A method of increasing 2-pyrrolidone synthesis

By expressing Butyricicoccus faecihominis CoA transferase in Corynebacterium glutamicum and enhancing its secretory expression, the problems of high energy consumption and low yield in the synthesis of 2-pyrrolidone in the prior art have been solved, and efficient and low-cost fermentation production of 2-pyrrolidone has been achieved.

CN116179456BActive Publication Date: 2026-04-10SENRIS BIOTECHNOLOGY (SHENZHEN) CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SENRIS BIOTECHNOLOGY (SHENZHEN) CO LTD
Filing Date
2022-12-02
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing chemical and microbial methods for synthesizing 2-pyrrolidone suffer from high energy consumption, cumbersome processes, severe pollution, and insufficient yield, making it difficult to meet industrialization needs.

Method used

A CoA transferase derived from Butyricicoccus faecihominis was expressed in Corynebacterium glutamicum, and its secretory expression was enhanced by the Ptacm promoter and NS signal peptide to construct an engineered strain that produces 2-pyrrolidone efficiently. The strain was then fermented with glucose in a one-step process at pH 7.0.

Benefits of technology

The efficient production of 2-pyrrolidone was achieved, with a yield of 12.13 g/L after 96 hours of fermentation, which significantly increased the yield and reduced the cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179456B_ABST
    Figure CN116179456B_ABST
Patent Text Reader

Abstract

The application discloses a method for increasing 2-pyrrolidone synthesis and belongs to the technical field of bioengineering. tacm The CoA transferase from Butyricicoccus faecihominis is expressed in the coryneform bacterium glutamicum, and the CoA transferase is secreted and expressed by means of P The promoter and the NS signal peptide strengthen the secretory expression of the CoA transferase, so that the constructed strain can ferment 2-pyrrolidone in a glucose carbon source and in a pH 7.0 environment, and the yield of the 2-pyrrolidone can reach 12.13 g / L in 96 h of flask fermentation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a method for increasing the synthesis of 2-pyrrolidone, belonging to the field of genetic engineering technology. BACKGROUND

[0002] 2-pyrrolidone (2-Pyrrolidone, 2P), also known as 2-oxopyrrolidine and gamma-butyrolactam, is a class of pyrrolidine compounds with a five-membered lactam ring, which is widely present in natural products and various artificially synthesized compounds. 2-pyrrolidone is a raw material for producing polyvinyl pyrrolidone, nylon-4 and acrylamide pyrrolidone, and has wide and important uses in the medical and industrial fields.

[0003] 2-pyrrolidone can be synthesized by chemical or biological methods. The chemical synthesis is usually obtained by amination of gamma-butyrolactone. With butanediol as raw material, gamma-butyrolactone is generated in the presence of copper catalyst at 200°C, and then reacts with ammonia (or amine) to produce 2-pyrrolidone. Another chemical synthesis method is to use 4-hydroxybutyramide as raw material to prepare by dehydration under high pressure and high temperature. The use of chemical method to produce 2-pyrrolidone has the defects of high energy consumption, complicated process, harsh reaction conditions, serious pollution and low safety.

[0004] In recent years, there have been some domestic and foreign literatures reported on the use of microorganisms to produce 2-pyrrolidone. At present, the highest yield is Tong Un Chae, which can reach 54g / L by modifying Escherichia coli, but the yield still cannot meet the needs of industrialization. The yield of 2-pyrrolidone produced by fermentation of Corynebacterium glutamicum and other microorganisms is relatively low, resulting in high cost and difficult commercial application. SUMMARY

[0005] In view of the above defects existing in the prior art, the present application provides a Corynebacterium glutamicum engineering strain with high yield of 2-pyrrolidone, which expresses CoA transferase from Butyricicoccus faecihominis. The strain can produce 2-pyrrolidone from glucose by one-step method under the condition of pH 7.0.

[0006] In one embodiment, the CoA transferase has an amino acid sequence as shown in Genbank accession number: MCQ5130945.1.

[0007] In an embodiment, the engineered bacteria use pCES plasmid as an expression vector; the pCES plasmid is disclosed in the paper "Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum".

[0008] In an embodiment, the upstream of the coding gene of the CoA transferase also has the signal peptide NS shown in SEQ ID NO. 2.

[0009] In an embodiment, the coding gene of the CoA transferase is regulated by the promoter P shown in SEQ ID NO. 1. tacm Initiate transcription.

[0010] In an embodiment, the engineered bacteria use Corynebacterium glutamicum FF10 as a host, which is disclosed in the patent with publication number CN114752544B.

[0011] The application also provides the use of the Corynebacterium glutamicum engineered bacteria in the one-step production of 2-pyrrolidone.

[0012] In an embodiment, the use is to use the Corynebacterium glutamicum engineered bacteria to produce 2-pyrrolidone by fermentation using monosaccharides, polysaccharides or mixtures thereof that can be utilized by Corynebacterium glutamicum as a carbon source at pH 7.0±0.2.

[0013] In an embodiment, the carbon source includes but is not limited to one or more of glucose, fructose, sucrose, and molasses.

[0014] In an embodiment, the use is to culture the engineered bacteria in a seed medium for a period of time, collect the seed liquid, and then inoculate the seed liquid into a fermentation medium and ferment at 28-30°C for a period of time.

[0015] In an embodiment, the fermentation is carried out at 28-30°C and 150-250 rpm for at least 48 hours.

[0016] In this embodiment, the seed medium is BHIS medium.

[0017] In an embodiment, the seed liquid is obtained by culturing the engineered bacteria in BHIS medium at 28-30°C for 12 hours.

[0018] In an embodiment, the seed liquid is inoculated into the fermentation medium at an inoculation amount of 5-10%.

[0019] In one embodiment, the fermentation medium contains: glucose, (NH4)2SO4, urea, KH2PO4, K2HPO4, MgSO4·7H2O, CaCl2·2H2O, MOPS, biotin, and trace elements.

[0020] In one embodiment, the fermentation medium contains: glucose 50 g / L, (NH4)2SO4 20 g / L, urea 5 g / L, KH2PO4 1 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.25 g / L, CaCl2·2H2O 13.3 mg / L, MOPS 42 g / L, biotin 0.2 mg / L, trace element solution 1 mL / L; the trace element solution contains: FeSO4·7H2O 10 g / L, MnSO4·1H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4·5H2O 313 mg / L, NiCl·6H2O 20 mg / L.

[0021] The application also claims the use of the engineered bacteria in the production of 2-pyrrolidone or its derivatives.

[0022] In one embodiment, the derivatives include but are not limited to N-methyl pyrrolidone.

[0023] Advantages:

[0024] The application expresses CoA transferase from Butyricicoccus faecihominis in C. glutamicum, and through P tacm The promoter and NS signal peptide strengthen the secretion expression of CoA transferase, improve the expression efficiency of CoA transferase, and enable the constructed strain to ferment 2-pyrrolidone with glucose as the carbon source in an environment with pH 7.0, and the yield of 96 h fermentation can reach 12.13 g / L. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Schematic diagram for the construction of the secretion expression element of CoA transferase ACT.

[0026] Figure 2 Effect of whether CoA transferase ACT is secreted and expressed on the yield of 2-pyrrolidone. DETAILED DESCRIPTION

[0027] Technical terms:

[0028] Expression: the term "expression" includes any steps related to the production of enzymes or proteins, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0029] Expression vector: The term "expression vector" means a linear or circular DNA molecule comprising a polynucleotide encoding a glutamate decarboxylase mutant of the application and operably linked to control sequences providing for its expression.

[0030] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the application. The term "host cell" encompasses any progeny of the parent cell which is not identical to the parent cell (due to mutations that occur during replication).

[0031] Fermentation broth: "Fermentation broth" refers to a preparation produced by cells during fermentation, either without recovery or with recovery and / or purification. For example, a fermentation broth is produced when a microbial culture is incubated to saturation under carbon-limiting conditions that allow for protein synthesis (e.g., expression of an enzyme by a host cell) and secretion of the protein into the cell culture medium. The fermentation broth can contain the contents of the fermentation material as obtained at the end of fermentation. For example, the fermentation broth includes medium components that are utilized by the microorganism as well as cell debris that remains after removal of the microbial cells (e.g., filamentous fungal cells) by centrifugation.

[0032] Culture medium:

[0033] CGXII medium: glucose 50 g / L, (NH4)2SO4 20 g / L, urea 5 g / L, KH2PO4 1 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.25 g / L, CaCl2·2H2O 13.3 mg / L, MOPS 42 g / L, biotin 0.2 mg / L, trace element solution 1 mL / L, pH adjusted to 7.0 with KOH; wherein the trace element solution: FeSO4·7H2O 10 g / L, MnSO4·1H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4·5H2O 313 mg / L, NiCl·6H2O 20 mg / L.

[0034] Detection method:

[0035] Detection of 2-pyrrolidone production by liquid chromatography: Agilent liquid chromatograph 1290 equipped with a photodiode array detector, chromatographic column: InfinityLab Poroshell 120 EC C18 (2.7 μm, 4.6 x 100 mm, Agilent); mobile phase: 95% water-acetonitrile (containing 0.1% formic acid) mixed solution: methanol (90:10) isocratic elution for 5 min; flow rate 0.3 mL / min; detection wavelength 210 nm; column temperature 30 °C; injection volume 1 μL.

[0036] Construction of coenzyme A transferase ACT secretion expression plasmid in Example 1

[0037] Figure 1 For the construction of coenzyme A transferase ACT secretion expression element, the expression element includes promoter P tacm (nucleotide sequence as shown in SEQ ID NO. 1) and signal peptide NS (nucleotide sequence as shown in SEQ ID NO. 2) in turn; the coding gene (Genbank accession number MCQ5130945.1) of coenzyme A transferase ACT.

[0038] The specific steps are as follows:

[0039] The act gene (Genbank accession number MCQ5130945.1) from Butyricicoccus faecihominis strain was selected to design amplification primers:

[0040] ACTNSF: GACACCTACATGATCAGGAGCTCTTTATGCGTTCTCTGGAGGGAGTCCG, ACTR: CTACTGCCGCCAGGCAGCGGCCGCTTTAAATCGCACCGCAGGCTGCCAG.

[0041] The gene with Gene ID MCQ5130945.1 was directly synthesized as a template, and the target fragment was obtained by PCR amplification. After purification by a DNA purification kit, the PCR amplification product, the synthesized promoter P tacm fragment, and the synthesized signal peptide NS fragment were connected to the backbone fragment of plasmid pCES (the plasmid is disclosed in the paper “Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum”) by Gibson, and transformed into E. coli DH5α. The correct plasmid verified by sequencing was named pCES-NS-ACT. The recombinant strain FF10 pCES-ACT without signal peptide NS was used as a control.

[0042] Example 2 Fermentation production of 2-pyrrolidone by using Corynebacterium glutamicum engineering strain

[0043] The recombinant plasmid pCES-NS-ACT constructed in Example 1 was transformed into the permissive cells of the high-yield γ-aminobutyric acid chassis FF10 (disclosed in the patent with publication number CN114752544B) to construct the 2-pyrrolidone production recombinant strain FF10 pCES-NS-ACT.

[0044] The recombinant bacteria FF10 pCES-NS-ACT and FF10 pCES-ACT were used respectively for one-step fermentation production of 2-pyrrolidone from glucose. The specific steps were as follows: the bacteria FF10 pCES-NS-ACT or FF10 pCES-ACT were cultured in BHIS medium at 30°C for 12 hours to obtain seed liquid; the seed liquid was inoculated into 500 mL shake flask containing 50 mL CGXII medium at an inoculation amount of 10%, and then the fermentation was carried out at 30°C and 200 rpm for 96 hours.

[0045] As shown in Figure 2 , compared with the standard sample of 2-pyrrolidone, the peak of 2-pyrrolidone was detected in the fermentation liquid of the bacteria FF10 pCES-NS-ACT, which showed that the constructed bacteria could produce 2-pyrrolidone.

[0046] Figure 2 The influence of whether ACT was secreted on the production of 2-pyrrolidone in shake flask fermentation was shown. The results showed that FF10 pCES-NS-ACT could produce 12.13 g / L 2-pyrrolidone by secreting ACT in shake flask fermentation, which was 1.67 times of FF10 pCES-ACT without secreting ACT, thereby proving that the secretion of ACT could improve the yield of 2-pyrrolidone.

[0047] Comparative Example 1

[0048] The specific implementation was the same as that in Example 1, except that the promoter P tacm was replaced by P H36 promoter (the nucleotide sequence is shown as SEQ ID NO. 3). The fermentation was carried out according to the method of Example 2, and the results showed that the yield of 2-pyrrolidone of the prepared bacteria was 8.76 g / L, which was lower than that of the P tacm promoter.

[0049] Comparative Example 2

[0050] The specific implementation was the same as that in Example 1, except that the NS signal peptide was replaced by NS2 signal peptide (the nucleotide sequence is shown as SEQ ID NO. 4). The fermentation was carried out according to the method of Example 2, and the results showed that the yield of 2-pyrrolidone of the prepared bacteria was 5.13 g / L, which was lower than that without signal peptide.

[0051] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and anyone skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be defined by the claims.

Claims

1. An engineered Corynebacterium glutamicum strain having 2-pyrrolidone synthesis ability, characterized in that, expresses a CoA transferase with an amino acid sequence as shown in Genbank Accession No. MCQ5130945.1; the gene encoding the CoA transferase has a signal peptide NS as shown in SEQ ID NO. 2 upstream; the coding gene of the CoA transferase is driven by a promoter P as shown in SEQ ID NO. 1 tacm initiating transcription.

2. The Corynebacterium glutamicum engineered bacterium of claim 1, characterized in that, The CoA transferase is expressed by using pCES plasmid as an expression vector.

3. The Corynebacterium glutamicum engineered bacterium of claim 2, characterized in that, The coding gene of the CoA transferase is preceded by the promoter P tacm initiating transcription.

4. The Corynebacterium glutamicum engineered bacterium of any one of claims 1 to 3, characterized in that The Corynebacterium glutamicum engineering strain takes Corynebacterium glutamicum FF10 as a host.

5. The Corynebacterium glutamicum engineering strain according to any one of claims 1 to 4 is used in one-step production of 2-pyrrolidone or its derivative.

6. A method for the fermentative production of 2-pyrrolidone, characterized in that, The Corynebacterium glutamicum engineering strain according to any one of claims 1 to 4 is used to produce 2-pyrrolidone by fermentation with monosaccharide, polysaccharide or mixture thereof available to Corynebacterium glutamicum as a carbon source at pH 7.0±0.

2.

7. The method of claim 6, wherein, The carbon source includes one or more of glucose, fructose, sucrose and molasses.

8. The method according to claim 6 or 7, characterized in that, The fermentation is carried out at 28-30℃, 150-250rpm for at least 48h.

9. The method of claim 8, wherein, The fermentation medium contains glucose, (NH4)2SO4, urea, KH2PO4, K2HPO4, MgSO4, CaCl2, MOPS, biotin and trace elements.

Citation Information

Patent Citations

  • A one-step method for producing γ-aminobutyric acid and the construction of its strain.

    CN114752544B

  • Recombinant corynebacterium glutamicum and applications thereof in producing 2-pyrrolidone

    CN110951664A