Genetically engineered bacterium for efficiently synthesizing gamma-aminobutyric acid from beginning by efficiently utilizing mixed carbon source, method and application

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a genetically engineered bacterium for efficiently synthesizing gamma-aminobutyric acid from the beginning by efficiently utilizing a mixed carbon source, a method and application, and the genetically engineered bacterium is obtained by overexpressing edd from Zymomonas mobilis on the basis of escherichia coli E. coli G16; eda from the zymomonas mobilis is over-expressed; performing overexpression on acs (Acetobacter pasteurianus) sources; a malic acid synthase gene aceB is knocked out; a malic acid synthase gene glcB is knocked out; and the acetyl phosphate transferase gene eutD is knocked out. The escherichia coli strain which is clear in genetic background and capable of producing gamma-aminobutyric acid is utilized, and an ED path and an acetic acid utilization path are introduced, so that acetyl CoA branch metabolism is reduced, and the yield and conversion rate of gamma-aminobutyric acid are remarkably improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular to a genetically engineered bacterium, method and application of efficiently synthesizing γ-aminobutyric acid de novo using mixed carbon sources. Background Technology

[0002] Gamma-aminobutyric acid (GABA), also known as 4-aminobutyric acid, is a four-carbon non-protein amino acid. Its molecular formula is C4H9NO2. GABA was first successfully synthesized chemically in the early 1880s. Subsequent research revealed that GABA is widely distributed in various organisms, including algae, bacteria, fungi, animals, plants, and cyanobacteria. Although GABA exists in many foods such as fruits, vegetables, and grains, its content is relatively low. Therefore, for many years, much research has focused on finding the most suitable production strategies to increase the GABA content in food. In recent years, the main production methods have been chemical synthesis, plant enrichment, and microbial fermentation.

[0003] Chemical synthesis is the traditional method for GABA production, primarily utilizing chemical reagents. Its core pathways include glutamate decarboxylation, acrylonitrile ammoniation, and cyclization intermediate conversion. However, chemical synthesis typically requires hazardous or extremely harsh conditions and produces numerous byproducts, many of which are toxic, making it unsuitable for use as pharmaceuticals or food additives. Plant extraction, which yields natural GABA from GABA-rich plants, is environmentally friendly and produces natural products, but its limitations in raw material availability and extraction efficiency hinder large-scale production. Enzymatic catalysis, another major method for GABA production, has also been extensively studied. In this pathway, isolated GAD enzymes are used as catalysts for GABA production, synthesizing GABA under specific conditions. However, GAD enzymes thrive in acidic environments (pH 5-7) and require pyridoxal phosphate catalysis, making in vitro reaction conditions harsh and unsuitable for large-scale production. Microbial fermentation for GABA production generally utilizes the glutamate decarboxylation (GAD) pathway. The putrescine pathway has high nitrogen source requirements and easily produces putrescine-related byproducts, therefore it is not used for GABA production. The glutamate decarboxylation pathway (GAD) utilizes GAD within microorganisms to convert glutamate into GABA. Glutamate decarboxylases are regulated by pyridoxal phosphate and are widely found in microorganisms such as Escherichia coli and yeast. Microbial fermentation has become a more promising method for GABA production due to its environmental friendliness, low cost, and ease of operation.

[0004] By comparison, the following patent publications related to this invention patent application were found: 1. A γ-aminobutyric acid (GABA) producing strain and its construction method and application (CN 18165907 B). This invention relates to the fields of compound biotechnology and fermentation engineering technology production, and in particular to a γ-aminobutyric acid (GABA) producing strain and its construction method. The producing strain is characterized by: […]. E.coil W3110 was used as the starting strain, and after modification, this strain indeed... puuE , gabT , aceA ; overexpressed gadA , gadB , gdhA Genes; heterologous expression of origin Corynebacterium glutamicum strain K051 glsK , gltB , gltD Genes were extracted, ultimately yielding a γ-aminobutyric acid (GABA) producing strain numbered GABAS-13. Fermentation in a 5 L fermenter for 48 h resulted in a final GABA yield of 31.3 g / L.

[0005] 2. A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid (GABA) de novo using inexpensive carbon sources, its method, and its application (CN 120098883 B), wherein the genetically engineered bacterium is a wild-type *Escherichia coli*. E. coli Based on MG1655, the phage-derived T7 RNA polymerase gene was overexpressed. T7RNAP Xylose promoter P xylF Control; GABA transaminase gene missing gabT and puuE Overexpression of the endogenous GABA transporter gene in E. coli gadC Overexpression of the glutamate decarboxylase gene derived from Bacillus megaterium gad bm Overexpression of the glutamate dehydrogenase gene derived from Corynebacterium glutamicum gdh ( cgl2079 Overexpression of the endogenous citrate synthase gene in E. coli gltA Overexpression of the pyruvate carboxylase gene from Corynebacterium glutamicum pyc ( cgl0689 Overexpression of the endogenous phosphoenolpyruvate carboxylase gene in Escherichia coli. ppc Three growth-coupled promoters, namely P, are used. rpst 、 P rpsl 、 P rrnc Dynamically regulate the 2-ketoglutarate dehydrogenase gene in the GABA production pathway of Escherichia coli. sucA and amino acid N-acetyltransferase gene argAFermentation in a 5 L fermenter for 38 h yielded a final γ-aminobutyric acid (GABA) yield of 35.4 g / L.

[0006] By comparison, the present invention patent application is fundamentally different from the aforementioned patent publications. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide a genetically engineered bacterium, method and application for efficient de novo synthesis of γ-aminobutyric acid using mixed carbon sources.

[0008] The technical solution adopted by this invention to solve its technical problem is: A genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid (GABA) de novo using a mixed carbon source, wherein the genetically engineered bacterium is *Escherichia coli*. E. coli Based on G16 (disclosed in Chinese Patent Publication CN120098883B), this method overexpresses the 6-phosphoglucuronide dehydrogenase gene derived from *Mammotrophic motilityformes*. edd Overexpression of the 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility*. eda Overexpression of the acetyl-CoA synthase gene derived from *Acetobacter pasteurization* acs Knockout of malate synthase gene aceB Knockout of malate synthase gene glcB Knockout of acetylphosphotransferase gene eutD .

[0009] Furthermore, the gene edd The nucleotide sequence of the gene is SEQ ID NO.1; eda The nucleotide sequence is SEQ ID NO.2; the gene acs The nucleotide sequence is SEQ ID NO.3; the gene aceB The nucleotide sequence is SEQ ID NO.4; the gene glcB The nucleotide sequence is SEQ ID NO.5; the gene eutD The nucleotide sequence is SEQ ID NO.6.

[0010] The application of genetically engineered bacteria in the production of γ-aminobutyric acid, as described above.

[0011] The method for constructing genetically engineered bacteria as described above involves using CRISPR / Cas9-mediated gene editing technology. E. coli The G16 genome was obtained through targeted modification.

[0012] Furthermore, the specific steps are as follows: (1) In Escherichia coli E. coliG16 yghX The 6-phosphogluconate dehydrogenase gene from *Mammotrophic motility* is integrated at the pseudogene locus. edd It is controlled by the TRC bootloader; (2) In yeeP The 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility* is integrated at the pseudogene locus. eda It is controlled by the TRC bootloader; (3) In ilvG An acetyl-CoA synthase gene derived from *Acetobacter pasteurellii* is integrated at the pseudogene locus. acs It is controlled by the TRC bootloader; (4) Knockout of malate synthase gene aceB ; (5) Knockout of malate synthase gene glcB ; (6) Knockout of acetylphosphotransferase gene eutD .

[0013] A method for producing γ-aminobutyric acid (GABA) by fermentation using genetically engineered bacteria as described above, wherein the method improves the yield and conversion rate of GABA through fermentation with mixed carbon sources.

[0014] Furthermore, the method employs a fermentation culture method, which includes shake flask fermentation or fermenter fermentation.

[0015] Furthermore, the specific operating steps are as follows: During fermentation in the fermenter, the bacterial culture of the genetically engineered bacteria is evenly spread on an activation slant and passaged. The strain on the activation slant is then inoculated into a seed culture medium and cultured at 37 ℃ for 8-10 h, with ammonia added to maintain the pH at 7.0-7.2 during the culture. The seed culture is then inoculated into the fermentation medium at an inoculation rate of 15-20% to begin fermentation. The initial pH of fermentation is controlled at 7.0-7.2, and after 6-8 h of fermentation, ammonia is added to maintain the pH at 6.3-6.5. When the glucose in the culture medium is depleted, an 80% glucose solution and a 36% acetic acid solution are added to maintain the final concentrations of residual sugar and acetic acid at 0.1-0.5%. Throughout the fermentation process, the temperature is controlled at 37 ℃, the dissolved oxygen level is controlled at 15%-30%, and the fermentation cycle is 38 h, yielding γ-aminobutyric acid (GABA).

[0016] Furthermore, the slant culture medium used for the activation slant includes: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, and agar 20 g / L; Alternatively, the seed culture medium may comprise: glucose 25-30 g / L, KH₂PO₄ 1.2-1.5 g / L, MgSO₄ 0.5-1.0 g / L, yeast extract 5-8 g / L, FeSO₄ 10-12 mg / L, MnSO₄ 10-12 mg / L, peptone 3-5 g / L, and vitamins B1, B3, B5, and B6. 12 V H Each 1.3-2.5 mg / L; pH 7.0-7.5, autoclaved at 121℃ for 20 min; Alternatively, the fermentation medium may comprise: glucose 20-25 g / L, xylose 5-10 g / L, acetic acid 10-12 g / L, MgSO4·7H2O 5-5.0 g / L, yeast extract 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, and vitamins B1, B3, B5, and B6. 12 V H Each 2-4 mg / L, VB6 50 mg / L; pH 7.0-7.5, 121℃, autoclave for 20 min.

[0017] The advantages and positive effects of this invention are as follows: 1. This invention utilizes a genetically well-defined Escherichia coli strain capable of producing γ-aminobutyric acid (GABA) and introduces a 6-phosphoglucuronide dehydrogenase gene derived from *Mammotrophic motility-promoting* bacteria. edd 2-Dehydro-3-Deoxy-glucose phosphate gene derived from *M. molybdenum* eda The ED pathway was constructed, which rapidly converts glucose into pyruvate and enters the TCA cycle, accelerating the fermentation process and improving production efficiency. By introducing the ED pathway and the acetic acid utilization pathway, the metabolism of the acetyl-CoA branch was reduced, significantly increasing the yield and conversion rate of γ-aminobutyric acid.

[0018] 2. Acetic acid is a common byproduct of Escherichia coli fermentation and a cheap fermentation carbon source. However, E. coli itself does not have an efficient pathway for utilizing acetic acid. Unlike E. coli, acetic acid bacteria (Pasteurella multocida) have the ability to naturally accumulate and utilize acetic acid. This invention introduces an acetyl-CoA synthase gene derived from acetic acid bacteria (Pasteurella multocida). acs It efficiently converts acetic acid into acetyl-CoA, providing an additional available carbon source for the synthesis of γ-aminobutyric acid.

[0019] 3. Acetyl-CoA is a crucial node in carbon metabolism, and increasing its supply helps increase the content of the target product γ-aminobutyric acid (GABA). In *E. coli*, acetyl-CoA can be metabolized through several pathways, such as being converted to malate by malate synthase and to acetylphosphate by acetylphosphotransferase. Therefore, this invention knocks out the malate synthase gene. aceB and glcB Knockout of acetylphosphotransferase gene eutD This can reduce the consumption of acetyl-CoA, thereby further increasing the flow of acetyl-CoA to the TCA cycle for the synthesis of the target product γ-aminobutyric acid.

[0020] 4. The engineered Escherichia coli strain for producing γ-aminobutyric acid (GABA) constructed in this invention can achieve a yield of 52.6 g / L and a sugar conversion rate of 20.5% after fermentation in a 5 L fermenter for 38 h without the addition of glutamic acid. Compared with the starting strain, the yield of GABA (35.4 g / L) and the sugar conversion rate (16.3%) are increased by 48.6% and 25.8%, respectively. This is the highest yield and conversion rate of GABA synthesized de novo by Escherichia coli reported to date, and it has good industrial application value. Attached Figure Description

[0021] Figure 1 This is a diagram illustrating the metabolic modification strategy of the genetically engineered bacteria of this invention. Figure 2 This is a flowchart illustrating the process of producing γ-aminobutyric acid (GABA) using genetically engineered bacteria in this invention. Detailed Implementation

[0022] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0023] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0024] A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid (GABA) de novo using glucose and acetic acid as substrates, wherein the genetically engineered bacterium is *Escherichia coli*. E. coli Based on G16 (disclosed in Chinese Patent Publication CN120098883B), this method overexpresses the 6-phosphoglucuronide dehydrogenase gene derived from *Mortrophilia motilityis*. edd Overexpression of the 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility*. edaOverexpression of the acetyl-CoA synthase gene derived from *Acetobacter pasteurization* acs Knockout of malate synthase gene aceB Knockout of malate synthase gene glcB Knockout of acetylphosphotransferase gene eutD .like Figure 1 As shown.

[0025] Preferably, some genes are already registered in GeneBank, and those skilled in the art can obtain these genes via PCR. As an example, edd The gene is Gene ID: 58026217; eda The gene is Gene ID: 58026787; acs The gene is Gene ID: 66350809; aceB The gene is Gene ID: 948512; glcB The gene is Gene ID: 948857; eutD The gene is Gene ID: 946940.

[0026] edd The gene sequence is SEQ ID NO.1; eda The gene sequence is SEQ ID NO.2; acs The gene sequence is SEQ ID NO.3; aceB The gene sequence is SEQ ID NO.4; glcB The gene sequence is SEQ ID NO.5; eutD The gene sequence is SEQ ID NO.6.

[0027] The method for constructing genetically engineered bacteria as described above involves using CRISPR / Cas9-mediated gene editing technology. E. coli The G16 genome was targeted for modification.

[0028] Preferably, the specific steps are as follows: (1) In Escherichia coli E. coli G16 yghX The 6-phosphogluconate dehydrogenase gene from *Mammotrophic motility* is integrated at the pseudogene locus. edd It is controlled by the TRC bootloader; (2) In yeeP The 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility* is integrated at the pseudogene locus. eda It is controlled by the TRC bootloader; (3) In ilvG An acetyl-CoA synthase gene derived from *Acetobacter pasteurellii* is integrated at the pseudogene locus. acsIt is controlled by the TRC bootloader; (4) Knockout of malate synthase gene aceB ; (5) Knockout of malate synthase gene glcB ; (6) Knockout of acetylphosphotransferase gene eutD .

[0029] A method for producing γ-aminobutyric acid (GABA) by fermentation using genetically engineered bacteria as described above, wherein the method improves the yield and conversion rate of GABA through fermentation with mixed carbon sources.

[0030] Preferably, the method employs a fermentation culture method, which includes shake flask fermentation or fermenter fermentation, and the specific operation steps are as follows: During fermentation in the fermenter, the bacterial culture of the genetically engineered bacteria is evenly spread on an activation slant and passaged. The strain on the activation slant is then inoculated into a seed culture medium and cultured at 37 ℃ for 8-10 h, with ammonia added to maintain the pH at 7.0-7.2 during the culture. The seed culture is then inoculated into the fermentation medium at an inoculation rate of 15-20% to begin fermentation. The initial pH of fermentation is controlled at 7.0-7.2, and after 6-8 h of fermentation, ammonia is added to maintain the pH at 6.4-6.5. When the glucose in the culture medium is depleted, an 80% glucose solution and a 36% acetic acid solution are added to maintain the final concentrations of residual sugar and acetic acid at 0.1-0.5%. Throughout the fermentation process, the temperature is controlled at 37 ℃, the dissolved oxygen level is controlled at 15%-30%, and the fermentation cycle is 38 h, yielding γ-aminobutyric acid (GABA).

[0031] Preferably, the slant culture medium used for the solid slant and activated slant includes: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, and agar 20 g / L. Alternatively, the seed culture medium may comprise: glucose 25-30 g / L, KH₂PO₄ 1.2-1.5 g / L, MgSO₄ 0.5-1.0 g / L, yeast extract 5-8 g / L, FeSO₄ 10-12 mg / L, MnSO₄ 10-12 mg / L, peptone 3-5 g / L, and vitamins B1, B3, B5, and B6. 12 V H Each 1.3-2.5 mg / L; pH 7.0-7.5, autoclaved at 121℃ for 20 min; Alternatively, the fermentation medium may comprise: glucose 20-25 g / L, xylose 5-10 g / L, acetic acid 10-12 g / L, KH₂PO₄ 2.5-5.0 g / L, MgSO₄·7H₂O 1.2-2.0 g / L, yeast extract 4-8 g / L, FeSO₄ 20-24 mg / L, MnSO₄ 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, and vitamins B1, B3, B5, and B6. 12 V H Each 2-4 mg / L, VB6 50 mg / L; pH 7.0-7.5, 121℃, autoclave for 20 min.

[0032] Specifically, the relevant preparation and testing methods are as follows: 1. Gene editing methods This invention employs a CRISPR / Cas9-mediated gene editing method, which can be referenced in the literature (Metabolic Engineering, 2015, 31: 13-21.). CRISPR / Cas9 is a precise and efficient novel gene-targeting modification technology. The two plasmids used in this method are pGRB and pREDCas9. The pREDCas9 plasmid is a temperature-sensitive plasmid carrying a gRNA plasmid elimination system, a λ phage Red recombination system, and a Cas9 protein expression system. It is resistant to zirconia (working concentration: 100 mg / L) and has an optimal incubation temperature of 32 ℃. The pGRB plasmid, with pUC18 as its backbone, contains the promoter J23100, a gRNA-Cas9 binding region sequence, and a terminator sequence. It is resistant to ampicillin (working concentration: 100 mg / L) and has an optimal incubation temperature of 37 ℃.

[0033] 2. The specific process of strain construction A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid (GABA) de novo using glucose and acetic acid as substrates, wherein the genetically engineered bacterium is *Escherichia coli*. E. coli Based on G16 (disclosed in Chinese Patent Publication CN120098883B), this method overexpresses the 6-phosphoglucuronide dehydrogenase gene derived from *Mortrophilia motilityis*. edd Overexpression of the 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility*. eda Overexpression of the acetyl-CoA synthase gene derived from *Acetobacter pasteurization* acs Knockout of malate synthase gene aceB Knockout of malate synthase gene glcB Knockout of acetylphosphotransferase gene eutD .

[0034] 2.1edd Genes in E. coli G16 genome yghX Integration at pseudogene sites according to E. coli Using the MG1655 genome as a template, based on its yghX Design homologous arm primers UP- for upstream and downstream sequences of pseudogenes yghX -S(SEQ ID NO.7), UP- yghX -A (SEQ ID NO. 8) and DOWN- yghX -S(SEQ ID NO.9), DOWN- yghX -A (SEQ ID NO.10), and its upstream and downstream homologous arm fragments were amplified by PCR; according to edd Design primers based on gene sequences. edd -UP(SEQ ID NO.11) edd -DOWN (SEQ ID NO.12), and amplify edd Gene fragments, the above fragments were obtained by overlapping PCR to contain... edd Integration fragment of gene (upstream homologous arm - P) trc edd -Downstream homologous arm). Design primers for gRNA- yghX -S (SEQ ID NO.13) and gRNA- yghX -A (SEQ ID NO.14) amplification includes yghX A 20 bp target DNA fragment from the gene sequence is recombinated with a linearized pGRB vector to obtain recombinant pGRB-. yghX Integrate fragments and pGRB- yghX Electroconversion to a plasmid containing pREDCas9 E. coli G16 competent cells were resuscitated and cultured in SOC medium to obtain single colonies. Positive recombinants were obtained by PCR colony verification. Then, pGRB- (used for gene editing) was eliminated. yghX strain E. coliS1 .

[0035] 2.2 eda Genes in E. coli S1 genome yeeP Integration at pseudogene sites according to E. coliMG1655 Using the genome as a template, based on its yeeP Design homology arm primers UP- for upstream and downstream sequences of pseudogenes yeeP -S(SEQ ID NO.15), UP- yeeP -A (SEQ ID NO.16) and DOWN- yeeP-S(SEQ ID NO.17), DOWN- yeeP -A (SEQ ID NO.18), and its upstream and downstream homologous arm fragments were amplified by PCR; according to eda Design primers based on gene sequences. eda -UP(SEQ ID NO.19) eda -DOWN (SEQ ID NO.20), and amplify eda Gene fragments, the above fragments were obtained by overlapping PCR to contain... eda Integration fragment of gene (upstream homologous arm - P) trc eda -Downstream homologous arm). Design primers for gRNA- yeeP -S (SEQ ID NO.21) and gRNA- yeeP -A (SEQ ID NO.22) amplification includes yeeP A 20 bp target DNA fragment from the gene sequence is recombinated with a linearized pGRB vector to obtain recombinant pGRB-. yeeP Integrate fragments and pGRB- yeeP Electroconversion to a plasmid containing pREDCas9 E. coli S1 In competent cells, single colonies were obtained through resuscitation culture, and positive recombinants were obtained by PCR colony verification. Then, pGRB- for gene editing was eliminated. yeeP strain E. coliS2 .

[0036] 2.3 acs Genes in E. coli S2 genome ilvG Integration at pseudogene sites according to E. coliMG1655 Using the genome as a template, based on its ilvG Design homology arm primers UP- for upstream and downstream sequences of pseudogenes ilvG -S(SEQ ID NO.23), UP- ilvG -A (SEQ ID NO.24) and DOWN- ilvG -S(SEQ ID NO.25), DOWN- ilvG -A (SEQ ID NO.26), and its upstream and downstream homologous arm fragments were amplified by PCR; according to acs Design primers based on gene sequences. acs -UP(SEQ ID NO.27), acs -DOWN (SEQ ID NO.28), and amplify acs Gene fragments, the above fragments were obtained by overlapping PCR to contain... acs Integration fragment of gene (upstream homologous arm - P)trc acs -Downstream homologous arm). Design primers for gRNA- ilvG -S (SEQ ID NO.29) and gRNA- ilvG -A (SEQ ID NO.30) amplification includes ilvG A 20 bp target DNA fragment from the gene sequence is recombinated with a linearized pGRB vector to obtain recombinant pGRB-. ilvG Integrate fragments and pGRB- ilvG Electroconversion to a plasmid containing pREDCas9 E. coli S2 In competent cells, single colonies were obtained through resuscitation culture, and positive recombinants were obtained by PCR colony verification. Then, pGRB- for gene editing was eliminated. [[ID= strain ​ .

[0037] 2.4 ​ Gene knockout according to ​ Design upstream homologous arm primers UP- for gene upstream and downstream sequences. ​ -S(SEQ ID NO.31), UP- ​ -A (SEQ ID NO.32) and downstream homologous arm primer DOWN- ​ -S(SEQ ID NO.33), DOWN- ​ -A(SEQ ID NO.34), with ​ Using a template, upstream and downstream homologous arms were amplified using PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained through recombinant PCR. This was achieved using primers and gRNA- ​ -S (SEQ ID NO.35) and gRNA- ​ Annealing of -A (SEQ ID NO.36) yields a product containing... ​ A 20 bp target DNA fragment of the target gene is recombinated with a linearized pGRB vector to obtain recombinant pGRB- ​ Integrate fragments and pGRB- ​ Electroconversion to a plasmid containing pREDCas9 ​ S3 competent cells were revived and cultured to obtain single colonies. Positive recombinants were obtained through PCR colony verification. Then, pGRB- for gene editing was eliminated. ​ strain ​ .

[0038] 2.5 ​ Gene knockout according to ​ Design upstream homologous arm primers UP- for gene upstream and downstream sequences.​ -S(SEQ ID NO.37), UP- ​ -A (SEQ ID NO.38) and downstream homologous arm primer DOWN- ​ -S(SEQ ID NO.39), DOWN- ​ -A(SEQ ID NO.40), with ​ Using a template, upstream and downstream homologous arms were amplified using PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained through recombinant PCR. This was achieved using primers and gRNA- ​ -S (SEQ ID NO.41) and gRNA- ​ Annealing of -A (SEQ ID NO.42) yields a product containing... ​ A 20 bp target DNA fragment of the target gene is recombinated with a linearized pGRB vector to obtain recombinant pGRB- ​ Integrate fragments and pGRB- ​ Electroconversion to a plasmid containing pREDCas9 ​ S4 competent cells were revived and cultured to obtain single colonies. Positive recombinants were obtained through PCR colony verification. Then, pGRB- for gene editing was eliminated. ​ strain ​ .

[0039] 2.6 ​ Gene knockout according to ​ Design upstream homologous arm primers UP- for gene upstream and downstream sequences. ​ -S(SEQ ID NO.43), UP- ​ -A (SEQ ID NO.44) and downstream homologous arm primer DOWN- ​ -S(SEQ ID NO.45), DOWN- ​ -A(SEQ ID NO.46), with ​ Using a template, upstream and downstream homologous arms were amplified using PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained through recombinant PCR. This was achieved using primers and gRNA- ​ -S (SEQ ID NO.47) and gRNA- ​ Annealing of -A (SEQ ID NO.48) yields a product containing... ​ A 20 bp target DNA fragment of the target gene is recombinated with a linearized pGRB vector to obtain recombinant pGRB- ​ Integrate fragments and pGRB- ​ Electroconversion to a plasmid containing pREDCas9 ​S5 competent cells were revived and cultured to obtain single colonies. Positive recombinants were obtained through PCR colony verification. Then, pGRB- for gene editing was eliminated. ​ strain ​ .

[0040] 3. Primers used in strain construction All primers used in the strain construction process are listed in the table below:

[0041]

[0042]

[0043] Example 2: Using genetically engineered bacteria ​ 5 L fermenter for the production of γ-aminobutyric acid.

[0044] Use an inoculation loop to pick up the genetically engineered bacteria from the preservation tube. ​ The bacterial culture was evenly spread on activation slant and subcultured. The strain from the activation slant was then inoculated into seed culture medium and incubated at 37 °C for 8 h, with the pH maintained at 7.2 by adding ammonia during the incubation process. The seed culture was then inoculated into fermentation medium at a rate of 15% to begin fermentation. The initial pH of fermentation was controlled at 7.0, and after 8 h of fermentation, the pH was maintained at 6.4 by adding ammonia. When the glucose in the culture medium was depleted, an 80% glucose solution and a 36% acetic acid solution were added to maintain the final concentrations of residual sugar and acetic acid at 0.1-0.5%. Throughout the fermentation process, the temperature was controlled at 37 °C, the dissolved oxygen level was controlled at 15%-30%, and the fermentation cycle was 38 h.

[0045] The slant culture medium formula is as follows: glucose 1 g / L, peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, sodium chloride 2.5 g / L, and agar 30 g / L; The seed culture medium formula is as follows: glucose 25-30 g / L, KH2PO4 1.2-1.5 g / L, MgSO4 0.5-1.0 g / L, yeast extract 5-8 g / L, FeSO4 10-12 mg / L, MnSO4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, and VB6. 12 V H Each 1.3-2.5 mg / L, pH 7.0-7.5, 121℃, autoclave for 20 min.

[0046] The fermentation medium formula is as follows: glucose 20-25 g / L, xylose 5-10 g / L, acetic acid 10-12 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast extract 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, and VB6. 12 V H Each 2-4 mg / L, VB6 50 mg / L, pH 7.0-7.5, 121℃, autoclave for 20 min.

[0047] The concentration of γ-aminobutyric acid (GABA) in fermentation supernatant was determined using high-performance liquid chromatography (HPLC), such as... ​ As shown, ​ S6 The genetically engineered strain can produce 52.6 g / L of GABA and achieve a sugar conversion rate of 20.5% after 38 h of fermentation. Compared with the starting strain G16 (disclosed in Chinese patent publication CN120098883B), the yield of γ-aminobutyric acid (GABA) (35.4 g / L) and the sugar conversion rate (16.3%) are increased by 48.6% and 25.8%, respectively.

[0048] The relevant sequences are as follows: Gene sequences in this invention: SEQ ID NO.1: Gene of 6-phosphoglucuronide dehydrogenase from *M. motile fermentum* ​ SEQ ID NO.2: Zymomonas mobilis-derived 2-dehydro-3-deoxy-glucose phosphate gene ​ ATGCGTGATATCGATTCCGTAATGCGTTTGGCACCGGTTATGCCGGTCCTCGTCATTGAAGATATTGCTGATGCAAAACCTATCGCAGAAGCTTTGGTTGCTGGTGGTCTGAACGTTCTTGAAGTAACGCTTCGCACCCCTTGTGCTCTTGAAGCCATCAAGATCATGAAAGAAGTTCCGGGTGCCGTTGTTGGTGCCGGTACGGTTCTGAACGCAAAAATGCTCGACCAAGCTCAGGAAGCTGGTTGCGAATTTTTCGTTAGCCCGGGTCTGACCGCTGACCTCGGCAAGCATGCTGTTGCCCAGAAAGCAGCTTTGCTTCCAGGTGTTGCTAATGCTGCTGATGTGATGCTTGGTCTTGACCTTGGTCTTGATCGCTTCAAATTCTTCCCGGCTGAAAATATCGGTGGTTTACCTGCCCTGAAGTCCATGGCTTCTGTTTTCCGTCAGGTTCGTTTCTGCCCGACCGGCGGTATCACCCCGACGTCAGCTCCTAAATATCTTGAAAACCCGTCCATTCTTTGCGTCGGTGGTAGCTGGGTTGTTCCGGCTGGCAAACCAGATGTCGCAAAAATCACGGCACTCGCTAAAGAAGCTTCTGCTTTCAAGCGCGCTGCTGTTGCCTAA SEQ ID NO.3: Acetobacter pasteurianus-derived acetyl-CoA synthase gene ​ SEQ ID NO.4: Malate synthase gene ​ SEQ ID NO.5: Malate synthase gene ​ SEQ ID NO.6: Acetylphosphotransferase gene ​ Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid de novo using a mixed carbon source, characterized by: The genetically engineered bacteria are *Escherichia coli*. E. coli Based on G16, overexpression of the 6-phosphate gluconate dehydrogenase gene derived from *Mammotrophic motility* is performed. edd Overexpression of the 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility*. eda Overexpression of the acetyl-CoA synthase gene derived from *Acetobacter pasteurization* acs Knockout of malate synthase gene aceB Knockout of malate synthase gene glcB ; Knockout of acetylphosphotransferase gene eutD .

2. The genetically engineered bacteria according to claim 1, characterized in that: The gene edd The nucleotide sequence is SEQ ID NO.1; the gene eda The nucleotide sequence is SEQ ID NO.2; the gene acs The nucleotide sequence of the gene is SEQ ID NO.3; aceB The nucleotide sequence is SEQ ID NO.4; the gene glcB The nucleotide sequence of the gene is SEQ ID NO. 5; eutD The nucleotide sequence is SEQ ID NO.

6.

3. The application of the genetically engineered bacteria as described in claim 1 or 2 in the production of γ-aminobutyric acid.

4. The method for constructing genetically engineered bacteria as described in claim 1 or 2, characterized in that: The method employs CRISPR / Cas9-mediated gene editing technology to... E. coli The G16 genome was obtained through targeted modification.

5. The construction method according to claim 4, characterized in that: The specific steps are as follows: (1) In Escherichia coli E. coli G16 yghX The 6-phosphate gluconate dehydrogenase gene from *Mammotrophic motility* is integrated at the pseudogene locus. edd It is controlled by the TRC bootloader; (2) In yeeP The pseudogene locus integrates the 2-dehydro-3-deoxy-glucose phosphate gene derived from *Mammotrophic motility*. eda It is controlled by the TRC bootloader; (3) In ilvG The acetyl-CoA synthase gene derived from *Acetobacter pasteurellii* is integrated at the pseudogene locus. acs It is controlled by the TRC bootloader; (4) Knockout of malate synthase gene aceB ; (5) Knockout of malate synthase gene glcB ; (6) Knockout of acetylphosphotransferase gene eutD .

6. A method for producing γ-aminobutyric acid by fermentation using genetically engineered bacteria as described in claim 1 or 2, characterized in that: The method improves the yield and conversion rate of γ-aminobutyric acid through fermentation with mixed carbon sources.

7. The method according to claim 6, characterized in that: The method employs a fermentation culture method, which includes shake flask fermentation or fermenter fermentation.

8. The method according to claim 7, characterized in that: The specific steps are as follows: During fermentation in the fermenter, the bacterial culture of the genetically engineered bacteria is evenly spread on an activation slant and passaged. The strain on the activation slant is then inoculated into a seed culture medium and cultured at 37 ℃ for 8-10 h, with ammonia added to maintain the pH at 7.0-7.2 during the culture. The seed culture is then inoculated into the fermentation medium at an inoculation rate of 15-20% to begin fermentation. The initial pH of fermentation is controlled at 7.0-7.2, and after 6-8 h of fermentation, ammonia is added to maintain the pH at 6.3-6.

5. When the glucose in the culture medium is depleted, an 80% glucose solution and a 36% acetic acid solution are added to maintain the final concentrations of residual sugar and acetic acid at 0.1-0.5%. Throughout the fermentation process, the temperature is controlled at 37 ℃, the dissolved oxygen level is controlled at 15%-30%, and the fermentation cycle is 38 h, yielding γ-aminobutyric acid (GABA).

9. The method according to claim 8, characterized in that: The slant culture medium used for the activation slant includes: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast extract 5-8 g / L, NaCl 2.5-5 g / L, and agar 20 g / L. Alternatively, the seed culture medium may comprise: glucose 25-30 g / L, KH₂PO₄ 1.2-1.5 g / L, MgSO₄ 0.5-1.0 g / L, yeast extract 5-8 g / L, FeSO₄ 10-12 mg / L, MnSO₄ 10-12 mg / L, peptone 3-5 g / L, and vitamins B1, B3, B5, and B6. 12 V H Each 1.3-2.5 mg / L; pH 7.0-7.5, autoclaved at 121℃ for 20 min; Alternatively, the fermentation medium may comprise: glucose 20-25 g / L, xylose 5-10 g / L, acetic acid 10-12 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast extract 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, and vitamins B1, B3, B5, and B6. 12 V H Each 2-4 mg / L, VB6 50 mg / L; pH 7.0-7.5, 121℃, autoclave for 20 min.

Images