Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS and its encoded product and application

Abstract

The present invention belongs to the field of medicinal plant genetic engineering, and particularly relates to a Platycodon farnesyl pyrophosphate synthase gene PgFPPS and its encoded product and application, wherein the gene PgFPPS has a nucleotide sequence shown in SEQ ID NO.1, or the nucleotide sequence of the gene PgFPPS has a similarity of greater than 50% with the nucleotide sequence shown in SEQ ID NO.1. The Platycodon farnesyl pyrophosphate synthase PgFPPS gene provided by the present invention is cloned and prepared from Platycodon plant species for the first time, and the Platycodon farnesyl pyrophosphate synthase is a key gene for the biosynthesis of triterpenoid saponins, the main active ingredient of Platycodon, and provides a substrate for squalene synthase in the triterpenoid synthesis pathway. The enzyme can be used in the pathway of preparing farnesyl pyrophosphate with isopentenyl pyrophosphate and geranyl pyrophosphate as substrates. The gene provided by the present invention can be used to increase the content of triterpenoid saponins, the active ingredient of Platycodon, through genetic engineering technology.

Description

Technical Field

[0001] The invention belongs to the field of medicinal plant genetic engineering, and particularly relates to a Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS and a product encoded by the gene and application thereof. Background Art

[0002] Platycodon grandiflorum was first recorded in Shennong's Herbal Classic: "It tastes spicy and slightly warm. It is used to treat chest and flank pain like a knife stabbing, abdominal distension, rumbling in the intestines, panic and palpitations". Platycodon grandiflorum is a traditional Chinese medicine and food variety, and is also one of the ten famous Anhui medicines. It is mainly produced in Anhui, Shandong, Inner Mongolia and other regions. The 2020 edition of the Chinese Pharmacopoeia records that Platycodon grandiflorum is derived from the dried root of Platycodongrandiflorum (Jacq.) A.DC., a plant of the Campanulaceae family. It has the effects of clearing the lungs and relieving sore throat, removing phlegm and discharging pus. It is mainly used to treat cough with sputum, chest tightness, sore throat and hoarseness, and lung abscess with pus. Modern pharmacological studies have confirmed that Platycodon grandiflorum has a wide range of pharmacological effects, including anti-inflammatory, anti-tumor, anti-obesity, liver protection, etc. Its main active ingredient is triterpenoid saponins.

[0003] Triterpenoids are widely distributed in nature and are composed of six 5-carbon units (C30), which can be linked to carbohydrates to form triterpenoid saponins. Farnesyl pyrophosphate (FPP) is an important precursor of triterpenoids and sesquiterpenoids, and is generated by farnesyl pyrophosphate synthase (FPPS) catalyzing isopentenyl pyrophosphate (IPP) and its isomers dimethylallyl pyrophosphate (DMAPP) or geranyl pyrophosphate (GPP). As an important branch point in the biosynthetic pathway of triterpenoids and sesquiterpenoids, FPPS's activity directly affects the synthesis of triterpenoids and sesquiterpenoids in plants. At present, Platycodon farnesyl pyrophosphate synthase has not been reported, and the Platycodon farnesyl pyrophosphate synthase gene has not been isolated and identified. Summary of the invention

[0004] In view of the above problems, on the one hand, the present invention discloses a Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS, wherein the gene PgFPPS has a nucleotide sequence shown in SEQ ID NO.1, or the nucleotide sequence of the gene PgFPPS has a similarity of greater than 50% with the nucleotide sequence shown in SEQ ID NO.1.

[0005] On the other hand, the present invention also provides a product encoded by the Platycodon farnesyl pyrophosphate synthase gene PgFPPS,

[0006] The product has an amino acid sequence as shown in SEQ ID NO.2;

[0007] Or the amino acid sequence of the product has a similarity of greater than 50% with the amino acid sequence shown in SEQ ID NO.2.

[0008] Furthermore, the product includes any one of conservative variant polypeptides, active fragments or active derivatives having the same function as the amino acid of Platycodon grandiflorum farnesyl pyrophosphate synthase PgFPPS.

[0009] The invention also provides an expression vector containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS.

[0010] Preferably, the expression vector is pColdⅠ.

[0011] The present invention also proposes a recombinant plasmid containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS. The recombinant plasmid uses the cDNA of the PgFPPS gene as a template, and performs PCR amplification using an upstream primer shown in SEQ ID NO: 3 and a downstream primer shown in SEQ ID NO: 4; the PCR product and the expression vector are subjected to single enzyme digestion, recovered and purified, and connected to transform Escherichia coli to obtain the recombinant plasmid.

[0012] The invention also provides a recombinant engineering bacterium containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS.

[0013] The invention also provides a host cell containing a recombinant plasmid of the platycodon farnesyl pyrophosphate synthase gene PgFPPS.

[0014] The Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS, recombinant plasmid, recombinant engineering bacteria and / or host cell proposed by the invention can be used in the preparation of triterpenoid compounds.

[0015] The invention provides an application of the recombinant plasmid of the Platycodon grandiflorum farnesyl pyrophosphate synthase gene PgFPPS or a host cell containing the recombinant plasmid in genetic engineering.

[0016] Beneficial effects of the present invention:

[0017] The Platycodon farnesyl pyrophosphate synthase PgFPPS gene provided by the present invention is cloned and prepared from Platycodon plant species for the first time. Platycodon farnesyl pyrophosphate synthase is a key gene for the biosynthesis of triterpenoid saponins, the main active ingredient of Platycodon, and provides a substrate for squalene synthase in the triterpenoid synthesis pathway. The enzyme can be applied to the pathway of preparing farnesyl pyrophosphate with isopentenyl pyrophosphate (IPP) and geranyl pyrophosphate (GPP) as substrates. The gene provided by the present invention can be used to increase the content of triterpenoid saponins, the active ingredient of Platycodon, through genetic engineering technology.

[0018] Other features and advantages of the present invention will be described in the following description, and partly become apparent from the description, or understood by practicing the present invention. The purpose and other advantages of the present invention can be realized and obtained by the structures pointed out in the description, claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 The agarose gel electrophoresis diagram of the Platycodon farnesyl pyrophosphate synthase gene PgFPPS in Example 1 of the present invention is shown;

[0021] Figure 2 The structure and function domain prediction analysis of the Platycodon farnesyl pyrophosphate synthase gene PgFPPS in Example 2 of the present invention is shown;

[0022] Figure 3 The secondary structure analysis diagram of the Platycodon farnesyl pyrophosphate synthase gene PgFPPS in Example 2 of the present invention is shown;

[0023] Figure 4 The predicted diagram of the transmembrane domain of the Platycodon farnesyl pyrophosphate synthase gene PgFPPS in Example 2 of the present invention is shown;

[0024] Figure 5 The tertiary structure diagram of the Platycodon farnesyl pyrophosphate synthase gene PgFPPS in Example 2 of the present invention is shown;

[0025] Figure 6 The phylogenetic tree of the Platycodon farnesyl pyrophosphate synthase gene PgFPPS in Example 2 of the present invention is shown;

[0026] Figure 7 The SDS-polyacrylamide gel electrophoresis results of the PgFPPS protein in Example 4 of the present invention are shown;

[0027] Figure 8 The ion flow diagram of the standard farnesol in Example 5 of the present invention is shown;

[0028] Fig. 9 The standard mass spectrum of farnesol in Example 5 of the present invention is shown;

[0029] Fig.10 The total ion flow diagram of the products of isopentenyl pyrophosphate (IPP) and geranyl pyrophosphate (GPP) catalyzed by the PgFPPS protein in Example 5 of the present invention is shown;

[0030] Fig.11The mass spectrum of the peaks at retention time 18.989 min of isopentenyl pyrophosphate (IPP) and geranyl pyrophosphate (GPP) catalyzed by the PgFPPS protein in Example 5 of the present invention is shown;

[0031] Fig.12 The ion current diagram of the unloaded pColdⅠ standard in Example 5 of the present invention is shown;

[0032] Fig.13 The mass spectrum of the peak at retention time 18.989 min of the unloaded pColdⅠ in Example 5 of the present invention is shown. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] The technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0035] Reverse Transcription Kit PrimeScript TM II 1st Strand cDNA Synthesis Kit was purchased from TakaraBio; non-toxic 4S Green Plus nucleic acid dye was purchased from Shanghai Sangon Biotechnology Co., Ltd.; EasyPure Quick Gel Extraction Kit, T vector pEASY-Blunt Zero CloningKit, E. coli Rosetta (DE3) were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; high-fidelity enzyme Phusion, BamH I and other restriction endonucleases were purchased from New England Biotechnology (NEB) Beijing Co., Ltd.; primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; other reagents were imported or domestic analytical grade reagents.

[0036] Example 1 Cloning of Platycodon grandiflorum farnesyl pyrophosphate synthase PgFPPS gene

[0037] Cloning of PgFPPS using forward primer:

[0038] Upstream primer: P1: 5′ATGAGCGATCTGAAGTCAAAATTTC 3′;

[0039] Downstream primer: P2: 5'CTACTTTTGCCTTTTGTATATCTTT 3'.

[0040] PCR amplification was performed using the full-length sequence of the gene encoding farnesyl pyrophosphate synthase PgFPPS from Platycodon grandiflorum as a template.

[0041] The PCR reaction system was (50 μL): 1 μL template cDNA, 2.5 μL primers primer-F and primer-R, 25 μL Phusion High-Fidelity, and the remaining reaction volume was supplemented with sterile double distilled water. PCR reaction conditions: 98°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 2 min, 72°C extension for 5 min after 40 cycles, and storage at 4°C. The agarose gel electrophoresis diagram of the Platycodon farnesyl pyrophosphate synthase PgFPPS gene was obtained by agarose gel electrophoresis, as shown in the following figure. Figure 1 As shown, the size of the PCR amplification product was determined to be between 1000bp and 2000bp, which was consistent with the length of the target gene. Thus, the Platycodon grandiflorum farnesyl pyrophosphate synthase PgFPPS gene clone was obtained.

[0042] Example 2 Bioinformatics Analysis of PgFPPS Gene

[0043] The full-length cDNA of the farnesyl pyrophosphate synthase gene obtained by the present invention, the open reading frame (ORF) of the PgFPPS gene is 1026 bp in length, and its nucleotide sequence is shown in SEQ ID NO.1 in the sequence list, encoding 341 amino acids, and its amino acid sequence is shown in SEQ ID NO.2 in the sequence list. The PgFPPS gene sequence is searched for nucleotide homology in the Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translation+PDB+Swiss sprot+Superdate+PIR databases using the BLAST program in the NCBI database. The gene has a high homology with FPPS in other species at the amino acid level, and has a typical Isoprenoid_Biosyn_C1 superfamily domain, such as Figure 2 As shown; the protein secondary structure of PgFPPS gene was analyzed by online software NPS, and the results are shown Figure 3 As shown in Figure 2, the secondary structure of PgFPPS protein is composed of α-helix, extended chain and random coil; the transmembrane domain analysis of the protein sequence was performed using the online software TMHMM. The results are shown in Figure 2. Figure 4 As shown in Figure 2, PgFPPS has no transmembrane domain. The tertiary structure of PgFPPS protein was predicted by the online software SwissModel, as shown in Figure 2. Figure 5 As shown in Figure 1, the PgFPPS protein model 7bux.1.A has a score of 0.82 and a protein sequence similarity of 83.58%. The neighbor-joining phylogenetic tree was constructed using the software MEGA7, with 1000 bootstrap repetitions. Figure 6 As shown in the figure, PgFPPS and Asteraceae plants are clustered together and have a high genetic relationship.

[0044] Example 3 Construction of prokaryotic expression vector (recombinant plasmid)

[0045] Using the cDNA of the PgFPPS gene as a template, BamHI was selected as a single restriction site, and specific upstream primers and downstream primers (as shown in Table 1) were designed to perform PCR amplification reaction. The underlined part of the primer was the restriction site.

[0046] Table 1

[0047]

[0048]

[0049] The PCR reaction system was (50 μL): 1 μL template cDNA, 2.5 μL primers primer-F (P3) and primer-R (P4), 25 μL Phusion High-Fidelity, and the remaining reaction volume was supplemented with sterile double distilled water. PCR reaction conditions: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 2 min, 72℃ extension for 5 min after 40 cycles, and storage at 4℃. The amplified product was detected by 1% agarose gel electrophoresis and the gel was cut and recovered. The expression vector pColdⅠ plasmid was treated with BamH I and the gel was cut and recovered. The target fragment after gel cutting and the expression vector pColdⅠ were connected with the seamless splicing kit at 50℃ for 35 min, and the connection product was transformed into Escherichia coli Trans1-T1 competent cells, and the single clone was picked for bacterial liquid PCR positive test, sequencing and plasmid extraction. The recombinant plasmid pCol d-PgFPPS with the correct target sequence was saved for expression transformation.

[0050] Example 4 Induced expression of engineering bacteria

[0051] The target plasmid pCold-PgFPPS was used to transform E.coli Rosetta (DE3) competent cells, and the positive strain E.coli Rosetta (DE3)-PgFPPS containing the pCold-PgFPPS plasmid was cultured and screened. The strain contains the inducible PgFPPS recombinant gene with high efficiency expression. The positive clone E.coli Rosetta a (DE3)-PgFPPS was inoculated into LB culture medium containing Amp resistance at a ratio of 1:100, and cultured at 37°C, 200rpm shaking until A600 = 0.4-0.6, and a final concentration of 0.4mM IPTG was added to induce at 20°C overnight, and the pColdⅠ empty load was treated under the same conditions as a blank control. Take 1mL of bacterial solution and centrifuge to obtain the precipitate as the whole bacteria. Centrifuge the remaining bacterial solution to remove the supernatant to obtain the bacterial cells. Add 3-5mL Buffer A, resuspend, transfer to a 15mL centrifuge tube and place it in an ultrasonic disruptor. Ultrasonic disruption is effective for 5min (5s interval), 25% ultrasonic efficiency, and the centrifuge tube is inserted into a beaker filled with ice. The operation is carried out on ice. After the ultrasonic disruption lysate is centrifuged at 4℃ for 15min, the supernatant and precipitate are obtained, and 12% SDS-PAGE electrophoresis analysis is performed. The electrophoresis results are as follows: Figure 7 As shown in the figure, an obvious specific protein expression band appears at a molecular weight of about 40 kDA, which is consistent with the theoretical value. Lane M is the Protein Ruler Marker; Lane 1 is the whole E. coli Rosetta (DE3) containing the pColdⅠ empty vector; Lane 2 is the whole uninduced PgFPPS; Lane 3 is the whole induced PgFPPS; Lane 4 is the supernatant of the induced PgFPPS.

[0052] Example 5 In vitro enzyme function verification

[0053] 1. Preparation of purified protein: PgFPPS supernatant obtained in Example 5 was taken, 1 mL of supernatant was mixed with 500 μL of washed Ni-NTA Resin in a 2 mL centrifuge tube; placed in an ice box, shaken on an orbital shaker at 120 rpm for more than 1 h; centrifuged at 4°C, 500×g for 5 min, and the supernatant was discarded; 1 mL of Buffer A was added to resuspend, and the supernatant was discarded after centrifugation at 4°C, 500×g for 5 min, and the supernatant was discarded, and the process was repeated three times; 200 μL of Buffer B was added to elute, and the supernatant was centrifuged at 4°C, 500×g for 5 min, and the supernatant was discarded.

[0054] 2. PgFPPS enzyme function verification: IPP and GPP were used as reaction substrates for in vitro enzyme function verification. The reaction system was: 50 mM Tris HCl (pH 7.6), 100 μM IPP, 100 μM GPP, 5 mM MgCl 2, 25mM DTT, 10% glycerol and 385μL enzyme solution. Mix well, incubate at 30℃ overnight, and blow dry with a nitrogen blower. Add 2U calf intestinal alkaline phosphatase and 2U potato adenosine triphosphate diphosphatase, and incubate at 30℃ for 10h. Vortex extract 3 times with an equal volume of n-hexane, combine the extracts, concentrate to dryness in a vacuum, add 150μL n-hexane to re-dissolve, obtain the sample, take 1μL for injection, and use farnesol as the standard. GC-MS detection reaction GC-MS analysis conditions are: 40℃, 3min; 10℃ / min heating to 130℃; 50℃ / min heating to 230℃; 230℃, keep warm for 8min. The product was qualitatively analyzed, and the results showed that the retention time of the farnesol standard in GC was 18.989min, such as Figure 8 As shown, with m / z 69 [CH 3 (CH 3 )=CHCH 2 -] + , 222[M] + Characteristic ion peaks, such as Fig. 9 As shown. Fig.10 As shown, the sample also has a characteristic peak at the retention time of 18.989 min, such as Fig.11 As shown, the sample characteristic peak also has m / z69 [CH 3 (CH 3 )=CHCH 2 -] + , 222[M] + The characteristic ion peaks were also identified as farnesol. However, no corresponding characteristic peaks were detected in the empty vector control sample, and its chromatogram is shown in Fig.12 As shown in the mass spectrum Fig.13 Therefore, it can be determined that pCold-PgFPPS has the activity of catalyzing IPP and GPP to generate farnesyl pyrophosphate, and farnesyl pyrophosphate is hydrolyzed into farnesol under the action of phosphatase and detected.

[0055] The SEQ ID NO.1 and SEQ ID NO.2 mentioned in Example 2 are as follows: SEQ ID NO.1:

[0056]

[0057] SEQ ID NO.2:

[0058] Met Ser Asp Leu Lys Ser Lys Phe Leu Glu Val Tyr Ala Ser Leu Lys SerGlu Leu Leu Ala Asp Pro Ala Phe Glu Trp Thr Asp Asp Ser Arg Gln Trp Val GluArg Met Leu Asp Tyr Asn Val Pro GlyGly Lys Leu Asn Arg Gly Leu Ser Val ValAsp Ser Tyr Lys Leu Leu Lys Gly Glu Glu Leu Thr Asn Asp Glu Val Phe Leu AlaCys Ala Leu Gly Trp Cys Ile Glu Trp Leu Gln Ala Tyr Phe Leu Val Leu Asp AspIle Met Asp Ser Ser His Thr Arg Arg Gly Gln ProCys Trp Phe Arg Leu Pro LysVal Gly Leu Ile Ala Val Asn AspGly Ile Leu Leu Arg Asn His Ile Pro Arg IleLeu Lys Lys His Phe Arg Gly Lys Pro Tyr Tyr Val Asp Leu Leu Asp Leu Phe AsnGlu Val Glu Phe Gln Thr Ala Ser Gly Gln Met Ile Asp Leu IleThr Thr Leu ValGly Glu Lys Asp Leu Ser Lys Tyr Ser Leu SerTyr Ile His Arg Arg Ile Val GlnPhe Lys Thr Ala Tyr Tyr Ser Phe Leu Pro Val Ala Cys Ala Leu Leu Met Phe GlyGlu Asn Leu Asp Asn His Val Ala Val Lys Asp Ile Leu Ile Glu Met Gly Thr TyrPhe Gln Val Gln Asp Asp Tyr Leu Asp Asn Phe Gly Ala Pro Glu Val Ile Gly LysIle Gly Thr Asp Ile Glu Asp Phe LysCys Ser Trp Leu Val Val Lys Ala Leu GluLeu Ser Asn Glu Asp Gln Lys Lys Val Leu Asn Glu Asn Tyr Gly Lys Val Asp ProAla Cys Val Ala Lys Val Lys Glu Leu Tyr Asn Ala Leu Lys Leu Gln Asp Val PheAla Glu Tyr Glu Asn Lys Ser Tyr Glu Lys Leu Ile Ser Ser Ile Glu Ala His ProSer Lys Ala Val Gln Ala Val Leu Lys Ser Phe Leu Gly Lys Ile Tyr Lys Arg GlnLys

[0059] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent substitutions for some of the technical features therein; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A farnesyl pyrophosphate synthase gene from Platycodon grandiflorum PgFP , characterized in that, The gene PgFP The nucleotide sequence is shown in SEQ ID NO.

1.

2. A Platycodon grandiflorum farnesyl pyrophosphate synthase gene according to claim 1 PgFP Encoded amino acids.

3. A plant containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene according to claim 1. PgFP expression vector.

4. The Platycodon grandiflorum farnesyl pyrophosphate synthase gene according to claim 3 PgFP The expression vector is characterized in that The expression vector is pCold Ⅰ.

5. A plant containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene according to claim 1. PgFP The recombinant plasmid is characterized in that The recombinant plasmid PgFP The cDNA of the gene is used as a template, and PCR amplification is performed with the upstream primer shown in SEQ ID NO: 3 and the downstream primer shown in SEQ ID NO: 4; the PCR product and the expression vector are digested with a single enzyme, recovered and purified, and connected to transform Escherichia coli to obtain a recombinant plasmid.

6. A plant containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene as claimed in claim 1 PgFP of recombinant engineered bacteria.

7. A plant containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene as claimed in claim 5. PgFP The host cell of the recombinant plasmid is not a new species of animal or plant.

8. The Platycodon grandiflorum farnesyl pyrophosphate synthase gene according to claim 1 PgFP , the use of the recombinant plasmid according to claim 5, the recombinant engineered bacteria according to claim 6 and / or the host cell according to claim 7 in preparing triterpenoid compounds by catalyzing IPP and GPP to generate farnesyl pyrophosphate.

9. A plant containing the Platycodon grandiflorum farnesyl pyrophosphate synthase gene according to claim 5. PgFP Use of a recombinant plasmid or a host cell containing the recombinant plasmid of claim 7 in catalyzing IPP and GPP to generate farnesyl pyrophosphate.

Images