A strain producing protein glutaminase and its application

Abstract

The present invention discloses a strain producing protein glutaminase and its application, belonging to the field of genetic engineering and fermentation engineering. The present invention uses Bacillus subtilis 168 as the initial strain, constructs a recombinant strain containing a transcriptional regulatory factor comk fragment and a Vpr protease promoter replacement fragment, and transforms the protein glutaminase expression plasmid to obtain a Bacillus subtilis recombinant strain BSK2-PG producing active protein glutaminase. Through xylose-induced fermentation and enzyme activity detection, it is found that the recombinant strain can obtain the expression and accumulation of active protein glutaminase. And by optimizing the xylose addition time and addition concentration, after fermentation for 59-72h, the enzyme activity of shake flask fermentation is 7.2U / mL, and the enzyme activity of fermentation tank fermentation is 25U / mL. The recombinant strain can be widely used in the production of protein glutaminase, which is beneficial to reduce the production cost of the enzyme.

Description

Technical Field

[0001] The invention relates to a strain producing protein glutaminase and application thereof, belonging to the technical field of genetic engineering and fermentation engineering. Background Art

[0002] Plant proteins contain a large amount of glutamine and asparagine residues. Removing the amide-containing components by deamidation can enhance the processability of the protein, improve the taste, promote gastrointestinal digestion and ensure its biological activity. Currently, the commonly used deamidation methods include chemical methods (removal by acid, alkali treatment or ion exchange resin) and enzymatic methods (catalyzed by peptide glutaminase, glutaminase and protein glutaminase). Chemical deamidation has many adverse effects on proteins, such as peptide chain hydrolysis and the production of adverse by-products. Enzymatic deamidation has the advantages of mild reaction conditions, fast reaction rate, high specificity and safety, and is more desirable than chemical deamidation.

[0003] Protein-glutaminase (EC 3.5.1.44, Protein-glutaminase, PG) is produced as an inactive zymogen. After activation, it can specifically catalyze glutamine residues in proteins, release protein L-glutamate and ammonia, and will not catalyze asparagine residues or cause adverse effects on protein structure. It is a food safety enzyme that can effectively improve protein functions such as solubility, emulsification, affinity and gelation, and is widely used in food processing, feed and other industries. In 2000, Yamaguchi and Yokoe first discovered and purified a protein deamidase with industrial application potential in the culture supernatant of Chryseobacterium proteolytic strain 9670. However, natural production strains have problems such as low enzyme yield, weak enzyme activity, and low genetic manipulation efficiency, which cannot meet the requirements of industrial production. Therefore, it is very important to establish an effective heterologous expression system for the industrial production and application of PG. Summary of the invention

[0004] The present invention provides the construction and application of a Bacillus subtilis strain producing active protein glutaminase. Using Bacillus subtilis 168 host bacteria as the initial strain, a recombinant strain containing a xylose-induced expression global transcriptional regulatory factor comk expression frame and a Vpr protease promoter replacement fragment is constructed; then a protein glutaminase gene derived from Chryseobacterium proteolyticum (C.proteolyticum) is constructed on a plasmid and transformed into the above-mentioned recombinant strain, and a host bacteria that can efficiently activate and accumulate protein glutaminase is obtained by optimizing the expression time and expression intensity of comk and Vpr proteases. The host bacteria can be applied to the production of protein glutaminase, which is beneficial to reducing the production cost of the enzyme.

[0005] The invention provides a recombinant bacillus subtilis bacteria producing active protein glutaminase, a xylose-inducible promoter for regulating the expression of Vpr protease, and a recombinant vector carrying the protein glutaminase gene shown in SEQ ID NO.1.

[0006] In one embodiment of the present invention, the nucleotide sequence of the xylose-inducible promoter is shown in SEQ ID NO. 2; the gene encoding the Vpr protease is located on the genome of Bacillus subtilis.

[0007] In one embodiment of the present invention, the promoter of the Vpr protease is replaced by a xylose-inducible promoter P xyl , the xylose-inducible promoter P xyl There is also a regulatory protein xylR gene upstream.

[0008] In one embodiment of the present invention, the recombinant vector is pHT01, pP43NMK or pMA5 vector.

[0009] In one embodiment of the present invention, the host of the recombinant Bacillus subtilis is Bacillus subtilis 168, WB600 or WB800.

[0010] The present invention provides a method for constructing a recombinant Bacillus subtilis bacteria producing active protein glutaminase. Bacillus subtilis 168 is used as a starting strain, a recombinant strain containing a xylose-induced transcriptional regulatory factor comk expression frame (integrated into the genome) is constructed, and the recombinant strain is named BSK1. Then, the natural promoter of the Vpr protease on the genome is replaced with a xylose promoter, and the obtained recombinant strain is named BSK2. Finally, a plasmid containing the protein glutaminase is transformed into BSK2, and the recombinant bacteria is named BSK2-PG.

[0011] The invention provides a method for expressing protein glutaminase by using the recombinant bacterium BSK2-PG, and the bacterium is inoculated into a TB culture medium for fermentation.

[0012] In one embodiment of the present invention, xylose is added during the fermentation process. The xylose is added during the logarithmic phase or the stable phase of the fermentation. The final concentration of xylose is 0-4% (V / V) and the fermentation is continued for at least 59 hours.

[0013] In one embodiment of the present invention, the logarithmic phase or stationary phase refers to fermentation for 12-36 hours.

[0014] The present invention provides a method for improving the expression of protein glutaminase, which is characterized in that fermentation is carried out using recombinant bacillus subtilis BSK2-PG, and xylose is added in the logarithmic phase or the stable phase, with the final added concentration being 0-4% (V / V).

[0015] The present invention provides the application of the recombinant bacillus subtilis BSK2-PG, or the method for expressing protein glutaminase, or the method for improving the expression of protein glutaminase in the production of protein glutaminase and food containing protein glutaminase.

[0016] Beneficial Effects

[0017] The invention constructs a recombinant Bacillus subtilis expressing protein glutaminase. During shake flask fermentation, the activity of the protein glutaminase of the strain reaches a maximum at 72 hours of fermentation, which can reach 7.2 U / mL. During fermentation in a fermenter, the activity of the protein glutaminase reaches a maximum at 59 hours of fermentation, which can reach 25 U / mL. The activity is 2 to 8 times higher than the fermentation activity (0.4 to 7 U / mL) of the currently reported recombinant Bacillus subtilis. The invention is beneficial to promoting the industrial production of protein glutaminase, reducing production costs, and promoting its wide application in the field of food industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : Schematic diagram of the recombinant fragment of comk transcriptional regulatory factor and vpr promoter gene;

[0019] Figure 2 :pP43NMK-PG plasmid map;

[0020] Figure 3 :Optimization of xylose induction time of BSK2-PG recombinant strain;

[0021] Figure 4 :Optimization of xylose induction concentration for BSK2-PG recombinant strain;

[0022] Figure 5 : Electrophoresis of purified protein glutaminase;

[0023] Figure 6 : Fermentation curve of BSK2-PG recombinant strain in 3-L tank. DETAILED DESCRIPTION

[0024] The present invention will be further described below with reference to examples.

[0025] The culture medium formula involved in the embodiment of the present invention is as follows:

[0026] LB liquid medium: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, adjust pH to 7.2-7.4, sterilize at 121℃ for 20min;

[0027] LB solid medium: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar 10g / L, adjust pH to 7.2-7.4, sterilize at 121℃ for 20min;

[0028] TB liquid medium: peptone 12 g / L, yeast extract 24 g / L, glycerol 5 g / L, KH2PO4 2.31 g / L, K2HPO4 12.54 g / L, adjust pH to 7.2-7.4, sterilize at 115°C for 20 min;

[0029] 10× salt solution: K2HPO4·3H2O 183 g / L, KH2PO4 60 g / L, (NH4)2SO4 20 g / L, trisodium citrate 10 g / L, MgSO4·7H2O 2 g / L, dissolved in distilled water in sequence;

[0030] The preparation method of GM I is as follows: 95.6 ml of 1× minimum salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein, and 1 ml of 10% yeast powder juice; wherein 1× minimum salt solution is prepared by diluting 10× salt solution;

[0031] GM II preparation method is: 1× minimum salt solution 96.98 ml, 20% glucose 2.5 ml, 5% hydrolyzed casein 0.08 ml, 10% yeast powder juice 0.04 ml, 1M MgCl2 0.25 ml, 1M CaCl2 0.05 ml;

[0032] Washing buffer: 20 mM PBS, 0.5 M NaCl, 0-30 mM imidazole, pH 7.4;

[0033] Elution buffer: 20 mM PBS, 0.5 M NaCl, 500 mM imidazole, pH 7.4.

[0034] Example 1: Construction of recombinant Bacillus subtilis strain BSK1

[0035] 1. Construction of comk transcriptional regulatory factor genomic integration fragment:

[0036] Primer design:

[0037] TF:ctttccaattcaagTCGTCGAACGGCAGGCG;

[0038] TR: gataaattaccccacTATCTCTGGAAGATCCGCGCGTAC;

[0039] WU-F: gtggggtaatttatctgatagggggaac;

[0040] WU-R:tccccgggtaccgagctcgaagttatccctcctgcaaaataatgaatctcct;

[0041] WD-F:ctgcaggcatgcaagcttgccaaaaagcggtgctcgatgc;

[0042] WD-R:GTTCGACGActtgaattggaaagaaaagagaggaatgaag;

[0043] CMF:ttcgagctcggtacccggggatc;

[0044] CMR:caagcttgcatgcctgcaggtcgacg;

[0045] TW-F:ttcgagctcggtacccggggatc;

[0046] TW-R:ctataagttaggttatccctcctgcaaaataatgaatctcct;

[0047] X-F:agggataacctaacttataggggtaacacttaaaaaagaatcaat;

[0048] X-R:tctgactcattgtacatttccccctttgatttaagtgaac;

[0049] comk-F:gaaatgtacaatgagtcagaaaacagacgcacctttagaatc;

[0050] comk-R:gatccccgggtaccgagctcgaaaaaggagctgccctgttcggtca;

[0051] WF:gtggggtaatttatctgatagggggaac;

[0052] WR:cttgaattggaaagaaaagagaggaatgaag;

[0053] XCX-F:tctgccgcctctagattgccctg;

[0054] JPF:cgacattattgccaccggtacgc;

[0055] JPR:ctttcagcaccttagtaagtttatgcatcta;

[0056] Using the genome of Bacillus subtilis 168 as a template, primers WU-F / R and WD-F / R were used to amplify the upstream and downstream homology arms; using the commercial T-carrier plasmid as a template, primers TF / TR were used to amplify the T-carrier fragment; using the nucleotide sequence shown in SEQ ID NO.3 (gene synthesis was performed by Sangon Biotech (Shanghai) Co., Ltd.) as a template, CMF / CMR primers were used to amplify the chloramphenicol gene fragment containing the lox site. The above fragments were connected using Seamless cloning master, transformed into Escherichia coli JM109, coated with LB plates containing 100 μg / mL ampicillin, and cultured at 37°C overnight. The transformants grown on the plates were verified by colony PCR using primers TW-F / R, and the transformants with correct colony PCR were selected and inoculated into LB liquid for 12 hours. The plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis to obtain plasmid TW.

[0057] Using the genome of Bacillus subtilis 168 as a template, primers comk-F / R were used to amplify the comk gene of the Bacillus subtilis genome; using the PHY300 plasmid as a template, primers XF / R were used to amplify the xylose induction system (including the xylose promoter region and the regulatory protein xylR); using plasmid TW as a template, primers TW-F / R were used to amplify the plasmid vector (including the upstream and downstream homology arms of the integration site fragment, and the chloramphenicol resistance gene fragment). The above fragments were connected using Seamless cloning master, transformed into Escherichia coli JM109, coated with LB plates containing 100 μg / mL ampicillin, and cultured at 37°C overnight. The transformants grown on the plates were verified by colony PCR using primers XCX-F / WR. The transformants with correct colony PCR were selected and inoculated into LB liquid for culture for 12 hours. The plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis to obtain plasmid T-comk.

[0058] 2. Construction of recombinant Bacillus subtilis strain BSK1:

[0059] Using the plasmid T-comk obtained in the above steps as a template, the comk expression system integration fragment was amplified by PCR using primers WF / WR (including the upper and lower homologous arms of the genomic recombination site, the chloramphenicol resistance gene, and the xylose-induced comk expression system), and the fragment was purified using a kit of Shanghai Biotech, and transformed into the host Bacillus subtilis 168 by the competent transformation method. The specific process is as follows: freshly activated Bacillus subtilis 168 was inoculated from an LB plate into 5 ml of GMI solution, and cultured overnight at 37° C. and 220 rpm with shaking; on the second day, 1 ml was transferred to 9 ml of GM I, and cultured at 37° C. and 220 rpm for 3.5 h; 1 ml of the culture solution in the previous step was transferred to 20 ml of GM II solution, and after culturing at 37° C. and 220 rpm for 90 min, the bacteria were collected by centrifugation at 5000 g for 10 min; the bacteria were gently suspended with 1 ml of GM II solution, and the suspended bacteria were competent cells. Then, 0.2 ml of competent cells were taken, 10 uL of comk expression system integration fragment was added, and the cells were cultured at 37°C and 220 rpm for 60 min. Then, the cells were spread on LB plates containing 5 μg / mL chloramphenicol, and the cells were cultured at 37°C overnight. The transformants were checked the next day.

[0060] The correct colonies were selected from the transformation plate for PCR (primers used were JPF / JPR), inoculated into LB liquid medium containing 5 μg / mL chloramphenicol, and cultured overnight at 37°C and 220 rpm. The next day, the bacterial solution was diluted to OD 600 To about 1.0, add appropriate inducer xylose (50%) to a final concentration of 3% for induction, and culture at 37°C, 220rpm for 2h to obtain competent cells. Then take 0.2mL of competent cells, add 10μL of chloramphenicol-eliminated plasmid PDG148-cre, culture at 37°C, 220rpm for 90min, spread on LB plate containing 5μg / mL chloramphenicol and 50μg / mL kanamycin, and culture at 37°C overnight. The monoclonal transformants on the plate were picked up and placed in fresh LB liquid medium containing 50 μg / mL kanamycin, 0.5 μM IPTG was added, and the culture was induced at 37°C for 24 hours, then transferred to antibiotic-free LB medium, and cultured at 50°C for 24 hours, then streaked on an antibiotic-free LB plate, and the monoclonal transformants on the plate were picked up and spotted on LB plates containing 5 μg / mL chloramphenicol, LB plates containing 50 μg / mL kanamycin, and LB plates without antibiotics, and the transformants that did not grow on chloramphenicol and kanamycin plates but grew on antibiotic-free plates were selected, and the obtained Bacillus subtilis strain was named BSK1.

[0061] Example 2: Construction of recombinant Bacillus subtilis strain BSK2

[0062] 1. Construction of Vpr protease promoter replacement fragment:

[0063] Primer design:

[0064] U-F: CTTCCAGAGATAcaagcagcccattttgaatcctttc;

[0065] U-R: gagctcgaattttctatgaaacgtttgcttgtatctttacg;

[0066] D-F: caaagggggaaatgtacattgaaaaaggggatcattcgctttctg;

[0067] D-R: GTTCGACGActtcagatctgggtgattgtattcaacc;

[0068] C-F: caagcaaacgtttcatagaaaattcgagctcggtacccggggatc;

[0069] C-R: gtgttacccctataagttagcaagcttgcatgcctgcaggt;

[0070] xyl-F: gcaagcttgctaacttataggggtaacacttaaaaaagaatcaat;

[0071] xyl-R: cttttttcaatgtacatttccccctttgatttaagtgaac;

[0072] T-F: gatctgaagTCGTCGAACGGCAGGCG;

[0073] T-R: caaaatgggctgcttgTATCTCTGGAAGATCCGCGCGTAC;

[0074] VDF: caagcagcccattttgaatcctttc;

[0075] VDR: cttcagatctgggtgattgtattcaacc;

[0076] CCX-F: gcgacggagagttaggttattgggataag;

[0077] CCR-R: cttatcccaataacctaactctccgtcgc;

[0078] PF:ctcttttacatgtccgatcgcccac;

[0079] Using the PHY300 plasmid as a template, primers xyl-F / R were used to amplify the xylose induction system (including the xylose promoter region and the regulatory protein xylR); using the nucleotide sequence shown in SEQ ID NO.3 (gene synthesised from Sangon Biotech (Shanghai) Co., Ltd.) as a template, primers CF / R were used to amplify the chloramphenicol gene containing the lox site; using the Bacillus subtilis genome as a template, primers UF / R and DF / R were used to amplify the upstream and downstream homology arms; using the commercial T vector as a template, primers TF / R were used to amplify the plasmid vector T vector fragment. The above fragments were connected using Seamless cloning master, transformed into Escherichia coli JM109, coated with LB plates containing 100 μg / mL ampicillin, cultured at 37°C overnight, and the transformants grown on the plates were verified by colony PCR using primers CCX-F / R. The transformants with correct colony PCR were selected and inoculated into LB liquid for culture for 12 hours, and the plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis to obtain plasmid T-PX.

[0080] 2. Construction of recombinant Bacillus subtilis strain BSK2:

[0081] The promoter-replacement recombinant fragment in the above recombinant plasmid T-PX was amplified by PCR using primers VDF / VDR (including the upper and lower homologous arms of the genomic recombination site, the chloramphenicol resistance gene, and the xylose-induced expression system), and the fragment was purified using a kit from Shanghai Bioengineering, and the host Bacillus subtilis BSK1 was transformed by the competent transformation method. The specific process of the transformation method is as follows: freshly activated Bacillus subtilis BSK1 was inoculated into an appropriate amount of fresh LB liquid culture medium, and cultured overnight at 37°C and 220rpm. The bacterial solution was diluted to OD 600 To about 1.0, add appropriate inducer xylose (50%) to a final concentration of 3% for induction, and culture at 37°C, 220rpm for 2h to obtain competent cells. Then take 0.2mL of competent cells, add 10μL of promoter to replace the recombinant fragment, culture at 37°C, 220rpm for 90min, spread on LB plate containing 5μg / mL chloramphenicol, culture at 37°C overnight, and check the transformants the next day.

[0082] The primers PF / VDR were used to pick the colonies on the transformation plate for colony PCR verification, and the resistance of the verified colonies was eliminated. The transformation, induction and elimination methods of the PDG148-cre plasmid were the same as above, and the obtained Bacillus subtilis strain was named BSK2.

[0083] Example 3: Construction of protein glutaminase recombinant strain

[0084] 1. Construction of protein glutaminase expression plasmid:

[0085] The protein glutaminase from Chryseobacterium utilis was named PG, and its encoding nucleotide sequence is SEQ ID NO. 1. The PG gene was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and then the synthesized gene fragment was used as a template to extend the PG gene fragment using primers PG-F and PG-R, and the pP43NMK vector fragment was amplified using PV-F and PV-R.

[0086] PCR primers are as follows:

[0087] PG-F:cttgctggatgtacgGATTCAAATGGCAATCAAGAAATTAATGGC;

[0088] PG-R: gctttcatcaTTAatgatgatgatgatgatgAAAGCCGCATGATGAAACATCCG;

[0089] PV-F: catcatcatTAAtgatgaaagcttggccaggac;

[0090] PV-R:CATTTGAATCcgtacatccagcaagcaaaatcataag;

[0091] The above primers were used to amplify the protein glutaminase gene and the pP43NMK vector fragment, and the vector fragment and the PG gene were connected using Seamless cloning master. Escherichia coli JM109 was transformed and coated with LB plates containing 100 μg / mL ampicillin. The plates were cultured at 37°C overnight, and the successfully transformed transformants were selected and inoculated into LB liquid for culture for 12 hours. The plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis to obtain the protein glutaminase expression plasmid pP43NMK-PG.

[0092] 2. Construction of protein glutaminase recombinant strain

[0093] The above recombinant plasmid pP43NMK-PG was transformed into the Bacillus subtilis host cell BSK2 containing the comk expression frame. The specific transformation process is as follows: freshly activated Bacillus subtilis BSK2 was inoculated into an appropriate amount of fresh LB liquid culture medium, and cultured at 37°C and 220rpm overnight. The next day, the bacterial solution was diluted to OD 600To about 1.0, add appropriate inducer xylose (50%) to a final concentration of 3% (V / V) for induction, and culture at 37°C, 220rpm for 2h to obtain competent cells. Then take 0.2mL competent cells, add 10μL protein glutaminase expression plasmid pP43NMK-PG, culture at 37°C, 220rpm for 90min, spread on LB plate containing 50μg / mL kanamycin, culture at 37°C overnight, and obtain Bacillus subtilis strain containing protein glutaminase expression plasmid, named BSK2-PG.

[0094] 3. Expression of PG in recombinant strains of Bacillus subtilis

[0095] The single colonies of the recombinant Bacillus subtilis strain BSK2-PG obtained on the above plate were selected and inoculated into 2 mL of LB liquid containing 50 μg / mL kanamycin, and cultured at 37°C and 220 rpm for 12 h to obtain seed liquid. Then 1 mL of the seed liquid was inoculated into 25 mL of TB liquid culture medium, and cultured at 37°C and 220 rpm. The fermentation broth was centrifuged at different times to obtain the supernatant, and the enzyme activity of protein glutaminase was detected.

[0096] Example 4: Expression and purification of protein glutaminase recombinant strains

[0097] 1. Expression optimization of protein glutaminase recombinant strain

[0098] Pick the colonies obtained on the above plates and inoculate them into 2 mL of LB liquid containing 50 μg / mL kanamycin, shake and culture at 37°C and 220 rpm for 12 h to obtain seed liquid, then take 1 mL of seed liquid and inoculate it into 25 mL of TB liquid culture medium to optimize the time and intensity of xylose induction. The specific steps are as follows:

[0099] Optimization of xylose induction time: After the seed liquid was transferred to the shake flask, xylose was added to a final concentration of 1% (V / V) at 0h, 12h, 24h, and 36h after transfer according to the culture time. No xylose was added (C) as a control. Starting from 36h, the fermentation liquid was centrifuged every 6h to obtain the supernatant and the enzyme activity of protein glutaminase was detected.

[0100] Optimization of xylose induction intensity: After the seed liquid was transferred to the shake flask, xylose was added to different final concentrations of 0%, 0.5%, 1%, 2%, 3%, 4% (V / V) after 24 hours of culture. Starting from 36 hours, the fermentation liquid was centrifuged every 12 hours to obtain the supernatant and detect the enzyme activity of protein glutaminase.

[0101] The results showed that protein glutaminase was best induced by adding xylose at 24h, and the best effect was achieved when the final concentration of xylose was 3%. When xylose was added to a final concentration of 3% (V / V) at 24h of fermentation, the protein glutaminase activity of the BSK2-PG strain reached the highest level of 7.2U / mL after 72h of culture.

[0102] Enzyme activity detection method

[0103] The activity of protein glutaminase is defined as the amount of enzyme required to hydrolyze the substrate Z-Gln-Gly (benzyloxycarboxy-glutamine-glycine) to produce 1 μmol of ammonium ions at 37°C and pH 6.5 for 30 min. It is defined as 1 protein glutaminase activity unit and expressed in U.

[0104] Enzyme activity assay

[0105] Standard curve: Weigh 0.314 g of NH4Cl and dry it in an oven for 1 hour, then add water to make up to 1 L. Dilute according to Table 1 to obtain ammonia standard solutions of different concentrations.

[0106] Table 1 Ammonia standard solutions of different concentrations

[0107]

[0108] Take 60 μL of ammonia solution of different concentrations, add 240 μL ddH2O, 300 μL color reagent A, 150 μL color reagent B and 300 μL color reagent C respectively, mix thoroughly, and color develop in a 37°C water bath for 20 min. Use an enzyme marker to measure the absorbance at 630 nm. Use ammonium chloride concentration as the horizontal axis and absorbance value as the vertical axis to draw a standard curve of ammonia based on the results.

[0109] Color developing solution A: Weigh 2.023 g of phenol and 7.5 mg of sodium nitrosoferrocyanide, dissolve in double distilled water and make up to 50 mL.

[0110] Color developing solution B: Weigh 2.5 g KOH and dissolve it in double distilled water and make up to 50 mL.

[0111] Color developing solution C: Weigh 10.2 g of anhydrous K2CO3 and dissolve it in double distilled water, add 417 μL of NaClO solution dropwise, and add water to make up to 50 mL.

[0112] Substrate Cbz-Gln-Gly solution: Weigh 0.337 g of dipeptide Cbz-Gln-Gly and dissolve it in 0.176 mol·L -1 PBS buffer (pH 6.5) and dilute to 100 mL.

[0113] Trichloroacetic acid solution (0.4 mol·L -1): Weigh 6.536 g of trichloroacetic acid and dissolve it in 90 mL of distilled water, and make up to 100 mL.

[0114] Sample reaction: Take 1 mL of dipeptide Cbz-Gln-Gly solution and incubate it in a 37°C water bath for 10 min, add 100 μL of diluted fermentation supernatant, mix well, and place in a 37°C water bath for 30 min. After the reaction, add 1 mL of 0.4 mol·L -1 Trichloroacetic acid solution, mix well and terminate the reaction. Take 60 μL of the reaction solution and mix it thoroughly with 240 μL of distilled water, 300 μL of color reagent A, 150 μL of color reagent B and 300 μL of color reagent C, incubate in a 37°C water bath for 20 minutes, cool, and measure the light absorption value of the system at 630 nm.

[0115] Blank reaction: Take 100 μL of the diluted fermentation liquid and boil it at 100°C for 5 min as the blank group. The enzyme activity detection method is the same as above.

[0116] Enzyme activity calculation:

[0117]

[0118] OD1: light absorption value of the experimental system;

[0119] OD2: light absorption value of the control system;

[0120] a: slope of the standard curve of ammonia solution;

[0121] 30: reaction time min;

[0122] 2.1 / 0.1: volume ratio of reaction solution to enzyme solution;

[0123] 17.03: Relative molecular mass of ammonia.

[0124] 2. Purification of protein glutaminase

[0125] The fermentation broth from the shake flask fermentation was centrifuged, and the obtained supernatant was filtered through a 0.45 μm filter membrane, and then bound to a PrePsckNi-TED Purose 6FF nickel column. After the impurities on the column were washed off with a wash buffer, the protein glutaminase was recovered with elution buffers containing 100 mM and 500 mM imidazole, and the eluted protein solution was collected. The recovered protein solution was ultrafiltered and concentrated using an ultrafiltration tube, and finally the concentrated protein solution was subjected to SDS-PAGE protein electrophoresis detection.

[0126] Example 5: 3L tank fermentation

[0127] The starting Bacillus subtilis recombinant strain BSK2-PG was fermented in a 3-L fermenter. After 24 hours of fermentation, xylose was added to a final concentration of 3%. The culture medium formula used for fermentation was: glucose 20 g / L, yeast powder 24 g / L, peptone 24 g / L, K2HPO4 12.5 g / L, KH2PO4 2.5 g / L, urea 8 g / L, pH 7.4.

[0128] Fermentation production process: temperature 37°C, stirring rate 300-800rpm, ventilation volume 1.5m 3 / h, the inoculation amount is 5%, and the dissolved oxygen is controlled above 25%.

[0129] By measuring the activity of protein glutaminase in the fermentation broth at different times, the fermentation enzyme activity curve ( Figure 6 ).

[0130] The results showed that after 59 hours of fermentation, the fermentation enzyme activity of the recombinant bacteria Bacillus subtilis BSK2-PG was 25U / ml.

[0131] Comparative Example 1:

[0132] The starting strain and the recombinant strain BSK2 constructed in Example 2 were fermented by the method described in Example 5, and the enzyme activity of the fermentation broth was detected. The results were as follows:

[0133] Table 2 Fermentation enzyme activities of starting strain and BSK2 strain

[0134]

[0135] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Bacillus subtilis strain producing protein glutaminase, characterized in that: The recombinant Bacillus subtilis is integrated with a xylose-induced transcriptional regulatory factor comk fragment to induce a xylose-induced promoter P xyl A recombinant vector regulating the expression of Vpr protease and carrying the protein glutaminase gene shown in SEQ ID NO. 1; The comk fragment contains the comk gene, a xylose-induced promoter and a regulatory protein xylR, wherein the regulatory protein xylR is located upstream of the xylose-induced promoter, and the comk gene is located downstream of the xylose-induced promoter; The nucleotide sequence of the xylose-inducible promoter is shown in SEQ ID NO. 2; the gene encoding the Vpr protease is located on the Bacillus subtilis genome.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that The recombinant vector is pHT01, pP43NMK or pMA5 vector.

3. The recombinant Bacillus subtilis according to claim 2, characterized in that The host of the recombinant Bacillus subtilis bacteria is Bacillus subtilis 168, Bacillus subtilis WB600 or Bacillus subtilis WB800.

4. A method for expressing protein glutaminase, characterized in that: Fermentation using the recombinant Bacillus subtilis bacteria according to any one of claims 1 to 3; adding xylose during the fermentation process; The xylose is added during the logarithmic phase or the stable phase, the final concentration is 2-4% by volume, and the fermentation is performed for at least 59 hours.

5. A method for increasing the expression of protein glutaminase, characterized in that: Fermentation is carried out using the recombinant Bacillus subtilis bacteria according to any one of claims 1 to 3, and xylose is added during the logarithmic phase or the stable phase, with the final added concentration being 2-4% by volume.

6. Use of the recombinant Bacillus subtilis according to any one of claims 1 to 3, or the method according to claim 4, or the method according to claim 5 in the production of protein glutaminase and foods containing protein glutaminase.

Images