A method for detecting DNA adenine methyltransferase activity

By employing rolling circle amplification and RNA-cutting DNA mimicry technology, a dual-enzyme coupling of specific probes and enzymes was designed, solving the problems of complexity and accuracy in existing DNA methyltransferase activity detection and achieving detection results with high sensitivity and high specificity.

CN116179653BActive Publication Date: 2025-10-24JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211528001.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-30
Publication Date
2025-10-24
Estimated Expiration
2042-11-30

AI Technical Summary

Technical Problem

Existing methods for detecting DNA methyltransferase activity are complex to operate, costly, have low accuracy, and have high detection limits, which restrict their application in practice.

Method used

A method based on rolling circle amplification and RNA-cutting DNA mimicry was employed. By designing specific substrate hairpin probes and coupling them with restriction endonucleases, combined with DNA rolling circle amplification and RNA-cutting DNA mimicry technology, a fluorescent signal was generated to detect DNA adenine methyltransferase activity.

Benefits of technology

This method achieves highly sensitive and specific detection of DNA adenine methyltransferase activity, reducing operational complexity and cost while improving detection accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179653B_ABST
    Figure CN116179653B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of DNA adenine methyltransferase activity detection method, according to substrate hairpin in the double enzyme coupling of DNA adenine methyltransferase and restriction endonuclease obtains a truncated hairpin structure, and design contains RNA cleavage type DNA mimic enzyme complementary sequence's rolling circle probe, with truncated hairpin structure as primer, with rolling circle probe as template to carry out rolling circle amplification, the RNA cleavage type DNA mimic enzyme cleavage molecular beacon obtained, so that the fluorescent group and quencher group modified in the two ends of molecular beacon are far away, release fluorescence signal, realize the detection of DNA adenine methyltransferase activity, detection limit is as low as 3.09x10 ‑4 U / mL, provide a specific, high sensitivity method for DNA adenine methyltransferase activity analysis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to a DNA adenine methyltransferase activity detection method. BACKGROUND

[0002] DNA methylation is a biological process in which a methyl group is transferred from the donor S-adenosyl methionine and covalently bound to the C5 or N4 position of the cytosine of the CpG dinucleotide or the N6 position of the adenine of the 5'-G-A-T-C-3' tetranucleotide under the catalysis of DNA methyltransferase. DNA methylation can change genetic performance without changing the DNA sequence, and thus plays a crucial role in biological evolution. However, abnormal DNA methylation can lead to tumorigenesis. There are two types of abnormal DNA methylation in living organisms, namely hypermethylation and hypomethylation. DNA hypermethylation is associated with cancers such as small cell lung cancer, breast cancer and cervical cancer. At the same time, hypomethylation is associated with various cancers such as breast cancer, brain cancer and cervical cancer. Therefore, the activity of DNA methyltransferase has the potential to serve as a reference for medical disease diagnosis and prognosis. Conventional determination of DNA methyltransferase activity includes high performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay (ELISA), radiolabeling method and methylation-specific PCR. Although these methods have been widely used in laboratories for screening DNA methyltransferase activity, however, these methods require high degree of expertise for operators, are high in cost, low in accuracy, high in detection limit, and require pretreatment of samples, etc., which limits their further application in practice.

[0003] Fluorescent biosensors have attracted extensive attention due to their good selectivity, high stability, high specificity, high sensitivity and other advantages. Fluorescent biosensors include a molecular recognition part and a signal conversion part, the molecular recognition part recognizes the target, and then converts the biological signal into a fluorescent signal. At present, many biosensors based on fluorescent signals have been developed, such as enzyme-linked immunoassay, small molecule modification method and biological enzyme method, but there are still problems such as high detection limit and weak specificity.

[0004] DNA rolling circle amplification is a method of DNA isothermal amplification, using a DNA circular structure as a template and a single-stranded DNA as a primer to perform nucleic acid isothermal amplification reaction under the action of DNA polymerase. Compared with the PCR method, the reaction conditions of rolling circle amplification are more mild and the amplification efficiency is higher. DNA mimic enzyme is a sequence fragment composed of DNA with certain functions, such as catalytic mimic enzyme G-quadruplex and RNA cleavage type DNA mimic enzyme. Artificially synthesized DNA fragments are high in cost, and the complementary sequence of the DNA mimic enzyme is embedded into the template strand of the DNA rolling circle amplification, and the target fragment can be cyclically amplified through the rolling circle amplification reaction, which is an efficient method for producing DNA mimic enzyme. SUMMARY

[0005] To solve the above technical problems, the present application provides a method for detecting DNA adenine methyltransferase based on rolling circle amplification and RNA cleavage type DNA mimic enzyme technology, which has the advantages of high sensitivity, high specificity, accurate determination, etc.

[0006] The first object of the present application is to provide a method for detecting DNA adenine methyltransferase activity, comprising the following steps:

[0007] S1, denature and renature the substrate hairpin probe sequence to form a hairpin structure, incubate the hairpin structure with different activities of DNA adenine methyltransferase respectively, add a restriction endonuclease after incubation, and continue to incubate to obtain a mixture containing a cleavage product;

[0008] S2, using the cleavage product obtained in S1 as a primer and a rolling circle probe containing a complementary sequence of the RNA cleavage type DNA mimic enzyme as a template for rolling circle amplification to obtain a mixture containing an amplification product;

[0009] The amplification product is a sequence containing an RNA cleavage type DNA mimic enzyme;

[0010] S3, adding a molecular beacon to the mixture containing the amplification product for incubation to establish a relationship curve between the fluorescence signal and the activity of DNA adenine methyltransferase;

[0011] S4, operating the sample to be tested according to S1-S3, measuring the fluorescence intensity, and calculating the activity of DNA adenine methyltransferase according to the relationship curve of S3.

[0012] Further, the nucleotide sequence of the rolling circle probe is shown in SEQ ID NO. 1.

[0013] Further, the nucleotide sequence of the substrate hairpin probe is shown in SEQ ID NO. 2.

[0014] Further, the restriction endonuclease is restriction endonuclease Dpn I.

[0015] Further, the molecular beacon is modified with a fluorescent group and a quencher group at both ends.

[0016] Further, the cleavage product and the rolling circle probe are denatured and renatured to form a complementary structure, and are added to an amplification system for rolling circle amplification.

[0017] Further, the amplification system includes Phi 29 DNA polymerase, dNTP and Tris-HCl buffer.

[0018] Further, the composition of the Tris-HCl buffer is: 45-55 mM Tris, 95-105 mM NaCl, 15-25 mM MgCl2, 195-205 mM KCl.

[0019] Further, S-adenosyl methionine is included in the incubation system of step S1.

[0020] Further, the nucleotide sequence of the molecular beacon is shown in SEQ ID NO. 3, which is ACATG / rA / TGGTTA.

[0021] Further, the rolling circle probe is obtained by denaturation and renaturation of a template probe with a nucleotide sequence shown in SEQ ID NO. 1 and a ligation probe with a nucleotide sequence shown in SEQ ID NO. 4, addition of T4 DNA ligase, formation of a circular structure, and digestion of excess single-stranded DNA by EXO I and EXO III.

[0022] The construction of the detection system of the present application includes: design of the substrate hairpin, design of the DNA template probe, design of the molecular beacon, double-enzyme coupling of the DNA adenine methyltransferase and the restriction endonuclease, performance of the DNA rolling circle amplification, cleavage of the RNA cleavage type DNA mimic enzyme, and fluorescence intensity determination. The detection principle is as follows: the substrate hairpin probe (HP) forms a short hairpin structure (sHP) under the double-enzyme coupling of the DNA adenine methyltransferase and the restriction endonuclease. After mixing sHP and the DNA circular template, denaturation at high temperature and then annealing, addition of Phi 29 DNA polymerase and dNTP, and then performance of the DNA rolling circle amplification reaction, a single-stranded DNA containing the RNA cleavage type DNA mimic enzyme is obtained. After addition of the molecular beacon, the RNA cleavage type DNA mimic enzyme cleaves the molecular beacon, and a fluorescence signal is generated. Finally, a linear relationship between the fluorescence signal intensity and the activity of the DNA adenine methyltransferase is established, and the activity of the target in the sample is calculated by using the standard curve. When the DNA adenine methyltransferase does not exist in the system, the unmethylated HP cannot be cleaved by the restriction endonuclease Dpn I, the DNA rolling circle amplification cannot be performed due to the absence of primers, the molecular beacon cannot be cleaved, and no fluorescence signal is generated.

[0023] By the above-mentioned scheme, the present application has at least the following advantages:

[0024] The present application cuts the molecular beacon by using DNA rolling circle amplification reaction and RNA cleavage DNA mimic enzyme technology, generates a large amount of fluorescence signal. When DNA adenine methyltransferase is absent, the HP sequence cannot be cut, so that the DNA rolling circle amplification cannot be carried out without primers, and then the RNA cleavage DNA mimic enzyme cannot be generated, and the fluorescence signal cannot be generated. And only when the HP is methylated by the DNA adenine methyltransferase existing in the system, it will be cut by the restriction enzyme Dpn I, so that the subsequent reaction can be carried out. Compared with the traditional method for detecting DNA adenine methyltransferase, the toxicity is low, the specificity is strong, and the sensitivity is high.

[0025] The above description is only a summary of the technical scheme of the present application, in order to more clearly understand the technical means of the present application, and can be implemented according to the content of the description, the following is the preferred embodiment of the present application and the detailed description of the drawings as follows. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to make the content of the present application more easily understood, the following is a further detailed description of the present application according to the specific embodiments of the present application and in combination with the drawings.

[0027] Figure 1 The principle diagram of the present application based on rolling circle amplification and RNA cleavage DNA mimic enzyme for DNA adenine methyltransferase activity analysis method;

[0028] Figure 2 The fluorescence intensity standard curve of DNA adenine methyltransferase activity;

[0029] Figure 3 The specificity verification result of DNA adenine methyltransferase activity detection;

[0030] Figure 4 The fluorescence difference when the molecular beacon with different nucleotide sequences is detected. DETAILED DESCRIPTION

[0031] The present application will be further described below in combination with the drawings and specific embodiments, so that those skilled in the art can better understand the present application and can be implemented, but the embodiments are not as a limitation on the present application.

[0032] The present application provides an analysis method for DNA adenine methyltransferase activity based on rolling circle amplification and RNA cleavage DNA mimic enzyme technology:

[0033] Firstly, the designed substrate hairpin probe (HP) is denatured at high temperature and then reannealed to form a hairpin structure. After adding DNA adenine methyltransferase and restriction endonuclease, the HP is cut into a short hairpin structure (sHP) under the action of double enzyme coupling. After mixing the sHP and the pre-synthesized DNA circular structure, DNA rolling circle amplification is carried out, and the obtained amplification product is a DNA single strand containing RNA cleavage type DNA mimic enzyme. After adding the molecular beacon, the RNA cleavage type DNA mimic enzyme will cut the molecular beacon to produce a fluorescence signal. The higher the activity of DNA adenine methyltransferase is, the higher the concentration of sHP produced by double enzyme coupling is, which leads to the increase of rolling circle amplification product, that is, the increase of the concentration of RNA cleavage type DNA mimic enzyme, so that the fluorescence intensity is enhanced. The linear relationship between the fluorescence signal intensity and the activity of DNA adenine methyltransferase can be used to determine the activity of DNA adenine methyltransferase in the sample.

[0034] The DNA sequences described in the following examples are purchased from Shenguo Bioengineering (Shanghai) Co., Ltd.

[0035] The nucleic acid sequences used in the embodiments of the application are shown in Table 1.

[0036] Table 1 Sequence list

[0037]

[0038] Establishment of detection system in Example 1

[0039] (1) Methylation of HP: the HP is denatured at 95℃ for 5min and then reannealed at 4℃ for 30min to form a hairpin structure. S-adenosyl methionine is added as a methylation transfer raw material. DNA adenine methyltransferase and restriction endonuclease Dpn I are added to perform double enzyme coupling at 37℃. The HP is methylated and cut at a specific site to obtain rolling circle amplification primer sHP. The sequence of the HP is as follows:

[0040] Substrate hairpin probe: 5'-ACTTATCAGCACTCGGATCATACGACTTCTACTTGATCCGAGTGCTGATAAGT

[0041] (2) Formation of DNA circular template:

[0042] After mixing the DNA template probe and the DNA ligation probe, the mixture is denatured at 95℃ for 5min and then reannealed at 4℃ for 30min. T4 DNA ligase is added and incubated at 16℃ for 12h to connect the template probe end to end to form a circular structure. After adding EXO I and EXO III to digest the ligation probe combined with the template probe and the excess DNA single strand, the DNA circular template is obtained.

[0043] DNA template probe sequence and DNA ligation probe sequence are:

[0044] DNA template probe: 5'-P-AGTCGTGGGATCTCAAGTAGAAGTCGTATGA ACATGGGTGTAACCTGGTTAATCGCTGACCTGAACGCT

[0045] DNA ligation probe: 5'-GATCCCACGACTAGCGTTCAGGTC

[0046] (3) DNA rolling circle amplification reaction: after mixing sHP obtained in step (1) with DNA circular template in step (2), denaturing at 95℃ for 5 min and then annealing at 4℃ for 30 min to form partial base complementary pairing, adding Phi 29 DNA polymerase and dNTP, and then adding Tris-HCl buffer to make the volume 90 μL, incubating at 37℃ for 2 h, using DNA circular template as amplification template and sHP as primer to perform DNA rolling circle amplification reaction. The composition of Tris-HCl buffer is: 50 mM Tris, 100 mM NaCl, 20 mM MgCl2, 200 mM KCl, pH 7.4.

[0047] (4) Cleavage of molecular beacon: adding molecular beacon to the DNA rolling circle amplification product obtained in step (3) and incubating at 37℃ in the dark for 2 h. The molecular beacon is cleaved by the RNA cleavage type DNA mimic enzyme in the DNA rolling circle amplification product, and the fluorescence group and the quenching group are far away, releasing a large amount of fluorescence signal. Molecular beacon: 5'-FAM-ACATG / rA / TGGTTA-BHQ1-3'.

[0048] (5) Detection of fluorescence intensity and drawing of standard curve: using Enspire Microplate Reader to measure the fluorescence intensity of the solution obtained in step (4), and the measurement parameters are excitation light 485 nm and emission light 525 nm. According to the relationship between the measured fluorescence intensity and the activity of DNA adenine methyltransferase, the corresponding linear relationship curve is drawn.

[0049] (6) Actual sample detection: diluting the target with human serum, repeating the operations described in steps (1) to (5), and measuring the corresponding fluorescence intensity, and calculating the corresponding target activity from the standard curve.

[0050] Example 2 Drawing of DNA adenine methyltransferase activity standard curve

[0051] The HP sequence was subjected to methylation reaction with DNA adenine methyltransferase of different activities, 5U restriction endonuclease Dpn I and 1600 μΜ S-adenosylmethionine, and sHP was obtained by cleavage at the methylation site. After mixing the template probe and the ligation probe, denaturation at 95 °C for 5 min, annealing at 4 °C for 30 min, 20U T4 DNA ligase was added to form a DNA circular structure at 16 °C for 12 h, and 100U EXO I and 10U EXO III were added to digest the excess single-stranded DNA to obtain a DNA circular template. After mixing sHP with the DNA circular template, 0.5U Phi 29 DNA polymerase and 250nM dNTP were added to incubate at 37 °C for 2h to perform DNA rolling circle amplification reaction. Then the molecular beacon was added to incubate at 37 °C for 2h in the dark to perform RNA cleavage type DNA mimic enzyme cleavage reaction, so that the fluorescent group and the quencher group were away from each other, and a large amount of fluorescent signal was generated. The fluorescence intensity was measured in Enspire Microplate Reader, and the parameters were set as excitation light 485 nm and emission light 525 nm. The standard curve determination of DNA adenine methyltransferase of different activities was repeated. According to the relationship between the determined fluorescence value and the target activity, the corresponding linear relationship curve was drawn.

[0052] As shown in Figure 2 , the fluorescence intensity increased with the increase of the activity of DNA adenine methyltransferase, and the linear regression equation was y = 6331.87 * logC + 43301.65 (R 2 = 0.9916), wherein y represents the fluorescence signal intensity, C represents the target activity (U / mL), the detection limit of the method is 3.09 x 10 -4 U / mL, and the detection range is 10 -3 U / mL ~ 10 U / mL.

[0053] Example 3 Specificity verification

[0054] Other non-target proteins were used to replace DNA adenine methyltransferase to verify the specificity of the detection method to the target. The results are shown in Figure 3 , only when DNA adenine methyltransferase (a) is present, the detection method shows high fluorescence intensity. When BSA (b), Klenow exo - (c) and Nb.bpu 10I (d) are present, the fluorescence intensity is very weak. It is proved that the detection method has strong specificity to DNA adenine methyltransferase.

[0055] Example 4 Detection of target activity in actual sample

[0056] In order to further verify the accuracy of the method in determining the target activity in the actual sample, human serum was selected as the sample for detection.

[0057] Different active targets were added to the human serum sample, and the human serum sample was added to the HP sequence to add different active DNA adenine methyltransferase, 5U restriction endonuclease Dpn I and 1600 μM S-adenosyl methionine for methylation reaction and cutting at the methylation site by restriction endonuclease Dpn I to obtain sHP. After mixing the template probe and the ligation probe, high-temperature denaturation was carried out, and under the action of T4 DNA ligase, the reaction was carried out for 12 h to form a DNA circular structure, 100 U EXO I and 10 U EXO III were added to digest the excess single-stranded DNA to obtain a DNA circular template. After mixing sHP with the DNA circular template, 0.5 U Phi 29 DNA polymerase and 250 nM dNTP were added, and the DNA rolling circle amplification reaction was carried out at 37°C for 2 h. Then the molecular beacon was added, and the RNA cleavage type DNA mimic enzyme cutting reaction was carried out at 37°C for 2 h, so that the fluorescent group and the quencher group were far away from each other, and a large amount of fluorescent signal was generated. The fluorescence intensity was measured in the Enspire Microplate Reader, and the fluorescence value was substituted into the standard curve to calculate the activity of the target.

[0058] The specific sample and detection results are shown in Table 2.

[0059] Table 2 Actual sample detection

[0060] Sample Activity of added target Activity of detected target Recovery (%) Relative standard deviation (%) 1 0.05 U / mL 0.0516 U / mL 103.28 2.94% 2 0.5 U / mL 0.4811 U / mL 96.24 4.65% 3 5 U / mL 4.7892 U / mL 95.78 3.32%

[0061] Comparative Example 1

[0062] The template probe and the ligation probe were replaced by the sequences in the following table, and the remaining steps were the same as in the example. It was found that when the system constructed using the following probes was used for detection, even without the addition of the target, the system would produce a relatively high fluorescence value, leading to false positives.

[0063]

[0064] Comparative Example 2

[0065] The molecular beacon was replaced by 5'-FAM-TGACTGTT / rA / GGAATGAC-BHQ1-3', and the remaining steps were the same as in the example.

[0066] The fluorescence effects produced by different molecular beacons were determined, and the results are shown in Figure 4 wherein the molecular beacon 1 is the molecular beacon used in Example 1, and the molecular beacon 2 is the molecular beacon provided in this comparative example. It can be seen that the fluorescence difference produced by the molecular beacon 1 is higher, and the detection effect is better under the same concentration.

[0067] Obviously, the above embodiments are merely example for clearly illustrating, and are not limitation to the embodiments. For ordinary skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, all the embodiments need not and can not be exhausted. The obvious changes or variations derived therefrom are still within the scope of the present invention.

Claims

1. A method for detecting non-diagnostic DNA adenine methyltransferase activity, characterized by, Comprise the following steps: S1, denaturation, renaturation of the substrate hairpin probe sequence to form a hairpin structure, incubate the hairpin structure with different activities of DNA adenine methyltransferase respectively, add restriction endonuclease Dpn I after incubation, continue to incubate to obtain a mixture containing cleavage products; S2, using the cleavage products obtained in S1 as primers, using a rolling circle probe containing RNA cleavage type DNA mimic enzyme complementary sequence as a template for rolling circle amplification to obtain a mixture containing amplification products; The amplification product is a sequence containing RNA cleavage type DNA mimic enzyme; S3, adding molecular beacon to the mixture containing amplification products for incubation, establishing a relationship curve between fluorescence signal and DNA adenine methyltransferase activity; S4, the sample to be tested is operated according to S1-S3, the fluorescence intensity is measured, and the activity of DNA adenine methyltransferase is calculated according to the relationship curve of S3; The nucleotide sequence of the rolling circle probe is shown as SEQ ID NO. 1, the nucleotide sequence of the substrate hairpin probe sequence is shown as SEQ ID NO. 2, the nucleotide sequence of the molecular beacon is shown as SEQ ID NO. 3, the molecular beacon is modified with a fluorescent group and a quencher group at both ends, and the incubation system of step S1 includes S-adenosyl methionine.

2. The method of claim 1, wherein the non-diagnostic DNA adenine methyltransferase activity is detected by: (a) contacting the DNA with a DNA adenine methyltransferase enzyme; (b) contacting the DNA with a DNA adenine methyltransferase enzyme inhibitor; and (c) detecting the presence or absence of the DNA adenine methyltransferase enzyme inhibitor. The cleavage products are denatured and renatured with the rolling circle probe to form a complementary structure, and are added to the amplification system for rolling circle amplification.

3. The method of claim 2, wherein the non-diagnostic DNA adenine methyltransferase activity is detected by: (a) contacting the DNA with a DNA adenine methyltransferase enzyme; (b) contacting the DNA with a DNA adenine methyltransferase enzyme inhibitor; and (c) detecting the presence or absence of the DNA adenine methyltransferase enzyme inhibitor. The amplification system comprises Phi 29 DNA polymerase, dNTP and Tris-HCl buffer.

4. The non-diagnostic DNA adenine methyltransferase activity detection method according to claim 3, characterized in that: The composition of Tris-HCl buffer is: 45-55 mM Tris, 95-105 mM NaCl, 15-25 mM MgCl2, 195-205 mM KCl.

Citation Information

Patent Citations

  • Nucleic acid enzyme-mediated signal amplification for biosensing

    US20200325521A1