A truncated fish peptidoglycan recognition protein and its use

By constructing and purifying truncated fish peptidoglycan recognition proteins, the solubility and yield issues of natural PGRPs in recombinant expression were resolved, achieving efficient expression and enhanced biological activity, especially enhanced antibacterial activity against Gram-positive bacteria, making it suitable for antibacterial infection control in aquaculture.

CN121609773BActive Publication Date: 2026-06-26QINGDAO AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-02-02
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing natural fish peptidoglycan recognition proteins suffer from problems such as poor solubility, low yield, and difficulty in refolding during recombinant expression, which limits their application and development in aquaculture.

Method used

By deleting non-core regions from natural PGRPs genes while retaining core functional domains, a truncated protein was constructed. Its expression was optimized in an E. coli expression system, and purified by nickel column affinity chromatography to obtain a biologically active truncated TmPGRP2 recombinant protein.

Benefits of technology

It improves the expression efficiency and biological activity of truncated proteins, enhances their binding ability to peptidoglycan and their antibacterial effect, especially significantly enhancing their antibacterial effect against Gram-positive bacteria, and has the potential for further large-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121609773B_ABST
    Figure CN121609773B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular biology, and relates to a truncated fish peptidoglycan recognition protein and application thereof. The amino acid sequence of the truncated fish peptidoglycan recognition protein is shown in Table SEQ ID NO. 1. The truncated fish peptidoglycan recognition protein provided by the present application has higher expression efficiency and higher yield in a prokaryotic expression system compared with a natural peptidoglycan recognition protein. The truncated fish peptidoglycan recognition protein has stronger binding capacity with peptidoglycan (PGN) and lipopolysaccharide (LPS), which are main components of cell walls of gram-positive bacteria and gram-negative bacteria. The bacteriostatic and agglutination capacity of the truncated fish peptidoglycan recognition protein on gram-positive bacteria and gram-negative bacteria is significantly improved. These characteristics show that the truncated fish peptidoglycan recognition protein has development potential as an aquatic immunopotentiator, and provides important support for subsequent application research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to a truncated fish peptidoglycan recognition protein and its applications. Background Technology

[0002] Pattern recognition receptors (PRRs), as an important component of fish innate immunity, play a pivotal role in maintaining homeostasis by recognizing pathogen-associated molecular patterns (PAMPs) such as peptidoglycan (PGN) and activating downstream immune cascades. Notably, peptidoglycan recognition proteins (PGRPs), as a typical PRR, not only recognize PGN, activate downstream inflammatory signaling pathways, and initiate inflammatory responses, but are also immune-active effector molecules themselves, possessing multiple immunomodulatory functions such as antibacterial and bactericidal effects as well as inhibition of inflammatory signaling pathway activity. This characteristic makes them crucial nodes in constructing the fish's immune defense network.

[0003] As important immune effector molecules, PGRPs participate in the host's immune defense through multiple mechanisms, primarily encompassing pathogen recognition, direct antibacterial activity, and immunomodulation. Studies have shown that PGRPs in mammals and fish exhibit a broader range of PAMP recognition capabilities, including peptidoglycan (PGN), lipopolysaccharide (LPS), and lipoteichoic acid (LTA), among other pathogen molecules. Furthermore, fish PGRPs often exert antibacterial effects by hydrolyzing the amide bond between N-acetylmuramic acid and L-alanine in bacterial cell wall peptidoglycan, directly disrupting bacterial structural integrity. In terms of immunomodulation, PGRPs maintain immune homeostasis through multi-level regulatory mechanisms. They not only participate in immune effector processes such as antimicrobial peptide synthesis, complement system activation, and phagocytosis, but also finely regulate inflammatory responses.

[0004] With the increasing scale of aquaculture, bacterial diseases are becoming more prevalent, posing a significant challenge to the sustainable development of the aquaculture industry. Simultaneously, excessive antibiotic use leads to drug residues, disrupts aquatic microecology, and may promote the emergence and spread of drug-resistant bacteria. Therefore, exploring new methods of disease control and reducing reliance on antibiotics is urgently needed. PGRPs, as conserved PRRs, are potential targets for developing novel disease-fighting agents. However, natural PGRPs often suffer from poor solubility, low yield, and difficulty in refolding during recombinant expression, limiting their functional validation and application development. Existing studies have attempted to improve expression efficiency and bioactivity by modifying PGRPs through techniques such as fusion expression and point mutation. This invention constructs truncated proteins based on the structural domain information of natural PGRP genes, retaining core functional fragments, aiming to improve the expression efficiency and bioactivity of PGRPs. Therefore, researching and preparing truncated PGRP proteins with enhanced bioactivity can provide a reference for research on fish innate immunity and the development of immune-enhancing products, reducing antibiotic dependence and promoting green aquaculture. Summary of the Invention

[0005] The purpose of this invention is to provide a truncated fish peptidoglycan recognition protein, analyze its activity and function, and apply it to the field of nutritional immunity in aquaculture.

[0006] This invention is achieved through the following technical solution:

[0007] The present invention first provides a truncated fish peptidoglycan recognition protein, the amino acid sequence of which is shown in SEQ ID NO.1.

[0008] Furthermore, the present invention also provides a DNA molecule comprising a nucleotide sequence or its complementary sequence encoding the truncated fish peptidoglycan recognition protein.

[0009] Furthermore, the nucleotide sequence of the DNA molecule is shown in SEQ ID NO.2.

[0010] Furthermore, the present invention also provides a plasmid containing the aforementioned DNA molecule.

[0011] Furthermore, the present invention also provides a recombinant strain containing the aforementioned plasmid.

[0012] Furthermore, the present invention also provides the application of the truncated fish peptidoglycan recognition protein, which is used to prepare products for antibacterial infection.

[0013] Furthermore, the bacteria are one or more of Staphylococcus aureus, Bacillus subtilis, Escherichia coli, and / or Aeromonas hydrophila.

[0014] Furthermore, the present invention also provides an antibacterial infection product comprising the truncated fish peptidoglycan recognition protein described above.

[0015] Furthermore, the product also contains zinc ions.

[0016] This invention first clones and obtains from liver tissue samples of greenfin pufferfish. Tm The natural PGRP2 gene sequence was analyzed using bioinformatics and molecular docking techniques. Non-core regions were deleted, core functional domains were retained, and the sequence was optimized according to E. coli codon preferences to synthesize the full gene sequence. The truncated sequence was then... Tm The PGRP2 gene was cloned into the multiple cloning site of the prokaryotic expression vector pET-28a(+), and a recombinant expression plasmid was successfully constructed. The recombinant plasmid was transformed into *E. coli* BL21(DE3) competent cells and expressed the protein by IPTG induction. High-efficiency expression of the target protein was achieved by optimizing the induction conditions. The expression product was subjected to ultrasonic disruption, washing of inclusion bodies, denaturation with 8 M urea, purification by nickel column affinity chromatography, and protein refolding by gradient dialysis to obtain a biologically active truncated protein. Tm PGRP2 recombinant protein.

[0017] The truncated fish peptidoglycan recognition protein provided by this invention has the following advantages compared with natural peptidoglycan recognition proteins:

[0018] (1) The truncated fish peptidoglycan recognition protein retains the core functional domain of the amino acid of the natural peptidoglycan recognition protein, deletes the non-core region, and improves antibacterial and other biological activities.

[0019] (2) Compared with the natural protein, the truncated fish peptidoglycan recognition protein has higher expression efficiency and higher yield in the prokaryotic expression system;

[0020] (3) In this invention, the truncated fish peptidoglycan recognition protein recombinant plasmid was transformed into the Escherichia coli expression system. Through screening, strains with high expression efficiency were successfully obtained, which have the potential to be further developed for large-scale production.

[0021] (4) The truncated fish peptidoglycan recognition protein prepared in this invention has enhanced binding ability with both L-type and D-type peptidoglycan;

[0022] (5) The truncated fish peptidoglycan recognition protein prepared in this invention is similar to that of natural fish. Tm Compared to the PGRP2 recombinant protein, it has a significantly enhanced antibacterial effect against Gram-positive bacteria;

[0023] (6) The truncated fish peptidoglycan recognition protein prepared in this invention has significantly improved the agglutination ability of both Gram-positive and Gram-negative bacteria. Attached Figure Description

[0024] Figure 1 Purified as described in the embodiments of the present invention Tm SDS-PAGE and Western blot analysis of PGRP2 truncated protein; where (a) SDS-PAGE, M is the protein molecular weight standard, 1 is the sample after disruption, 2 is the elution, and 3-4 are the elutions; (b) Western blot, M is the protein molecular weight standard, 1 is the purified sample, and 2 is Multitag Protein.

[0025] Figure 2 for Tm PGRP2 native full-length protein domain analysis diagram;

[0026] Figure 3 for Tm Diagram showing the docking analysis between the natural full-length PGRP2 protein and the Gram-positive bacterial peptidoglycan derivative muramyl tripeptide (MTP); where A represents the overall structure of the protein molecule; B represents a detailed view within the red box in A; and C represents a simplified diagram of the intermolecular interaction principle.

[0027] Figure 4 for Tm Figure 1 shows the docking analysis of PGRP2 truncated protein with MTP molecules; where A is the overall structure of the protein molecule; B is a detailed view of the local area within the red box in A; and C is a simplified diagram of the principle of intermolecular interactions.

[0028] Figure 5 for Tm Diagram showing the molecular docking analysis of the natural full-length PGRP2 protein with the Gram-negative bacterial peptidoglycan derivative tracheocytotoxin (TCT); where A represents the overall structure of the protein molecule; B represents a detailed view of the area within the red box in A; and C represents a simplified diagram of the intermolecular interaction principle.

[0029] Figure 6 for Tm Figure 1 shows the docking analysis of PGRP2 truncated protein with TCT molecules; where A is the overall structure of the protein molecule; B is a detailed view of the local area within the red box in A; and C is a simplified diagram of the principle of intermolecular interactions.

[0030] Figure 7 For natural full length Tm PGRP2 protein and truncation Tm PGRP2 protein yield comparison chart;

[0031] Figure 8 As described in the embodiments of the present invention TmA diagram showing the binding affinity of PGRP2 truncated protein to peptidoglycan (PGN) and lipopolysaccharide (LPS);

[0032] Figure 9 As described in the embodiments of the present invention Tm Diagram showing the antibacterial activity of natural PGRP2 protein and its truncated protein; where A. Bacillus subtilis; B. Staphylococcus aureus; C. Aeromonas hydrophila; D. Escherichia coli;

[0033] Figure 10 As described in the embodiments of the present invention Tm A graph showing the bacterial agglutination ability of PGRP2 truncated protein. Detailed Implementation

[0034] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments. This description is only used to more clearly illustrate some aspects, characteristics and implementation schemes of the present invention, and should not be construed as a limitation of the present invention.

[0035] This invention relates to a method for preparing a truncated form of the peptidoglycan recognition protein of the greenfin pufferfish and its application. Firstly, a natural [substance / organism] is cloned... Tm The PGRP2 gene was analyzed using bioinformatics based on the NCBI database to determine its domain composition. Based on this analysis, a truncated protein retaining the core functional domains was designed and constructed. Further molecular docking methods were used to predict... Tm The binding of the full-length and truncated PGRP2 proteins to Lys- and Dap-type peptidoglycans was investigated. Subsequently, prokaryotic expression codons were optimized for the truncated protein sequence, and the entire gene was synthesized. The protein was ligated into the pET-28a(+) vector using double enzyme digestion, and the recombinant plasmid was constructed and transformed into an *E. coli* expression system. Highly efficient expression strains were screened. After induction of expression, the bacterial cells were disrupted, and the protein was purified to obtain the truncated peptidoglycan recognition protein.

[0036] The specific steps of the above method are as follows:

[0037] I. Truncated fish peptidoglycans recognize proteins ( Tm Preparation of PGRP2 truncated protein

[0038] 1. Based on the CDS sequence (EVM0002810) of the PGRP2 gene predicted from our laboratory-built third-generation full-length transcriptome sequencing database for the greenfin pufferfish, specific primers (F: ATGGCTCTATTTGGAGCACT, SEQ ID NO.3; R: TTAATCCCTAAAGTGTTCCC, SEQ ID NO.4) were designed for amplification of the target gene. Liver tissue from greenfin pufferfish was collected, and total RNA was extracted using TRIzol reagent (Invitrogen, USA). After treatment with DNase I (TaKaRa), the concentration and purity were determined by NanoDrop. Using the total RNA as a template, cDNA was synthesized via reverse transcription using the PrimeScript™ RT kit (TaKaRa) in a two-step process. Using the cDNA as a template, the target gene CDS was amplified using Taq DNA polymerase (Novozymes, China). The PCR reaction procedure was as follows: 94°C pre-denaturation for 5 min; 95°C for 10 s, 55°C for 30 s, 68°C for 1 min / kb, 30 cycles; 68°C extension for 5 min. The PCR products were separated by 1% agarose gel electrophoresis and purified using a gel extraction kit (China, Sangon Biotech). The purified product was mixed with pEASY-T1 vector (China, TransGold) at a 7:1 molar ratio and ligated at 25°C for 15 min. The ligation product was transformed into Trans1-T1 competent cells (China, TransGold), plated on LB agar plates containing Amp (50 μg / mL), X-Gal (20 mg / mL), and IPTG (500 mM), and incubated at 37°C for 16 h. White colonies were picked, and positive clones were verified by colony PCR (M13 primers) and sequencing. The CDS sequence of the PGRP2 gene of *Pteranodon spp.* was successfully obtained.

[0039] 2. Use NCBI CDD (Conserved Domain Database) for... Tm Predictive analysis of the PGRP2 domain shows that its core domain is located at 315aa-460aa at the C-terminus. Figure 2 As shown. Based on this, Tm The full-length PGRP2 protein was truncated to retain a 300aa-483aa fragment, as shown in SEQ ID NO.1 of the sequence listing.

[0040] 3. Perform molecular docking prediction. Predict using the AlphaFold website. TmThe 3D structures of the full-length and truncated PGRP2 proteins were obtained and downloaded as PDB format files. The proteins were imported into AutoDock for receptor preprocessing, involving the removal of water molecules, the addition of hydrogen atoms, and designation as the receptor. The final result was a PDBQT format protein-receptor file. For ligands, the molecular structure files of representative Lys-type peptidoglycan fragments MTP and TCT fragments of Dap-type peptidoglycan were downloaded from the PubChem database and converted from SDF to PDB format using Chem3D. Similarly, the ligands were preprocessed in AutoDock, including the removal of water molecules, the addition of hydrogen atoms, and designation as ligands. The software automatically generated and configured a torsion tree, exporting the ligand file as a PDBQT format file. During the docking parameter setting stage, the PDBQT files of the receptor and ligands were imported into AutoDock. The molecular docking grid box range was set, and the center coordinates and grid box size were adjusted with the target protein as the grid center to ensure that the entire receptor protein was completely covered by the docking box. Molecular docking calculations were then performed in AutoDock Vina, and the lowest binding energy conformation was selected based on the binding energy. After docking, the complex PDBQT file was converted to PDB format using PyMol 2.5, and the complex structure and interaction visualization analysis were further performed in PyMol 2.5 and Discovery Studio 2019. Figure 3-6 As shown, the molecular docking results indicate that... Tm The binding energies of the full-length and truncated PGRP2 proteins to MTP molecules are -7.2 kcal / mol and -7.9 kcal / mol, respectively; and to TCT molecules are -9.1 kcal / mol and -9.3 kcal / mol, respectively. Therefore, compared with the full-length protein, the truncated protein has a lower binding energy and stronger binding affinity to the PGN fragment.

[0041] 4. Codon optimization was performed on the truncated sequence for prokaryotic expression, and the truncated gene was synthesized as shown in SEQ ID NO.2 of the sequence listing. Specific primers containing BamHI and XhoI restriction sites were designed for the target gene (F: CGCGGATCCATGGAAGATGGTTTGCGTGA, SEQ ID NO.5; R: CCGCCTCGAGGTCACGGAAGTGTTCCCA, SEQ ID NO.6). PCR amplification was performed using high-fidelity DNA polymerase (Novizan, China). The amplified products were identified by agarose gel electrophoresis and then purified by gel extraction. 1 µg of the purified insert was reacted with 1 µL of BamHI / XhoI enzyme mixture (Takara, Japan) at 37°C for 2 h; simultaneously, the pET-28a(+) vector (Yisheng, China) was double-digested under the same conditions. After the enzyme digestion product was purified again, the insert fragment and the vector were mixed at a molar ratio of 7:1, 2 µL of ligation buffer and 0.5 µL of T4 DNA ligase (Beyotime, China) were added, and the volume was brought up to 20 µL with ddH2O. The mixture was incubated in a metal bath at 25°C for 2 h to complete the directional ligation and construct the recombinant expression plasmid.

[0042] 5. Recombinant plasmids were transformed using the calcium chloride method, and positive transformants were screened. 5 μL of the ligation product was added to 100 μL of competent DH5α cells and incubated on ice for 30 min. Afterward, the cells were heat-shocked in a 42°C water bath for 50 s, and then immediately returned to ice for 1 min. 500 μL of LB liquid medium (antibiotic-free) was added, and the cells were incubated on an air-bath shaker at 37°C and 220 rpm for 1 h. The shaken culture was then spread onto a plate containing 50 μg / mL kanamycin, using a spreader until the culture was completely absorbed. The plate was then incubated upside down at 37°C overnight. The next day, single colonies were picked, and colony PCR was performed using universal primers (T7 primers). Single colonies were picked with sterile toothpicks as templates, and the PCR products were detected by agarose gel electrophoresis. Positive clones detected by PCR were further sent for sequencing.

[0043] 6. Recombinant plasmids were extracted using a plasmid extraction kit (Tiangen, China). The extracted plasmids were introduced into BL21 (DE3) competent cells using the calcium chloride method. The transformation product was plated on LB solid medium containing kanamycin (50 μg / mL) and incubated upside down at 37°C for 16 h. Single colonies were picked and inoculated into LB medium supplemented with kanamycin (50 μg / mL). The cells were incubated at 220 rpm at 37°C until the OD600 reached approximately 0.6. IPTG (Beyotime, China) was added to the culture to a final concentration of 0.2 mM, and the culture was incubated overnight with shaking at 15°C and 200 rpm for protein expression induction. After induction, the cells were collected by centrifugation at 12,000 rpm for 10 min, washed with PBS buffer, and resuspended. The resuspension was sonicated in an ice-water bath (200 W, 5 s on, 5 s off, 10 cycles). The supernatant and precipitate were separated by centrifugation at 12,000 rpm for 30 min. 20 μL of the supernatant and an equal volume of the precipitate dissolution solution were added to 5 μL of 5× loading buffer (Chinese, White Shark), mixed thoroughly, and denatured in a boiling water bath for 10 min before 10% SDS-PAGE electrophoresis. After electrophoresis, the sample was stained with Coomassie Brilliant Blue R-250 for 1 hour, destaining until the background was clear, and the target protein bands were observed. Figure 1 As shown.

[0044] 7. Purification of the target protein using Ni column affinity chromatography. First, the bacterial cell precipitate was resuspended in lysis buffer (20 mM Tris-HCl, 1 mM PMSF, 1 mM bacterial protease inhibitor mixture, pH 8.0) and sonicated under ice bath conditions (400 W, 4 s on, 8 s off, 20 min total). The precipitate was then collected by centrifugation at 10,000 rpm for 20 min. The precipitate was washed three times with inclusion body washing buffer (20 mM Tris, 1 mM EDTA, 2 M urea, 1 M NaCl, 1% Triton X-100, pH 8.0) to obtain inclusion bodies. The inclusion bodies were dissolved in dissolution buffer (20 mM Tris, 5 mM DTT, 0.15 M NaCl, 8 M urea, pH 8.0) and sonicated (parameters as above, 15 min total). After centrifugation, the supernatant was collected for Ni column affinity chromatography. The supernatant was loaded onto a pre-equilibrated Ni-IDA-Sepharose Cl-6B column at a flow rate of 0.5 mL / min. The column was washed sequentially with wash buffer (20 mM imidazole) and eluted with elution buffer (250 mM imidazole). The eluent was then transferred to a dialysis bag and dialyzed at 4°C using a gradient refolding buffer (20 mM Tris-HCl, 150 mM NaCl, 10% glycerol, 1 mM EDTA, 0.5 M L-arginine, 6 / 4 / 2 / 1 / 0 M urea, 1 mM GSH, 0.2–0.5 mM GSSG, pH 8.0) to obtain the active protein. The purified protein concentration was determined using the Bradford method (Solepro, China). Tm The purification yield of PGRP2 truncated proteins was significantly higher than that of full-length proteins, such as... Figure 7 As shown.

[0045] 8. Comparison using ELISA method TmThe binding characteristics of full-length and truncated PGRP2 proteins to peptidoglycan (PGN) and lipopolysaccharide (LPS) were investigated. PGN supernatant and LPS, after sonication lysis, were dissolved in PBS to prepare 0.1 μg / μL coating buffers. These buffers were added to 96-well plates and incubated overnight at 4°C, with PBS-coated wells serving as negative controls. The coating buffer was discarded the following day, and the plates were washed three times with PBS. 200 μL of 5% BSA was added to each well, and the plates were blocked overnight at 4°C. After blocking, the plates were washed again, and 100 μL of purified protein (0.5 mg / mL) was added to each well. The plates were incubated overnight at 4°C. A ZnCl2 control group was also included, with 2 μL of 10 mM ZnCl2 added to the loading system. Subsequently, 100 μL of mouse anti-His primary antibody was added and incubated at 37°C for 1 h, followed by 100 μL of HRP-labeled goat anti-mouse secondary antibody and incubated at 37°C for 1 h. Each step involved thorough washing. Finally, add 100 μL of TMB substrate, incubate at 37°C in the dark for 10 min, terminate the reaction with 1 M H₂SO₄, and read the OD450 value within 15 min. Results are as follows: Figure 8 As shown, Tm The truncated PGRP2 protein exhibits a stronger affinity for PGN compared to the full-length protein, Zn 2+ This can enhance the effect. In comparison, the binding ability of the two proteins to LPS did not change significantly.

[0046] II. Prokaryotic Expression Tm Antibacterial effects of full-length and truncated PGRP2 proteins against different bacteria

[0047] 1. The Oxford cup perforation method was used to compare antibacterial activity. Bacillus subtilis (Bacillus subtilis) grown to the logarithmic growth phase was... B. subtilis Staphylococcus aureus S. aureus ), Escherichia coli ( E. coli Aeromonas hydrophila ( A.hydrophila Take 0.1 mL of bacterial suspension and add it to an appropriate amount of solid culture medium. Mix well and pour into plates. After the culture medium solidifies, use a sterile Oxford cup to punch a well in each plate. Add 100 μL of the following treatment sample (0.5 mg / mL) to each well. Tm PGRP2 full-length protein, 100 μL concentration is 0.5 mg / mL Tm PGRP2 protein was truncated, and a ZnCl2 control group was set up, i.e., 2 μL of 10 mM ZnCl2 was added to the sample loading system; a control group containing ZnCl2 was also set up. 2+ The final concentration of Zn in the treatment groups was consistent 2+ The solution was prepared, with kanamycin and PBS used as positive and negative controls, respectively. After incubation at 32°C for 12 h, the diameter of the inhibition zone was measured and compared. Results are as follows... Figure 9As shown, the truncated protein exhibits significantly stronger antibacterial activity against Gram-positive bacteria than the full-length protein, while its antibacterial activity against Gram-negative bacteria is not significantly different from that of the full-length protein.

[0048] 2. Study on Fluorescent Isothiocyanate (FITC) Labeling Method Tm Bacterial agglutination activity of full-length and truncated recombinant PGRP2 proteins. First, overnight cultured Bacillus subtilis (… B. subtilis Staphylococcus aureus S. aureus ), Escherichia coli ( E. coli Aeromonas hydrophila ( A.hydrophila Bacterial cells were collected by centrifugation at 4000 rpm for 5 min, washed three times with sterile PBS, and 50 μL of 1 mg / mL FITC (Maclean, China) was added, followed by TBS to a final volume of 1 mL. Labeling was performed at room temperature with shaking for 1 h in the dark. After labeling, the cells were washed 3-6 times with TBS until the eluent was colorless, resuspended in 1 mL of TBS, and the concentration adjusted to 1 x 10⁻⁶. 6 CFU / mL was prepared for later use. 150 μL of labeled bacterial culture was co-incubated with 20 μg of protein for 1 h (TBS was used as a negative control), and 10 mM Zn was prepared simultaneously. 2+ The treatment group evaluated Zn 2+ The effects of this were investigated, and the aggregation phenomenon was observed and photographed under a fluorescence microscope. The results are as follows: Figure 10 As shown, in Zn 2+ In the presence of the protein, the truncated protein exhibits significantly enhanced agglutination activity against both Gram-positive and Gram-negative bacteria compared to the full-length protein.

[0049] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A truncated fish peptidoglycan recognition protein, characterized in that: Its amino acid sequence is shown in SEQ ID NO.1 of the sequence listing.

2. A DNA molecule, characterized in that: The DNA molecule includes a nucleotide sequence or its complementary sequence encoding the truncated fish peptidoglycan recognition protein of claim 1.

3. The DNA molecule according to claim 2, characterized in that: The nucleotide sequence is shown in the sequence listing SEQ ID NO.

2.

4. A plasmid, characterized in that: It comprises the DNA molecule as described in claim 2 or 3.

5. A recombinant bacterial strain, characterized in that: It includes the plasmid as described in claim 4.

6. The application of the truncated fish peptidoglycan recognition protein according to claim 1, characterized in that: This protein is used in combination with zinc ions to prepare products that combat bacterial infections; the bacteria are Staphylococcus aureus or Bacillus subtilis.

7. A product for treating bacterial infections, characterized in that: This product contains the truncated fish peptidoglycan recognition protein as described in claim 1.

8. The antibacterial infection product according to claim 7, characterized in that: This product also contains zinc ions.

Citation Information

Patent Citations

  • Type two peptidoglycan recognition protein and preparation method and application thereof

    CN103131686A

  • Fish-derived peptidoglycan recognition protein mutant, preparation method and application thereof

    CN116178521A