Use of the PavKLUH gene and its transcription factor PavRAV2 in regulating the fruit size of sweet cherries

Abstract

The present invention discloses the use of the PavKLUH gene and its transcription factor PavRAV2 in regulating the fruit size of sweet cherries. Through experiments such as overexpressing PavKLUH ectopically in Arabidopsis thaliana and transiently silencing the expression of the PavKLUH gene in sweet cherry fruits, it is found that overexpressing or overexpressing the PavKLUH gene in sweet cherries can make the cherry fruits larger. The present invention further uses yeast one-hybrid screening library to obtain the binding protein PavRAV2 upstream of the PavKLUH promoter, and then uses EMSA and dual luciferase experiments to confirm that PavRAV2 can directly bind to the PavKLUH promoter and inhibit the expression of the PavKLUH gene. Combining with the experiment of transiently silencing the PavRAV2 gene in sweet cherry fruits, it is determined that PavRAV2 negatively regulates the expression of the PavKLUH gene, and inhibiting or silencing the PavRAV2 gene in sweet cherries can make the sweet cherry fruits significantly larger.

Description

Technical Field

[0001] The present invention relates to the new uses of the PavKLUH gene and its transcription factor PavRAV2, in particular to the uses of the PavKLUH gene and its transcription factor PavRAV2 in regulating the fruit size of sweet cherries, belonging to the field of new uses of the PavKLUH gene and its transcription factor PavRAV2. Background Art

[0002] European sweet cherry (Prunus avium L.), also known as sweet cherry, is a plant of the Rosaceae family and Prunus genus. It is native to Europe and western Asia and is the earliest fresh fruit on the market in spring in the north, deeply loved by consumers. At present, the cultivation area and output of Chinese sweet cherries have reached the first in the world. Due to the great difference between the climate in the suitable planting areas of Chinese sweet cherries and their original habitats, the fruit size is small and the yield is low. Especially in the early-maturing production areas in the midwestern warm temperate regions such as Henan, Anhui, Shanxi, and Shaanxi, the fruit size is even smaller. Fruit size has a great impact on the economic benefits of cherries and has become an important breeding goal in cherry breeding research. At present, most of the domestic and foreign research on fruit size stays at constructing the linkage map of the population and conducting QTL mapping analysis of fruit size, while there is little research on excavating genes related to fruit size and the molecular mechanism of regulating fruit size. So far, the key genes regulating the fruit size of sweet cherries have not been discovered. Therefore, it is necessary to use various biological means to discover the key genes of sweet cherry fruit size, and identify the gene functions and analyze their genetic and molecular mechanisms.

[0003] Cytochrome P450 (CYP) CYP78A subfamily is a highly conserved family of genes in plants. So far, multiple CYP78A family members have been identified to be closely related to grain / fruit size. For example, AtCYP78A5 / KLUH, AtCYP78A7, and AtCYP78A10 in Arabidopsis thaliana control grain size by affecting the proliferation of seed epidermal cells; AtCYP78A6, AtCYP78A8, and AtCYP78A9 control grain size by regulating the size of integument cells. However, the functional identification of CYP78A subfamily members in fruit trees has not been reported, and whether its family members also affect the development of plant organs and participate in the research on the molecular mechanism of regulating fruit size has not been reported. Moreover, it is not clear which upstream transcription factors regulate the expression level of CYP78A subfamily members, and further affect the molecular mechanism of sweet cherry fruit traits.

[0004] Therefore, mining CYP78A family genes related to the fruit size of sweet cherry, identifying the molecular functions of the genes, and analyzing their genetic and molecular mechanisms can further enrich the functional annotation of CYP78A, provide a theoretical reference for analyzing the molecular mechanism of regulating the fruit size of stone fruit trees such as cherry, provide some theoretical basis for fruit tree gene improvement, and have important practical significance for improving the current production status of small fruit size in the sweet cherry industry. Summary of the Invention

[0005] One object of the present invention is to provide the use of PavKLUH gene in regulating the fruit size of sweet cherry;

[0006] Another object of the present invention is to provide the use of the transcription factor PavRAV2 of PavKLUH gene in regulating the fruit size of sweet cherry;

[0007] The third object of the present invention is to provide a method for promoting the enlargement of sweet cherry fruits.

[0008] The above objects of the present invention are achieved by the following technical solutions:

[0009] The present invention discovers that overexpressing the PavKLUH gene ectopically in Arabidopsis thaliana can make the fruits larger, and further transiently silencing the PavKLUH gene in sweet cherry can result in smaller sweet cherry fruits. Thus, the present invention determines that the PavKLUH gene has the use of regulating the fruit size of sweet cherry, including: overexpressing or overexpressing the PavKLUH gene in sweet cherry to make the sweet cherry fruits larger.

[0010] As a reference implementation scheme for the PavKLUH gene to regulate the fruit size of sweet cherry, it includes: operably connecting the PavKLUH gene with an expression regulatory element containing a promoter to construct a recombinant plant expression vector, transforming this recombinant plant expression vector into sweet cherry to overexpress or overexpress the PavKLUH gene in sweet cherry, and the obtained transgenic sweet cherry fruits become larger.

[0011] The recombinant plant expression vector described in the present invention can be composed of a 5′-terminal non-coding region, the polynucleotide sequence of the PavKLUH gene, and a 3′ non-coding region. Among them, the 5′-terminal non-coding region can include a promoter sequence, an enhancer sequence, or / and a translation enhancement sequence; the promoter can be a constitutive promoter, an inducible promoter, a tissue or organ-specific promoter; the 3′ non-coding region can contain a terminator sequence, an mRNA cleavage sequence, etc. A suitable terminator sequence can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination regions.

[0012] The recombinant plant expression vector described in the present invention may also contain a selectable marker gene for selecting transformed cells. The selectable marker gene is used to select the transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds, etc. In addition, the marker genes also include phenotypic markers, such as β-galactosidase and fluorescent proteins, etc.

[0013] The recombinant plant expression vector containing the polynucleotide sequence shown by the PavKLUH gene and the host cell containing the recombinant plant expression vector also belong to the protection scope of the present invention.

[0014] Those skilled in the art can use any plant transformation method to transform the recombinant plant expression vector constructed in the present invention into the cells and tissues of sweet cherry to obtain transformants; and then regenerate the complete sweet cherry plants and their clones or their offspring from the transformants through plant tissue culture methods; as a reference implementation scheme, the transformation methods include: Agrobacterium-mediated transformation, protoplast transformation, Ti plasmid, Ri plasmid, plant virus vector, microinjection, electroporation method, particle bombardment, etc.

[0015] The nucleotide sequence of the PavKLUH gene described in the present invention is as follows:

[0016]

[0017]

[0018] In addition, those skilled in the art can also perform deletion, substitution or insertion of one or more bases on the basis of the above nucleotides according to the conventional mutation techniques in the art to obtain multiple nucleotide variants, and the nucleotide variants still have the function of regulating the fruit size of sweet cherry.

[0019] The promoter described in the present invention can be any promoter capable of initiating the expression of foreign genes in plants, including constitutive promoters, tissue-specific promoters and inducible promoters; preferably, the promoter has the following nucleotide sequence:

[0020]

[0021] As another exemplary embodiment of the PavKLUH gene in regulating fruit size, methods such as gene knockout or gene editing techniques are employed to silence or knockout the PavKLUH gene in sweet cherries, resulting in smaller sweet cherry fruits.

[0022] The present invention further provides a target gene sequence of the PavKLUH gene, and its nucleotide sequence is as follows:

[0023] GTCCTTCTGGCCTTCCTGTTCTTGGGTTGGTCTTGGCCTTCACTGGCTCTCTGACTCACAGAGTTCTAGCTAAGCTTGCTGAGACCTCAAAGGCCAAACCTTTAATGGCATTCTCTGTTGGGTTTACTCGTTTTGTCATCTCCAGCCACCCTGATACAGCTAAAGAGCTCTTGAATAGCTCTGCCTTCGCTGACCGACCCATTAAAGAGTCGGCTTATGAGCTTTTGTTCCATAAAGCAATGGGTTTTGCCCCTTTTGGCGAGTATTGGAGGAACTTGAGGAGAATCTCGGCCACCCATTTGTTCAGCCCGAAAAGAATCGCTAGTTTCGGGTTGTTTCGGGAAACTATCGGGCACAAAATGGTGGAGGAGATGAAGGCC (SEQ ID No.3).

[0024] Transforming a gene editing vector or a targeting vector constructed using this target gene sequence into a plant can effectively silence the expression of the PavKLUH gene in sweet cherries.

[0025] The present invention further utilizes yeast one-hybrid screening library to obtain the binding protein PavRAV2 upstream of the PavKLUH promoter. Then, EMSA and dual-luciferase experiments are used to confirm that PavRAV2 can directly bind to the PavKLUH promoter and inhibit the expression of the PavKLUH gene. Further, transient silencing of the PavRAV2 gene in sweet cherry fruits implies that PavRAV2 negatively regulates the PavKLUH gene and also has the function of regulating the size of sweet cherry fruits.

[0026] Thus, the second aspect of the present invention is to determine the use of the PavRAV2 gene in regulating the size of sweet cherry fruits, including: silencing or knocking out the PavRAV2 gene in sweet cherries to make the sweet cherry fruits larger, or overexpressing or overexpressing the PavRAV2 gene in sweet cherries to make the sweet cherry fruits smaller.

[0027] The third aspect of the present invention is to provide a method for promoting the enlargement of sweet cherry fruits, including: overexpressing or over-expressing the PavKLUH gene in sweet cherries; or silencing or knocking out the PavRAV2 gene in sweet cherries. By adopting these technical means, the fruits of sweet cherries can be enlarged.

[0028] Those skilled in the art can use conventional methods such as conventional gene knockout or gene editing techniques to mutate or knockout the PavRAV2 gene in sweet cherries to achieve the purpose of silencing the PavRAV2 gene. For example, constructing a PavRAV2 gene knockout vector or using gene editing techniques to construct a CRISPR / Cas9 gene editing vector, etc. These methods are all proficiently mastered by those skilled in the art.

[0029] The nucleotide sequence of the PavRAV2 gene described in the present invention is as follows:

[0030] Note: The information within the box is the target sequence information.

[0031] Term Definitions Related to the Present Invention

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

[0033] The term "recombinant plant expression vector": one or more DNA vectors for realizing plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors together with vectors having helper plasmids are mostly commonly used for Agrobacterium-mediated transformation. Binary vectors usually include: cis-acting sequences required for T-DNA transfer, engineered to be able to express a selectable marker or a heterologous gene to be transcribed in plant cells, etc.

[0034] The term "recombinant host cell" means a cell containing the polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide can remain as a non-integrating vector such as a plasmid or can be integrated into the host genome.

[0035] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides in single-stranded or double-stranded form and their polymers. Unless specifically restricted, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically restricted, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphoroamidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as the explicitly specified sequence. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Cassol et al., (1992); Rossolini et al., Mol Cell. Probes 8:91-98 (1994)).

[0036] The term "promoter" refers to a recognition site that exists upstream of the coding sequence of a gene of interest, provides a recognition site for RNA polymerase and other factors necessary for correct transcriptional initiation, and initiates or directs the transcription of the gene of interest into mRNA.

[0037] The term "selectable marker gene": The expression of this gene in a plant cell gives the cell a selection advantage. The selection advantage possessed by these cells transformed with these selectable marker genes can be due to their ability to grow in the presence of a negative selection agent (such as an antibiotic or herbicide) compared to the growth of non-transformed cells. The selectable marker gene also refers to a combination of multiple genes, whose expression in a plant cell gives the cell both negative and positive selection advantages.

[0038] The term "operably linked" refers to a functional linkage between two or more elements, and the elements that are operably linked can be adjacent or non-adjacent.

[0039] The term "transformation": A method of introducing a heterologous DNA sequence into a host cell or organism. The term "expression": The transcription and / or translation of an endogenous gene or a transgene in a plant cell. The term "coding sequence": A nucleic acid sequence that is transcribed into RNA. Description of the Drawings

[0040] Figure 1 Phylogenetic tree and gene expression pattern analysis of the PavKLUH gene in sweet cherry.

[0041] Figure 2 Effect of Ectopic Overexpression of PavKLUH Gene on Silique and Seed Size in Arabidopsis

[0042] Figure 3 Effect of Transient Silencing of PavKLUH Gene in Sweet Cherry Fruit on Fruit Size

[0043] Figure 4 Obtaining the Binding Protein PavRAV2 of PavKLUH Promoter by Yeast One-Hybrid Screening Library

[0044] Figure 5 Verifying that PavRAV2 Protein Directly Binds to PavKLUH Promoter by Yeast One-Hybrid and EMSA

[0045] Figure 6 Determining that PavRAV2 Inhibits the Expression of PavKLUH Gene by Dual-Luciferase Assay

[0046] Figure 7 Effect of Transient Silencing of PavRAV2 Gene in Sweet Cherry Fruit on Fruit Size Detailed Implementation Manner

[0047] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and forms of the present invention can be made without departing from the spirit and scope of the present invention, but such modifications and substitutions all fall within the protection scope of the present invention.

[0048] Experimental Example 1 Experiments on the Effect of PavKLUH Gene and PavRAV2 Gene on Sweet Cherry Fruit Size and the Effect of PavRAV2 on PavKLUH Gene Expression

[0049] 1 Experimental Method

[0050] 1.1 Experimental Materials

[0051] Plant Materials: The European sweet cherry cultivars 'Brooks' and 'Longguan' are from the cherry germplasm resource garden of Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences. The rootstock is 'ZY-1', with a tree age of 9 years and normal tree growth.

[0052] Arabidopsis and tobacco are cultured in a growth chamber.

[0053] 1.2 Phylogenetic Tree Analysis of PavKLUH Gene

[0054] The amino acid sequence homology alignment analysis of the PavKLUH gene in sweet cherry and the reported KLUH genes in other species (Arabidopsis thaliana, Oryza sativa, Triticum aestivum, Solanum lycopersicum, Vitis vinifera, Malus domestica, Fragaria × ananassa, Prunus persica, etc.) was carried out using MEGA 6.0 software, and its phylogenetic tree was constructed.

[0055] 1.3 Analysis of the expression pattern of the PavKLUH gene

[0056] Fruits of 'Brooks' at different developmental stages were collected, and the total RNA digested by DNase I was extracted using the RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing, China), and then reverse transcribed into cDNA. Specific primer pairs PavKLUH-q-F / R were designed (Table 1).

[0057] Table 1 Amplification primers used in this experiment

[0058]

[0059]

[0060] Three independent fluorescence quantitative PCRs were carried out to analyze the expression pattern of the PavKLUH gene in sweet cherry. The qPCR reaction was carried out on an ABI7500 PCR thermal cycler (Applied Biosystems, Foster City, CA, United States), and the reaction was carried out using the TransStart Top Green qPCR SuperMix kit (TransGen Biotech Co., Ltd., Beijing, China). The actin (Pav_sc0002247.1_g030.1.mk) of sweet cherry was used as an internal reference for analysis. Three biological replicates were performed and the average value was taken. The 2 -ΔΔct method was used to calculate the relative expression level of the gene.

[0061] 1.4 Construction of the overexpression vector of the PavKLUH gene and genetic transformation of Arabidopsis thaliana

[0062] Using the cDNA of sweet cherry fruits as a template, specific primers PavKLUH-F\R for the coding region sequence of the PavKLUH gene were designed (Table 1) for PCR amplification. The full-length fragments of the PavKLUH gene were obtained respectively. The PavKLUH gene was constructed into the plant expression vector pBI121 by homologous recombination method to obtain the recombinant vector pBI121-PavKLUH. It was electrotransformed into Agrobacterium tumefaciens, and Arabidopsis thaliana was transformed by the Agrobacterium-mediated method. Multiple positive transgenic lines of Arabidopsis thaliana overexpressing the PavKLUH gene were obtained. After subculturing for 2 generations, homozygous transgenic lines were obtained. Three lines with the highest expression levels (PavKLUH-2, PavKLUH-8, and PavKLUH-13) were selected for further phenotypic studies. Figure 7 )

[0063] 1.5 Construction of VIGS-PavKLUH recombinant vector, VIGS-PavRAV2 recombinant vector and transient transformation of sweet cherry fruits by VIGS technology

[0064] The length (300 bp - 500 bp) and sequence information of the target gene fragment are the key factors affecting the efficiency of gene silencing in Nicotiana benthamiana induced by TRV virus. Therefore, 3 target sequences were designed for the PavKLUH gene, namely PavKLUH-1, PavKLUH-2, and PavKLUH-3.

[0065] Among them, the nucleotide sequence of PavKLUH-1 is as follows:

[0066] GTCCTTCTGGCCTTCCTGTTCTTGGGTTGGTCTTGGCCTTCACTGGCTCTC

[0067] TGACTCACAGAGTTCTAGCTAAGCTTGCTGAGACCTCAAAGGCCAAACCTTTAA

[0068] TGGCATTCTCTGTTGGGTTTACTCGTTTTGTCATCTCCAGCCACCCTGATACAGC

[0069] TAAAGAGCTCTTGAATAGCTCTGCCTTCGCTGACCGACCCATTAAAGAGTCGGC

[0070] TTATGAGCTTTTGTTCCATAAAGCAATGGGTTTTGCCCCTTTTGGCGAGTATTGG

[0071] AGGAACTTGAGGAGAATCTCGGCCACCCATTTGTTCAGCCCGAAAAGAATCGCT

[0072] AGTTTCGGGTTGTTTCGGGAAACTATCGGGCACAAAATGGTGGAGGAGATGAA

[0073] GGCC (SEQ ID No.5).

[0074] The nucleotide sequence of PavKLUH-2 is as follows:

[0075]

[0076] The nucleotide sequence of PavKLUH-3 is as follows:

[0077]

[0078]

[0079] The full-length sequence of PavRAV2 is only 540 bp, and 1 target sequence, PavRAV2, was designed for PavRAV2 in this experiment.

[0080] The construction of pTRV2-PavKLUH and pTRV2-PavRAV2 vectors adopted the In-Fusion Cloning technology. Gene-specific primer pairs PavKLUH-RNAi-F1-3 / R1-3 and PavRAV2-RNAi-F / R (Table 1) with 16 overlapping regions (adapters that were reverse complementary to the pTRV2 fragment linearized by EcoRI and KpnI) were designed respectively for PavKLUH or PavRAV2. Using sweet cherry cDNA as a template, the target fragments of PavKLUH or PavRAV2 genes were amplified respectively, and the target fragments were constructed onto the pTRV2 construct linearized by double digestion with EcoRI and KpnI using the In-FusionTM HD Cloning kit (Clontech, CA, United States), named pTRV2-PavKLUH and pTRV2-PavRAV2 respectively, and then transferred into Escherichia coli DH5α competent cells. Positive strains were picked, and after being identified correctly by PCR, double digestion and sequencing, the pTRV2-PavKLUH and pTRV2-PavRAV2 vectors were transferred into Agrobacterium strain GV3101 for standby respectively. The VIGS method for sweet cherry fruits was carried out with reference to the method of Qi Xiliang et al. (Qi, X. L., Li, M., Liu, C. L., & Song, L. L. (2018). Establishment of a TRV-mediated VIGS system for European sweet cherry fruits. Acta Horticulturae Sinica, 35(11), 1309-1315.) and six biological replicates were performed.

[0081] 1.6 Semi-quantitative RT-PCR detection and analysis

[0082] Total RNA of sweet cherry fruit samples was extracted and reverse transcribed into cDNA. Using the actin (Pav_sc0002247.1_g030.1.mk) gene of sweet cherry as an internal reference, the cDNA content of different samples was adjusted, and then the expression levels of the PavKLUH or PavRAV2 genes after silencing were detected using the gene-specific primer pairs for PavKLUH or PavRAV2 (Table 1) respectively. Three biological replicates were performed and the average value was taken.

[0083] 1.7 Obtaining the binding protein PavRAV2 upstream of the PavKLUH gene promoter by yeast one-hybrid library screening

[0084] Yeast one-hybrid library screening was carried out with reference to the Matchmaker TM Gold Yeast One-Hybrid Library Screening System (Clontech, United States) kit.

[0085] First, a cDNA library of sweet cherry fruits was constructed. Total RNA was extracted from sweet cherry fruits using the EASY spin RNA Plant RNA Rapid Extraction Kit (Yuanpinghao Biotechnology, China). Then, mRNA was purified using Oligo(dT) magnetic beads. The mRNA was reverse transcribed into cDNA using a reverse transcription kit, and the dscDNA was amplified and purified. The purified dscDNA was inserted into the pGADT7 vector to form a recombinant plasmid, which was then transferred into Escherichia coli DH10B to obtain the cDNA library of sweet cherry fruits. Specific primers for the PavKLUH gene, PavKLUH-Pro-F / R (Table 1), were designed. Using sweet cherry DNA as a template, the promoter fragment of the PavKLUH gene was amplified and then cloned into the pAbAi vector by homologous recombination to construct the pAbAi-PavKLUH bait vector. The pAbAi-PavKLUH bait vector was linearized and transferred into the Y1HGold strain to prepare competent Y1HGold(pAbAi-PavKLUH). 10 μg of the cDNA library plasmid of sweet cherry fruits was taken, and the yeast one-hybrid library screening experiment was carried out according to the instructions of the Matchmaker Gold Yeast One-Hybrid Library Screening System. After the library plasmid was introduced into the Y1HGold(pAbAi-PavKLUH) yeast bait strain, the transformed resuspended bacterial solution was spread on an SD / -Leu medium containing 400 ng / mL AbA for screening. After obtaining positive colonies, the fragment sequence information was identified by sequencing to obtain candidate binding proteins.

[0086] 1.8 Construction and verification of the yeast one-hybrid vector: PavRAV2 directly binds to the promoter of the PavKLUH gene

[0087] Specific primers for the PavKLUH gene, PavKLUH-Pro-F / R (Table 1), were designed. Using sweet cherry DNA as a template, the promoter fragment of the PavKLUH gene was amplified and then cloned into the pAbAi vector by homologous recombination to generate the pAbAi-PavKLUH recombinant plasmid. The pAbAi-PavKLUH recombinant plasmid was linearized and transferred into the Y1HGold strain to prepare competent Y1HGold(pAbAi-PavKLUH). The full-length PavRAV2 gene was constructed onto the pGADT7 vector to form the pGADT7-PavRAV2 recombinant plasmid. The pGADT7-PavRAV2 recombinant plasmid was separately transformed into the competent cells of the Y1HGold strain containing pAbAi-PavKLUH and spread on an SD / -Leu medium containing an AbA inhibitory concentration of 400 ng / mL to observe the growth of yeast colonies. At least four biological replicates were performed for each culture combination.

[0088] 1.9 Gel retardation electrophoresis mobility shift assay (EMSA)

[0089] The EMSA experiment was carried out according to the instructions of the LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific, USA). The full-length sequence of the PavRAV2 gene was cloned into the pET32a vector with a His tag, and then introduced into Escherichia coli BL21 for amplification of the fusion protein. Then, the His-PavRAV2 fusion protein was recovered using the His protein purification system. The biotin-labeled PavKLUH gene promoter probe was synthesized by Shanghai Bioengineering Co., Ltd. Then, the His-PavRAV2 protein and the biotin-labeled PavKLUH promoter probe were mixed and subjected to electrophoresis analysis on an EMSA gel, and competitive probes, mutant probes, and negative controls were designed.

[0090] 1.10 Dual-luciferase reporter assay

[0091] Specific primers PavKLUH-Pro-F / R (Table 1) were designed to amplify the PavKLUH promoter sequence, which was inserted into the pGreenII 0800-LUC vector by homologous recombination to generate a reporter plasmid. Similarly, the PavRAV2 coding sequence was cloned into the pGreenII 62-SK vector by homologous recombination as an effector plasmid. Agrobacterium tumefaciens GV3101 containing the effector plasmid and the reporter plasmid was co-transformed into tobacco leaves. By transiently transforming the reporter vector and the effector vector in tobacco, after 2 days, the activities of LUC and REN were measured using a dual-luciferase reporter kit on a luminometer. The dual-luciferase reporter assay was performed with at least four biological replicates.

[0092] 1.11 Data processing

[0093] The obtained data were processed and plotted using Microsoft Excel 2010 software; correlation analysis and significance analysis of differences (P<0.05) were performed using SPSS17.0 software.

[0094] 2 Experimental results

[0095] 2.1 Phylogenetic tree and gene expression pattern analysis of sweet cherry PavKLUH.

[0096] To determine the evolutionary relationship between the PavKLUH gene of sweet cherry and the KLUH genes of other species, a phylogenetic tree of KLUH was constructed in this experiment. The results showed that PavKLUH could aggregate with the KLUH proteins of other species, showing a high similarity with peach, strawberry, and apple, with a similarity of over 75%. Among them, it had 96.55% homology with PmKLUH of Prunus mume and 96.92% homology with PpKLUH of peach. However, the functions of KLUH in these species with extremely high similarity have not been reported yet( Figure 1 A).

[0097] To analyze the expression pattern of the PavKLUH gene during the development and ripening of sweet cherry fruits, the gene expression in leaves, flowers, and different fruit development stages was analyzed by real-time fluorescence quantitative (qRT-PCR) in this experiment. The results showed that the PavKLUH gene was expressed throughout the flowering period and the fruit growth and development process, but there were significant expression differences. In the early stage of fruit growth and development (0 - 15 days after full bloom, DAFB), the expression of PavKLUH was low. Subsequently, after 21 DAFB, the expression of the PavKLUH gene increased sharply and then gradually decreased, remaining at a relatively high expression level in the late stage of fruit growth and development (35 - 50 DAFB). Figure 1 B), suggesting that the PavKLUH gene may play a key role in fruit growth and development.

[0098] 2.2 Effects of overexpressing the PavKLUH gene ectopically in Arabidopsis thaliana on the silique and seed size.

[0099] Using the positive transgenic T3 generation lines PavKLUH-OE-2, PavKLUH-OE-8, and PavKLUH-OE-13 generated by overexpressing the sweet cherry PavKLUH gene ectopically in Arabidopsis thaliana, phenotypic observation and statistical analysis were carried out on them and found that: compared with the wild-type Arabidopsis thaliana transformed with the empty vector, there were no obvious differences in the morphological characteristics and growth characteristics of Arabidopsis thaliana overexpressing the PavKLUH gene. However, the Arabidopsis thaliana lines overexpressing the PavKLUH gene produced larger siliques and seeds, and the sizes of both siliques and seeds were significantly higher than those of the siliques and seeds of the wild-type with the empty vector. Figure 2 ), indicating that the sweet cherry PavKLUH gene is a key gene regulating fruit size.

[0100] 2.3 Effects of transient silencing of the PavKLUH gene in sweet cherry fruits on fruit size.

[0101] Using the transformation system of sweet cherry fruits with virus-induced gene silencing established by the research group of the present inventors, the Agrobacterium tumefaciens strains GV3101 containing TRV::00 (blank control) and TRV::PavKLUH were respectively used to infect the sweet cherry cultivar 'Longguan'. After 15 days of infection, the mRNA of the fruits was extracted for expression level detection. The results showed that the expression level of PavKLUH in the sweet cherry fruits infected with TRV::PavKLUH containing the target gene fragment PavKLUH-1 was lower than that in the sweet cherry fruits infected with TRV::00( Figure 3 A), and the gene silencing efficiency reached more than 90%, indicating that the PavKLUH gene was effectively silenced respectively, while the silencing efficiency of TRV::PavKLUH containing the target gene fragments PavKLUH-2 and PavKLUH-3 was relatively low.

[0102] The results of measuring and statistically analyzing the weights, diameters, and pit weights of sweet cherry fruits at 5 days, 10 days, 15 days, and 25 days after infection with TRV::PavKLUH and TRV::00 showed that the fruit weights, transverse diameters, and longitudinal diameters of the sweet cherry fruits infected with TRV::PavKLUH were significantly lower than those of the fruits infected with TRV::00( Figure 3 B-D), while there was no significant difference in the pit weights of the sweet cherry fruits infected with TRV::PavKLUH and the pit weights of the fruits infected with TRV::00( Figure 3 E). It indicates that PavKLUH affects fruit size during the growth and development of sweet cherry fruits.

[0103] 2.4 Obtaining the binding protein PavRAV2 of the PavKLUH gene promoter by yeast one-hybrid screening library

[0104] To clarify which protein regulates the expression of the PavKLUH gene, a bait fusion vector of the PavKLUH gene promoter was constructed in this experiment and transferred into the Y1HGold strain to construct a bait strain. After correct detection and identification, the bait strain Y1HGold(pAbAi-PaKLUH) was made into competent cells. The plasmid of the yeast one-hybrid cDNA library of sweet cherry fruits constructed in this experiment was transferred into the competent cells of the bait strain Y1HGold(pAbAi-PaKLUH) and spread on the SD / -Ura / -Leu medium containing an AbA inhibition concentration of 400 ng / mL for screening. The positive yeast transformants obtained by screening were used to extract plasmids and sequence them, and the proteins encoded by the sequences they contained were analyzed. It was preliminarily determined that the regulatory protein PavRAV2 of the PavKLUH gene promoter (related to ABI3 / VP2, belonging to the AP2 / ERF class of transcription factors, Figure 4 ).

[0105] 2.5 Yeast one-hybrid and EMSA verification that PavRAV2 protein directly binds to the PavKLUH promoter

[0106] To verify whether the candidate transcription factor PavRAV2 obtained from yeast one-hybrid library screening is a false positive. In this experiment, the full-length PavRAV2 gene was constructed into the pGADT7 vector and transformed into the competent cells of the Y1HGold (pAbAi-PaKLUH) strain by yeast transformation. Then it was spread on the SD / -Leu medium containing an AbA inhibitory concentration of 400 ng / mL, and the growth of yeast colonies was observed. The results showed that after yeast transformation with the candidate protein PavRAV2, the yeast colonies grew normally on the SD / -Leu medium containing an AbA inhibitory concentration of 400 ng / mL, and after dilution by a certain multiple, the number of yeast colonies gradually decreased ( Figure 5 A), indicating that PavRAV2 binds to the promoter of the PavKLUH gene.

[0107] Then, in this experiment, the purified recombinant protein PavRAV2-HIS was used for electrophoretic mobility shift assay (EMSA) to further determine whether the PavRAV2 protein directly binds to the PavKLUH promoter in vitro. The EMSA results showed that the recombinant protein PavRAV2-HIS directly binds to the binding site of the ABRE cis-element AAGAA sequence of the PavKLUH promoter. Moreover, as the number of unlabeled biotin probes increased, the number of PavKLUH binding to the biotin-labeled probe decreased ( Figure 5 B). When the AAGAA sequence of the binding site of the PavKLUH promoter was mutated, no increase in the number of biotin-labeled mutant probes bound was observed ( Figure 5 B). The above results indicate that the PavRAV2 protein specifically binds to the promoter of the PavKLUH gene.

[0108] 2.6 Dual-luciferase assay to determine that PavRAV2 inhibits the expression of the PavKLUH gene

[0109] To determine how PavRAV2 regulates the expression of the PavKLUH gene, this experiment constructed a dual-luciferase reporter system, which included a reporter vector in which the expression of the Luc gene (firefly luciferase, as the reporter gene) was driven by the PavKLUH gene promoter and the expression of the REN gene (Renilla luciferase, as the internal reference gene) was driven by the CaMV35S promoter, and an effector vector for the expression of PavRAV2 driven by the CaMV35S promoter. After transient transformation of the reporter vector and the effector vector in tobacco, 2 days later, the activities of LUC and REN were measured using a dual-luciferase reporter kit in a luminometer. The results showed that compared with the empty vector control, the relative ratio of LUC / REN in tobacco transformed with the effector vector expressing the PavRAV2 gene was significantly decreased (Figure 6 ), indicating that PavRAV2 directly inhibits the expression of the PavKLUH gene. In summary, it is shown that PavRAV2 can directly bind to the PavKLUH promoter and negatively regulate the expression of the PavKLUH gene.

[0110] 2.7 Effect of transient silencing of the PavRAV2 gene in sweet cherry fruits on fruit size

[0111] To determine whether the PavRAV2 gene is involved in regulating the molecular function of sweet cherry fruit size, in this experiment, Agrobacterium tumefaciens suspensions containing TRV::00 (blank control) and TRV::PavRAV2 were used to infect the sweet cherry cultivar 'Brooks' through virus-induced gene silencing technology. Total mRNA was extracted from the infected fruits after 14 days for semi-quantitative PCR detection. The results showed that compared with the sweet cherry fruits infected with TRV::00, the expression level of the PavRAV2 gene in the sweet cherry fruits infected with TRV::PavRAV2 was significantly reduced ( Figure 7 A), and the gene silencing efficiency reached more than 85%, indicating that the PavRAV2 gene was effectively silenced.

[0112] After 21 days of infection, the phenotypes of the sweet cherry fruits with silenced PavRAV2 were observed, and it was found that the sweet cherry fruits with silenced PavRAV2 showed larger fruit size than the control fruits ( Figure 7 B). Then, the longitudinal and transverse diameters and single fruit weight of the fruits were measured. The results showed that the longitudinal diameter, transverse diameter and single fruit weight of the sweet cherry fruits with silenced PavRAV2 were significantly higher than those of the sweet cherry fruits infected with TRV::00 (control). However, there was no difference in the size of the stone of the sweet cherry fruits with silenced PavRAV2 compared with the control ( Figure 7 C-E). It is shown that silencing PavRAV2 significantly increased the sweet cherry fruit size, suggesting that PavRAV2 regulates sweet cherry fruit size.

Claims

1. Use of the PavKLUH gene in regulating the fruit size of sweet cherry; the nucleotide sequence of the PavKLUH gene is shown as SEQ ID No.

1.

2. The use according to claim 1, characterized in that, it includes: Overexpressing or overexpressing the PavKLUH gene in sweet cherry to make the sweet cherry fruit larger.

3. The use according to claim 2, characterized in that, it includes: Constructing a recombinant plant expression vector by operably connecting the PavKLUH gene with an expression regulatory element containing a promoter, and transforming the recombinant plant expression vector into sweet cherry to overexpress or overexpress the PavKLUH gene in sweet cherry.

4. The use according to claim 1, characterized in that, it includes: Knocking out the PavKLUH gene in sweet cherry to make the sweet cherry fruit smaller.

5. The use according to claim 4, characterized in that, it includes: Constructing a PavKLUH gene knockout vector with the target gene of the PavKLUH gene, and knocking out the PavKLUH gene in sweet cherry to make the sweet cherry fruit smaller.

6. Use of the transcription factor PavRAV2 of the PavKLUH gene in regulating the fruit size of sweet cherry, wherein, regulating the fruit size of sweet cherry is to silence the PavRAV2 gene in sweet cherry to make the sweet cherry fruit larger; the nucleotide sequence of the PavKLUH gene is shown as SEQ ID No.1; the nucleotide sequence of the coding gene of the transcription factor PavRAV2 is shown as SEQ ID No.

4.

7. A method for promoting the enlargement of sweet cherry fruit, including: Overexpressing or overexpressing the PavKLUH gene in sweet cherry; or silencing the transcription factor PavRAV2 that regulates the PavKLUH gene in sweet cherry; the nucleotide sequence of the PavKLUH gene is shown as SEQ ID No.1; the nucleotide sequence of the coding gene of the transcription factor PavRAV2 is shown as SEQ ID No.4.

Images