A gene OsB12D3 regulating rice chalkiness, its encoded protein and its application
By regulating gene editing and overexpression of the rice chalky gene OsB12D3, the problem of chalky traits in improving rice appearance quality was solved, and the rice quality was significantly improved.
Patent Information
- Application Number
- CN202310384403.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-12
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2043-04-12
AI Technical Summary
In the process of improving the appearance quality of rice in the existing technology, there are few cloned genes for the chalky trait, which affects the commercial value and quality traits of rice and makes it difficult to improve them.
Provided are a gene OsB12D3 for regulating rice chalkiness and its encoded protein. Gene editing or overexpression is performed through the CRISPR/Cas9 system to change the expression level of the OsB12D3 gene to regulate the chalkiness trait of rice.
It significantly affects the appearance quality of rice. By knocking out the OsB12D3 gene, chalkiness is increased, while overexpressing the OsB12D3 gene reduces chalkiness, thereby improving rice quality and providing useful genetic resources and technical routes.
Smart Images

Figure CN116218876B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a gene OsB12D3 for regulating rice chalkiness, its encoded protein and application. Background Art
[0002] Rice is a major staple crop in my country, with over 60% of the population relying on rice as their staple food. While both per-unit yield and total rice production have been increasing in my country in recent years, progress in cultivating high-quality rice has been relatively slow, resulting in a low market share for high-quality rice in my country. Rice quality traits encompass multiple aspects, including appearance, taste, and nutrition. Appearance directly determines the commercial value of rice and is a key indicator for evaluating rice quality. Chalkiness is the most important factor affecting rice appearance, and it also impacts both appearance and taste. Therefore, the level of rice chalkiness directly impacts its commercial value. Rapidly improving the chalkiness trait has become a pressing challenge for rice breeders in my country.
[0003] During rice grain development, endosperm filling is a process in which large amounts of storage substances, such as starch and protein, accumulate. The level of starch or protein filling during this period affects not only rice yield but also its appearance. Insufficient endosperm filling can lead to the formation of cavities between starch grains, resulting in a chalky phenotype. Previous studies have shown that, in addition to genetic factors, many other factors during the filling period, such as temperature, humidity, light, and water and fertilizer conditions, significantly influence the development of chalkiness.
[0004] There have been many studies on the genetic regulation of rice chalkiness. For example, some genes involved in rice endosperm sugar transport, energy metabolism and stress response pathways may affect rice chalkiness (Zhao et al. Genetic control of grain appearance quality in rice [J]. Biotechnology advances, 2022, 60, 108014.). Despite this, there are still many gaps in the research on chalkiness. Currently, there are few genes cloned for chalkiness traits that are more practical in breeding. For example, Chalk5 is one of the few genes that is more suitable for chalkiness trait improvement breeding (Li Yibo et al. Chalk5 encodes a vacuolar H (+) -translocating pyrophosphatase influencing grain chalkiness in rice. [J]. Nature genetics, 2014, 46 (4): 398-404.). Therefore, discovering and cloning some new chalkiness regulatory genes and further exploring their breeding application potential are of great theoretical and practical significance to current rice quality breeding research. Summary of the Invention
[0005] In order to solve the problems existing in the existing process of improving the appearance quality of rice, the present invention provides a gene OsB12D3 for regulating rice chalkiness, its encoded protein and application, which provides a new gene resource for the genetic improvement of rice quality.
[0006] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is:
[0007] In a first aspect, the present invention provides a gene OsB12D3 that regulates rice chalkiness, wherein the nucleotide sequence of the rice chalkiness gene OsB12D3 is as shown in SEQ ID NO.1, or the nucleotide sequence of the rice chalkiness gene OsB12D3 is at least 90% homologous to the sequence shown in SEQ ID NO.1.
[0008] The amino acid sequence encoded by OsB12D3 is shown in SEQ ID NO. 2, or the amino acid sequence encoded by OsB12D3 is at least 90% homologous to the sequence shown in SEQ ID NO. 2.
[0009] In a second aspect, the present invention provides an application of a gene OsB12D3 that regulates rice chalkiness in reducing rice grain chalkiness and improving rice quality.
[0010] The application method is as follows: editing, knocking out, modifying, inhibiting or overexpressing the rice chalkiness gene OsB12D3, thereby changing the expression level of the OsB12D3 gene in the target rice variety, thereby obtaining rice plants with different phenotypes.
[0011] Preferably, the vector used in the gene encoding process is pC1300-Cas9-B12D3, which contains the gene OsB12D3; the vector system is CRISPR / Csa9; and the system contains the intermediate vector SK-gRNA and the final vector pC1300-Cas9.
[0012] The preparation method of the vector pC1300-Cas9-B12D3 is as follows: the primer is mixed with the linear intermediate vector SK-gRNA after being cut with the Aar I restriction endonuclease, and the mixture is connected with T4 DNA ligase to obtain a plasmid SK-gRNA-B12D3, and the SK-gRNA-B12D3 plasmid is cut with the restriction endonucleases Kpn I and Bgl II. The 300bp fragment is recovered and mixed with the pC1300-Cas9 vector double-digested with Kpn I and BamH I, and the fragment is connected with T4 DNA ligase.
[0013] Preferably, the primer sequences are as follows:
[0014] sequence name sequence Sequence number Primer3 5'GGCAGCCGCGATGATGTTGGCAT 3' SEQ ID NO.5 Primer4 5'AAACATGCCAACATCATCGCGGC 3' SEQ ID NO.6
[0015] Preferably, the overexpression vector used in the gene overexpression process is 3*Flag-B12D3, containing the gene OsB12D3, and the vector is a plant expression vector pC1300Actin-3*Flag, which includes the promoter of the rice's own constitutively highly expressed gene Actin.
[0016] The method for preparing the overexpression vector 3*Flag-B12D3 is as follows: the pC1300Actin-3*Flag vector carrying the Actin promoter, which was linearized by cutting with restriction endonucleases SmaI and SalI, was mixed with the PCR amplification product containing OsB12D3, and homologous recombination ligation was performed using the ClonExpress Ultra One Step Cloning Kit.
[0017] Preferably, the PCR amplification primer sequences are as follows:
[0018] sequence name sequence Sequence number Primer7 5'TCCCCCGGGATGGGGCGTTGGGTTAGGCCT 3' SEQ ID NO.9 Primer8 5'GTCGACATCATCATTGTTCTCATCATGAT 3' SEQ ID NO.10
[0019] The present invention has the following beneficial effects: The authors discovered that disrupting the biological function of the protein encoded by the OsB12D3 gene significantly affects the appearance quality of rice, manifested by increased grain chalkiness. Conversely, overexpressing OsB12D3 significantly reduces rice chalkiness, improving rice quality, demonstrating the importance of this gene in improving rice quality. The present invention provides useful genetic resources and technical approaches for genetically improving rice appearance quality. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is an analysis of the expression pattern of the OsB12D3 gene in rice in Example 1 of the present invention;
[0021] Figure 2 Schematic diagram of the target sites and mutation types of the OsB12D3 gene editing in Example 2 of the present invention;
[0022] Figure 3 This is the analysis of rice chalkiness in the OsB12D3 gene knockout strain in Example 3 of the present invention; "**" indicates a very significant difference;
[0023] Figure 4 This is the target gene expression analysis of the OsB12D3 gene overexpression strain in Example 4 of the present invention; "**" indicates a very significant difference;
[0024] Figure 5 This is an analysis of rice chalkiness in the OsB12D3 gene overexpression line in Example 4 of the present invention; “**” indicates a very significant difference. DETAILED DESCRIPTION
[0025] The following is a description of specific embodiments of the present invention to facilitate understanding of the present invention by those skilled in the art. It should be understood that the present invention is not limited to the scope of the specific embodiments. Without departing from the spirit and scope of the present invention, any obvious changes such as equivalent transformations and simple substitutions based on the technical solutions of the present invention and all inventions and creations utilizing the concepts of the present invention are protected.
[0026] In the following examples, various processes and methods not described in detail are conventional methods known in the art. The primers used are indicated when they first appear, and the same primers used thereafter are the same as those first indicated.
[0027] Unless otherwise specified, the methods used in the following examples are all conventional methods. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent companies.
[0028] Example 1: Analysis of expression pattern of OsB12D3 gene in rice
[0029] 1. OsB12D3 gene sequence acquisition
[0030] This study focused on the effects of endosperm-dominantly expressed genes on rice quality. Therefore, based on the rice gene array expression database, a series of endosperm-specifically expressed genes were screened for functional analysis. Among them, one endosperm-dominantly expressed gene, OsB12D3, was identified. Its encoded protein consists of 96 amino acids (SEQ ID NO. 2), and its corresponding gene comprises 5443 nucleotides (SEQ ID NO. 1). Both the gene and amino acid sequence were derived from the genome of the rice variety Nipponbare (http: / / rice.plantbiology.msu.edu).
[0031] 2. Verification of OsB12D3 gene expression pattern
[0032] To verify the endosperm-dominant expression of the OsB12D3 gene, a pair of exon-spanning quantitative analysis primers were designed in the exon region of the OsB12D3 gene using the online software QuantPrime (https: / / quantprime.mpimp-golm.mpg.de / ). The primer sequences are as follows:
[0033] sequence name sequence Sequence number primer1 5'ATGATGTTGGCATCGGGCA3' SEQ ID NO.3 primer2 5'GCGCTTGCTGATCTTGACTT 3' SEQ ID NO.4
[0034] Using japonica rice Nipponbare as the material, different rice tissues (roots, stems, leaves, leaf sheaths and young panicles) and grains at different developmental stages (0, 5, 10, 15, 20, 25 and 30 DAF) were collected, and total RNA was extracted using a plant rapid RNA extraction kit (Novuba, FastPureUniversal Plant Total RNA Isolation Kit), and the first-strand cDNA was synthesized using a reverse transcription kit (Novuba, HiScript III RT SuperMix for qPCR). The expression level of OsB12D3 in different tissues was detected using a quantitative PCR kit (Novuba, ChamQ Universal SYBR qPCR Master Mix) and the above-mentioned quantitative PCR primers (SEQ ID NO.3 and SEQ ID NO.4). The test results are shown in Figure 2. Figure 1 As shown, this gene is only expressed during the grain filling period of rice, with the highest expression level 20 days after anthesis. It is an endosperm-specific gene, indicating that this gene may have very important biological significance in endosperm development.
[0035] Example 2: Construction of OsB12D3 gene knockout vector in rice and transgenic detection
[0036] 1. Gene Editing Site Design
[0037] In this study, based on the existing CRISPR / Cas9 related experimental methods, the GGCCGCGATGATGTTGGCATCGGG sequence containing GGG as the recognition site was selected as the knockout target site in the second exon of OsB12D3 (e.g. Figure 2 As shown in FIG, primers Primer3 and Primer4 (SEQ ID No. 5 and SEQ ID No. 6) were designed using the online tool targetDesign software (http: / / skl.scau.edu.cn / targetdesign / ) for gene editing vector construction.
[0038] The CRISPR primer sequences are as follows:
[0039] sequence name sequence Sequence number Primer3 5'GGCAGCCGCGATGATGTTGGCAT3' SEQ ID NO.5 Primer4 5'AAACATGCCAACATCATCGCGGC3' SEQ ID NO.6
[0040] 2. CRISPR / Cas9 vector construction and genetic transformation methods
[0041] The CRISPR / Csa9 vector system used in this study was provided by Researcher Wang Kejian from the China National Rice Research Institute. The system includes the intermediate vector SK-gRNA and the final vector pC1300-Cas9, whose DNA backbones are derived from the pBlueScript (SK+) vector and the pCAMBLA1300 vector, respectively.
[0042] Specific steps: primers primer3 and primer4 were diluted to 100 μM concentration, 10 μL of each primer was mixed and denatured at 100°C for 5 minutes, and then cooled naturally to obtain a double-stranded sequence containing the knockout target site; 7 μL of annealed primers were mixed with the linear intermediate vector SK-gRNA (100 ng) cut with AarI restriction endonuclease, and connected with T4 DNA ligase; Escherichia coli DH5α competent cells (Nanjing Novozymes Co., Ltd.) were taken out from -80°C and thawed on ice. After the cells were dissolved, the ligation product of the previous step was quickly added and gently mixed with a pipette. The cells were placed on ice for 30 min, then heat-shocked at 42°C for 30 s and placed on ice again for 2 min. Ten volumes of LB culture medium without antibiotics were then added to the transformed product and cultured at 37°C at 200 rpm for 50 min. The activated bacterial suspension was removed and centrifuged at 4000 rpm to remove most of the supernatant. The remaining liquid (about 100 μL) after suspension was spread on a plate (LB + ampicillin resistance) and cultured at 37°C overnight. The next day, a monoclonal colony was picked and expanded to 3 mL (LB + ampicillin resistance). The target site sequence was verified by sequencing using a dedicated sequencing primer for vector construction. Positive clones were selected and plasmids were extracted for later use.
[0043] The SK-gRNA-B12D3 plasmid was cut with restriction endonucleases Kpn I and Bgl II. The 300bp fragment was recovered and mixed with the pC1300-Cas9 vector, which had been double-digested with Kpn I and BamH I. The fragment was then ligated with T4 DNA ligase. The fragment was transformed into E. coli as in the previous step, and clones were selected for sequencing. The plasmid with the correct sequence was designated pC1300-Cas9-B12D3. The competent Agrobacterium EHA105 cells (Qingke Biotechnology Co., Ltd.) were taken out from -80°C and thawed on ice. 1 μL of the prepared positive clone plasmid was added, gently mixed, and placed on ice for 30 minutes. Then, they were frozen in liquid nitrogen for 2 minutes, quickly taken out and placed in a 37°C water bath to lyse the cells for 2 minutes. Then, 10 times the volume of LB anti-antibody culture medium was added to the transformation product, and the cells were cultured at 28°C and 250 rpm for 2-3 hours. The activated bacterial liquid was removed, centrifuged at 5000 rpm, and most of the supernatant was removed. The cells were resuspended with the remaining liquid (about 100 μL) and plated (LB + kanamycin). The cells were cultured at 28°C overnight for 36-48 hours. A single clone colony was picked for sequencing, and the positive strain was named Cas9-B12D3.
[0044] The positive Cas9-B12D3 Agrobacterium strain was used to transform rice Zhonghua 11 (ZH11) callus using the Agrobacterium-mediated transformation method for mature rice embryos (Liu Qiaoquan et al., Acta Physiologica Sinica, 1998). Successfully transformed callus cells were screened for hygromycin resistance and subsequently differentiated into positive transgenic rice seedlings. When the seedlings reached approximately 10 cm in height, they were tested and identified before transplanting to obtain T0 generation rice plants.
[0045] Example 3: Phenotypic Analysis of OsB12D3 Gene Knockout Strains
[0046] 1. Detection of genetically modified seedlings
[0047] A total of 30 seedlings were obtained by Agrobacterium infection and transformation. First, positive seedlings were screened with hygromycin detection primers. Then, sequencing primers primer5 (SEQ ID NO.7) and primer6 (SEQ ID NO.8) were designed upstream and downstream of the target site genomic sequence to detect mutations near the target site. After sequence amplification and sequencing analysis based on the target site, a total of two types of gene mutations were obtained (such as Figure 2 shown).
[0048] The sequencing primer sequences are as follows:
[0049] sequence name sequence Sequence number primer5 5'TAATGCCCGTCACAGATAAGG 3' SEQ ID NO.7 Primer6 5'TACTTGACTTCAGGGTTGGTG 3' SEQ ID NO.8
[0050] Phenotypic analysis of OsB12D3 gene knockout strains
[0051] In the T0 and T1 generation plantings, the agronomic traits of different strains were investigated and it was found that compared with the wild type Zhonghua 11, the knockout mutant line had no significant difference in agronomic traits except rice chalkiness. Subsequently, a stably inherited mutant line was obtained in the T2 generation, and three replicates were planted in the field, with two rows planted in each replicate, to further investigate the chalkiness of rice. The results showed that compared with the wild type Zhonghua 11, the chalkiness rate and chalkiness of the knockout mutant grains were significantly increased. This shows that OsB12D3 is a rice chalkiness regulatory gene (such as Figure 3 shown).
[0052] Example 4: Construction of OsB12D3 gene overexpression strain and phenotypic analysis
[0053] 1. Construction of OsB12D3 overexpression vector and acquisition of transgenic plants
[0054] The plant expression vector used in this study was Pc1300Actin-3*Flag (purchased from Shanghai Lianmai Company), which included the promoter of the rice's own constitutively highly expressed gene Actin.
[0055] The primer sequences for amplifying the OsB12D3 coding sequence are as follows
[0056] sequence name sequence Sequence number Primer7 5'TCCCCCGGGATGGGGCGTTGGGTTAGGCCT 3' SEQ ID NO.9 Primer8 5'GTCGACATCATCATTGTTCTCATCATGAT 3' SEQ ID NO.10
[0057] The specific steps involved using Nipponbare cDNA as a template and primers Primer7 and Primer8 to amplify the coding region of OsB12D3 (without the stop codon). Gene amplification was performed using the high-fidelity DNA polymerase Phanta Master (Novagen) on a PCR instrument. The PCR product was electrophoresed on a 1% agarose gel. The gel containing the target gene fragment was excised and recovered using a gel extraction kit (DP209 Tiangen). The recovered product was then mixed with the pC1300-Actin-3*Flag vector carrying the Actin promoter, which had been linearized with restriction endonucleases Sam I and Sal I. Homologous recombination ligation was performed using the ClonExpress Ultra One Step Cloning Kit (Novagen). The ligation product was transformed into competent Escherichia coli DH5α cells (Novagen, Nanjing) using the heat shock method. Transformed cells were plated on LB solid medium containing 100 mg / L ampicillin and cultured. Clones were selected for sequencing, and the correctly sequenced plasmid was named 3*Flag-B12D3. The vector 3*Flag-B12D3 was then transformed into japonica rice Zhonghua 11 using Agrobacterium-mediated transgenesis to obtain transgenic seedlings. The Agrobacterium transformation and rice genetic transformation methods were as described in Examples 2 and 3.
[0058] 2. Phenotypic Analysis of OsB12D3 Overexpressing Transgenic Plants
[0059] For the transgenic rice carrying the 3*Flag-B12D3 construct, homozygous lines were obtained from the T2 generation transgenic lines by hygromycin resistance screening. Subsequently, seeds of the homozygous lines were collected 15 days after flowering, and total RNA from the seeds was extracted and reverse transcribed into cDNA. The expression levels of the OsB12D3 gene in the homozygous lines were analyzed using the above-mentioned primers primer1 (SEQ ID NO. 3) and primer2 (SEQ ID NO. 4). Two lines with significantly upregulated expression levels were obtained for subsequent plant phenotypic analysis (e.g., Figure 4 Analysis of basic agronomic traits showed that during the growth and development of OsB12D3 overexpressing transgenic rice, there were no significant differences in plant height, tiller number, growth period, panicle length and grain shape compared with the parental control (data omitted), indicating that OsB12D3 overexpression had no significant effect on the growth and development of rice. The focus was on analyzing the appearance quality of rice in the B12D3 overexpressing lines. Compared with the wild type, the chalky grain rate and chalkiness of the OsB12D3 overexpressing lines were significantly reduced (as shown in Figure 2). Figure 5 This indicates that overexpression of OsB12D3 can improve the appearance quality of rice and has important breeding value for the genetic improvement of rice quality traits.
Claims
1. A gene that regulates chalkiness in rice OsB12D3 The application of the invention in reducing rice grain chalkiness and improving rice quality is characterized in that: Rice chalky gene OsB12D3 Overexpression of target rice varieties OsB12D3 The rice chalkiness gene is expressed in a variety of ways, thereby obtaining rice plants with different phenotypes. OsB12D3 The genomic nucleotide sequence is shown in SEQ ID NO. 1, OsB12D3 The encoded amino acid sequence is shown in SEQ ID NO. 2.