on 208a-UP, 208a-DOWN and 208a-LEU. The correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment 208a-P gal1 -CrAO-T TDH3 -P gal10 -AtCPR1-T CYC1 .

[0049] (3) The gene fragment in step (2) was transformed into the competent strain UO1, cultured on SD LEU plates at 28-30°C for 2-3 days, and verified by single colony PCR using primers YZ-208a-F and YZ-208a-R. Single colonies with the correct bands were selected.

[0050] (4) The strain obtained in step (3) was prepared into a competent state, transformed with the PY26-Cre plasmid, and cultured on SD Ura plates at 28-30°C for 2-3 days. A single colony was taken and inoculated into YPD medium and cultured for 15-24 hours. The colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 28-30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD LEU, and YPD solid plates respectively. The single colony that grew only on YPD medium was the correct Saccharomyces cerevisiae strain UO2.

[0051] UO2-related primer sequences

[0052] 208a-DOWN-F gacgctcgaaggctttaatttgcggccgatcacgacggcaatgacaaaaact 208a-DOWN-R gaggcctgcacagacacttg 208a-UP-F gctaaacatgccgtctccgaag 208a-UP-R catggtcatagctgtttcctggagcactttacacagtgcaggaac 208a-loxLEU-F gttcctgcactgtgtaaagtgctccaggaaacagctatgaccatgattacg 208a-loxLEU-R gctgtatagctcatatctttccctttaaaacgacggccagtgcca YZ-208a-F tggaaattgctaattctaaagctcctggtg YZ-208a-R gaagatggttttcagacaaactcctacaca

[0053] Example 1 Construction of Saccharomyces cerevisiae strain S1

[0054] The specific steps are as follows:

[0055] (1) Artificially synthesized gene fragments

[0056] P GAL1 -ADH2-T CYC1 -P GAL7 -ALD6-T ADH1 -P GAL7 -ACS1-T TDH3 (The nucleotide sequence is shown in SEQ ID NO. 2);

[0057] Using the Saccharomyces cerevisiae UO2 genome as a template and the primer sequences described in Table 1 , the gene fragment MLS1-UP was amplified with primers MLS1-UP-F and MLS1-UP-R;

[0058] The gene fragment MLS1-DOWN was amplified using primers MLS1-DOWN-F and MLS1-DOWN-R;

[0059] The plasmid pMHyLp-HIS (nucleotide sequence SEQ ID NO. 2 in patent CN113502235A) was used as a template and primers MLS1-loxHIS-F and MLS1-loxHIS-R were used to amplify the MLS1-loxHIS fragment.

[0060] (2) The four fragments in step (1)

[0061] P GAL1 -ADH2-T CYC1 -P GAL7 -ALD6-T ADH1 -P GAL7 -ACS1-T TDH3 , MLS1-UP, MLS1-DOWN, and MLS1-loxHIS were fused by PCR, and the correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment MLS1-P GAL1 -ADH2-T CYC1 -P GAL7 -ALD6-T ADH1 -P GAL7 -ACS1-T TDH3 .

[0062] (3) The fusion gene fragment in step (2) was transformed into the competent strain of Saccharomyces cerevisiae UO2, cultured on SD HIS plates at 28-30°C for 2-3 days, and verified by single colony PCR using primers YZ-MLS1-F and YZ-MLS1-R described in Table 1. Single colonies with correct bands were selected.

[0063] (4) The strain obtained in step (3) was prepared into a competent state, transformed into the PY26-Cre plasmid (nucleotide sequence SEQ ID NO. 3 in patent CN113502235A), cultured on SD Ura plates at 28-30°C for 2-3 days, and a single colony was inoculated into YPD medium and cultured for 15-24 hours. The single colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD HIS, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct recombinant Saccharomyces cerevisiae strain and was named Saccharomyces cerevisiae S1.

[0064] Table 1 Primer sequences

[0065] MLS1-DOWN-F ccgctgtatagctcatatctttccctttctcccttgccccagtgtacac MLS1-DOWN-R ttaaggatggctatcaacatcctttgaagtttccatta MLS1-loxHIS-F aagtagtaaaagcacataaaagaattaagaaacaggaaacagctatgaccatgattacg MLS1-loxHIS-R agctgtttcctgtttcttaattcttttatgtgcttttactactttgtttagttcaaaac MLS1-UP-F tgtctaatgcgaaggtacttttatttttttcagattca MLS1-UP-R agctgtttcctgtttcttaattcttttatgtgcttttactactttgtttagttcaaaac YZ-MLS1-F ttctagaatttacgttcaagaaggtatttacgacga YZ-MLS1-R ttgttggtctttctataaaccaagacgtgtc

[0066] Example 2 Construction of Saccharomyces cerevisiae strain S2

[0067] (1) Artificially synthesized gene fragment P TEF1 -ERG1-T TDH3 -P GAL1 -CrMAS-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 3);

[0068] The gene fragment 1021b-UP was obtained by amplifying the Saccharomyces cerevisiae UO2 genome with primers 1021b-UP-F and 1021b-UP-R;

[0069] The gene fragment 1021b-DOWN was amplified using primers 1021b-DOWN-F and 1021b-DOWN-R;

[0070] The 1021b-HIS fragment was amplified using plasmid pMHyLp-HIS as a template and primers 1021b-loxHIS-F and 1021b-loxHIS-R.

[0071] (2) The four segments P in step (1) TEF1 -ERG1-T TDH3 PCR was used to perform fusion PCR on 1021b-UP, 1021b-DOWN and 1021b-HIS. The correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment 1021b-P TEF1 -ERG1-T TDH3 -P GAL1 -CrMAS-T CYC1 .

[0072] (3) The gene fragment from step (2) was transformed into the competent strain S1 prepared in Example 1, cultured on SDHIS plates at 28-30°C for 2-3 days, and verified by single colony PCR using primers YZ-1021b-F and YZ-1021b-R. Single colonies with the correct bands were selected.

[0073] (4) The strain obtained in step (3) was prepared into a competent state, transformed with the PY26-Cre plasmid, and cultured on SD Ura plates at 28-30°C for 2-3 days. A single colony was taken and inoculated into YPD medium and cultured for 15-24 hours. The colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 28-30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD HIS, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct Saccharomyces cerevisiae strain S2.

[0074] Table 2 Primer sequences

[0075] 1021b-DOWN-F cgaaggctttaatttgcggccggcattatgagttaagagataatacgcac 1021b-DOWN-R gagaaaggacttaatccgtacacaatga 1021b-UP-F ttggtaacagaagatggcagtatttcca 1021b-UP-R gcgtaatcatggtcatagctgtttcctgggagatgcgacgaattactggc 1021b-loxHIS-F gccagtaattcgtcgcatctcccaggaaacagctatgaccatgattacgc 1021b-loxHIS-R aaaaaaggagtagaaacattttgaagctattaaaacgacggccagtgcca YZ-1021b-F acctagacttcagcgaccgt YZ-1021b-R agagtgggaggaacaagatgct

[0076] Example 3 Construction of Saccharomyces cerevisiae strain S3

[0077] The specific steps are as follows:

[0078] (1) Artificially synthesized gene fragment P GAL1 -CrMAS-T CYC1 (The nucleotide sequence is shown in SEQ ID NO.6);

[0079] Using the Saccharomyces cerevisiae UO2 genome as a template and the primer sequences described in Table 3 , primers 1309a-UP-F and 1309a-UP-R were used to amplify the gene fragment 1309a-UP;

[0080] The gene fragment 1309a-DOWN was amplified using primers 1309a-DOWN-F and 1309a-DOWN-R;

[0081] The 1309a-HIS fragment was amplified using plasmid pMHyLp-HIS as a template and primers 1309a-loxHIS-F and 1309a-loxHIS-R.

[0082] (2) The fragment P in step (1) TEF1 -ERG1-T TDH3 PCR was used to perform fusion PCR on 1309a-UP, 1309a-DOWN, and 1309a-HIS. The correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment 1309a-P GAL1 -CrMAS-T CYC1 ;

[0083] (3) The fusion gene fragment obtained in step (2) was transformed into the competent strain S2 prepared in Example 2, cultured on SD HIS plates at 28-30°C for 2-3 days, and single colony PCR verification was performed using primers YZ-1309a-F and YZ-1309a-R; and single colonies with correct bands were selected.

[0084] (4) The strain obtained in step (3) was prepared into a competent state, transformed with the PY26-Cre plasmid, and cultured on SD Ura plates at 28-30°C for 2-3 days. A single colony was taken and inoculated into YPD medium and cultured for 15-24 hours. The colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 28-30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD HIS, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct Saccharomyces cerevisiae strain S3.

[0085] Table 3 Primer sequences

[0086] 1309a-DOWN-F ctcgaaggctttaatttgcggccaggtctactactccatcgtaaagcc 1309a-DOWN-R ccattgaataacaacggtcttaccatct 1309a-loxHIS-F tcaactactacgagagagggaccaggaaacagctatgaccatgattacgc 1309a-loxHIS-R aaaaaaggagtagaaacattttgaagctattaaaacgacggccagtgcca 1309a-UP-F gcagatgtgaccataaccctgg 1309a-UP-R gcgtaatcatggtcatagctgtttcctggtccctctctcgtagtagttgatatccc YZ-1309a-F tgatgaagccgtcagccaagg YZ-1309a-R gcagtgaaggcaagacgagtt

[0087] Example 4 Construction of Saccharomyces cerevisiae strain S4

[0088] The specific steps are as follows:

[0089] (1) Using the Saccharomyces cerevisiae UO2 genome as a template, the primer sequences described in Table 4 were used to amplify the gene fragment P using primers HXT1-F and HXT1-R. HXT1(The nucleotide sequence is shown in SEQ ID NO.4);

[0090] Using the Saccharomyces cerevisiae UO2 genome as a template and the primer sequences described in Table 4 , the gene fragment 308a-UP was amplified with primers HXT1-UP-F and HXT1-UP-R;

[0091] The gene fragment HXT1-DOWN was amplified using primers HXT1-DOWN-F and HXT1-DOWN-R;

[0092] The HXT1-HIS fragment was amplified using plasmid pMHyLp-HIS as a template and primers HXT1-loxHIS-F and HXT1-loxHIS-R.

[0093] (2) The fragment P in step (1) HXT1 , HXT1-UP, HXT1-DOWN, and HXT1-HIS were fused by PCR, and the correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment HXT1-P HXT1 ;

[0094] (3) The fusion gene fragment obtained in step (2) was transformed into the competent strain S3 prepared in Example 3, cultured on SD HIS plates at 28-30°C for 2-3 days, and single colony PCR verification was performed using primers YZ-HXT1-F and YZ-HXT1-R; and single colonies with correct bands were selected.

[0095] (4) The strain obtained in step (3) was prepared into a competent state, transformed with the PY26-Cre plasmid, and cultured on SD Ura plates at 28-30°C for 2-3 days. A single colony was taken and inoculated into YPD medium and cultured for 15-24 hours. The colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 28-30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD HIS, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct Saccharomyces cerevisiae strain S4.

[0096] Table 4 Primer sequences

[0097]

[0098]

[0099] Example 5 Construction of Saccharomyces cerevisiae strain S5

[0100] The specific steps are as follows:

[0101] (1) Artificially synthesized gene fragment P GAL1-PLN1-CrAO-AtCPR1-T TDH3 (The nucleotide sequence is shown in SEQ ID NO.1);

[0102] Using the Saccharomyces cerevisiae UO2 genome as a template and the primer sequences described in Table 5 , primers 308a-UP-F and 308a-UP-R were used to amplify the gene fragment 308a-UP;

[0103] The gene fragment 308a-DOWN was amplified using primers 308a-DOWN-F and 308a-DOWN-R;

[0104] The 308a-HIS fragment was amplified using plasmid pMHyLp-HIS as a template and primers 308a-loxHIS-F and 308a-loxHIS-R.

[0105] (2) The fragment P in step (1) GAL1 -PLN1-CrAO-AtCPR1-T TDH3 PCR was used to perform fusion PCR on 308a-UP, 308a-DOWN, and 308a-HIS. The correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment 308a-P GAL1 -PLN1-CrAO-AtCPR1-T TDH3 ;

[0106] (3) The fusion gene fragment obtained in step (2) was transformed into the competent strain S4 prepared in Example 4, cultured on SD HIS plates at 28-30°C for 2-3 days, and single colony PCR verification was performed using primers YZ-308a-F and YZ-308a-R; and single colonies with correct bands were selected.

[0107] (4) The strain obtained in step (3) was prepared into a competent state, transformed with the PY26-Cre plasmid, and cultured on SD Ura plates at 28-30°C for 2-3 days. A single colony was taken and inoculated into YPD medium and cultured for 15-24 hours. The colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 28-30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD HIS, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct Saccharomyces cerevisiae strain S5.

[0108] Table 5 Primer sequences

[0109]

[0110]

[0111] Example 6 Construction of Saccharomyces cerevisiae strain S6

[0112] The specific steps are as follows:

[0113] (1) Artificially synthesized gene fragment P GAL7 -POS5-T TDH3 (The nucleotide sequence is shown in SEQ ID NO.5);

[0114] Using the Saccharomyces cerevisiae UO2 genome as a template and the primer sequences described in Table 6, the gene fragment 720a-UP was amplified with primers CIT2-UP-F and 720a-UP-R;

[0115] The gene fragment 720a-DOWN was amplified using primers 720a-DOWN-F and 720a-DOWN-R;

[0116] The 720a-HIS fragment was amplified using plasmid pMHyLp-HIS as a template and primers 720a-loxHIS-F and 720a-loxHIS-R.

[0117] (2) Fragments 720a-UP, 720a-DOWN, and 720a-HIS in step (1) were subjected to fusion PCR, and the correct bands obtained by running the gel were recovered by column to obtain the fusion gene fragment 720a;

[0118] (3) The fusion gene fragment obtained in step (2) was transformed into the competent strain of the S5 strain prepared in Example 5, cultured on SD HIS plates at 28-30°C for 2-3 days, and single colony PCR verification was performed using primers YZ-720a-F and YZ-720a-R; and single colonies with correct bands were selected.

[0119] (4) The strain obtained in step (3) was prepared into a competent state, transformed with the PY26-Cre plasmid, and cultured on SD Ura plates at 28-30°C for 2-3 days. A single colony was taken and inoculated into YPD medium and cultured for 15-24 hours. The colony was streaked onto a YPD plate containing 5-fluoroorotic acid and cultured at 28-30°C for 2-3 days. The grown single colony was spot-plated on SD Ura, SD HIS, and YPD solid plates, respectively. The single colony that grew only on YPD medium was the correct Saccharomyces cerevisiae strain S6.

[0120] Table 6 Primer sequences

[0121]

[0122]

[0123] Example 7S1-S6 Preparation of Ursolic Acid and Oleanolic Acid by Fermentation of Saccharomyces cerevisiae Strains

[0124] The specific steps are as follows:

[0125] (1) Preparation of seed solution

[0126] Recombinant Saccharomyces cerevisiae strains S1 to S6 were selected and cultured in 2 mL of YPD medium at 25 to 35° C. and 220 to 280 rpm for 18 to 24 h.

[0127] (2) Fermentation culture

[0128] The inoculum was transferred to a 250 mL flat-bottom flask containing 20 to 40 mL of soy peptone medium at a rate of 1% to 5% (v / v), and cultured at 25 to 35° C. and 220 to 280 rpm for 96 to 120 h.

[0129] Soy peptone medium: 30-60 g / L soy peptone, 15-35 g / L sucrose, 15-35 g / L glucose, 10-25 g / L galactose, 20-60 mg / L uracil.

[0130] (2) Product extraction

[0131] Take 1 mL of fermentation broth, centrifuge at 12000 rpm for 5 min, discard the supernatant, add 1 mL of methanol and 0.5 g of glass beads for grinding and crushing, centrifuge at 12000 rpm for 10 min, and take the upper methanol to determine the production of ursolic acid and oleanolic acid.

[0132] The results are shown in Table 7.

[0133] Table 7 Yields of strains S1 to S6

[0134]

[0135]

[0136] Example 8 Preparation of Ursolic Acid and Oleanolic Acid by Fermentation in a 3-L Fermentor of Saccharomyces cerevisiae Strain S6

[0137] The specific steps are as follows:

[0138] (1) Preparation of primary seed solution

[0139] The recombinant Saccharomyces cerevisiae strain S6 was selected and placed in 2 mL of YPD medium and cultured at 25-35°C and 220-280 rpm for 18-24 h.

[0140] (2) Preparation of secondary seed solution

[0141] The inoculum was transferred to a 500 mL flat-bottom flask containing 150 mL of soy peptone medium at a 1% (v / v) inoculum volume, and cultured at 25-35° C. and 220-280 rpm for 18-24 h.

[0142] (3) 3-L fermenter culture

[0143] The inoculum was transferred to a 3-L fermenter containing 1.5 L of soy peptone medium at a 10% (v / v) inoculum. Before induction, 800 g / L of glucose was used as the carbon source. At 48 hours, galactose was added as an inducer at a final concentration of 15-25 g / L. After 48 hours, 790 g / L of ethanol was used as the carbon source, maintaining the ethanol concentration below 10 g / L. The fermentation results are as follows: Figure 1 At 108 h, 1132.9 mg / L of ursolic acid and 433.9 mg / L of oleanolic acid were synthesized in the 3-L fermenter.

[0144] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A saccharomyces cerevisiae for increasing the yield of ursolic acid and oleanolic acid, characterized in that: The brewer's yeast was prepared by using the brewer's yeast Y6 in the publication number CN113502235A as the starting strain, integrating and expressing the nucleotide sequence shown in SEQ ID NO.8, at least two copies of the nucleotide sequence shown in SEQ ID NO.6, and at least one copy of the nucleotide sequence shown in SEQ ID NO.3, replacing the gene sequence encoding malate synthase MLS1 on the genome with the nucleotide sequence shown in SEQ ID NO.2, and using the promoter P HXT1 Replace the original promoter P of lanosterol synthase ERG7 on the genome ERG7 .

2. The brewer's yeast according to claim 1, characterized in that: The Saccharomyces cerevisiae expresses the fusion protein PLN1-CrAO-AtCPR1; the nucleotide sequence of the fusion protein PLN1-CrAO-AtCPR1 is shown in SEQ ID NO.

1.

3. The brewer's yeast according to claim 1, wherein: The NADH kinase POS5 is enhancedly expressed in the yeast cerevisiae; the nucleotide sequence of the NADH kinase POS5 is shown in SEQ ID NO.

5.

4. A method for increasing the yield of ursolic acid and oleanolic acid, characterized in that: The method comprises the step of fermenting with the brewer's yeast according to any one of claims 1 to 3.

5. The method according to claim 4, characterized in that: The brewer's yeast is activated and cultured in a seed culture medium to obtain a seed liquid, which is then inoculated into a fermentation culture medium for fermentation culture.

6. The method according to claim 5, characterized in that: The brewer's yeast is activated in a seed culture medium at 25-35° C. to obtain a seed solution, the seed solution is inoculated into a fermentation medium at an inoculation rate of 1-5%, and fermentation is carried out at 25-35° C.

7. The method according to claim 6, characterized in that: The seed culture medium is YPD culture medium; the fermentation culture medium is soy peptone culture medium.

Images