A method for increasing the loading amount of specific nucleic acid molecules in engineered cell exosomes and its application

Abstract

The present invention discloses a method and application thereof for increasing the loading capacity of specific nucleic acid molecules in engineered cell exosomes, discloses the engineering design principle of obtaining high-loading target nucleic acid exosomes by engineering cells, based on the autonomous docking of multiple bridging proteins L7Ae or its variants with RNA nucleic acid molecules containing C / D box sequences, and through the fusion protein (i.e., scaffold protein) constructed by the bridging protein L7Ae or / and its variants and exosome membrane proteins such as CD47, the RNA nucleic acid molecules are targeted and loaded into the exosomes. This method can effectively increase the loading capacity of exosomes for specific RNA nucleic acid molecules to be loaded, and provides an important theoretical and technical basis for the development of drugs using exosomes as nucleic acid drug delivery systems. The engineered exosomes produced by the present invention can carry a wide variety of nucleic acid drugs with strong functions, and have the versatility of RNA nucleic acid drug delivery.

Description

Technical Field

[0001] The present invention belongs to the field of exosomes as nucleic acid drug delivery carrier systems, and can be used to load nucleic acid drugs in various fields such as vaccines, regenerative medicine, and drug therapy. Specifically, it relates to a preparation method and application of engineered exosomes that can target and enrich nucleic acids containing specific sequences into exosomes. Background Art

[0002] Exosomes are cell-derived extracellular vesicles with membrane structures, with a diameter of 30-150nm. They are produced in multivesicular bodies (MVBs) and secreted into the extracellular fluid through the fusion of MVBs with cell membranes. At present, exosomes are considered to be extracellular vesicles secreted specifically by cells, mainly used for intercellular communication and participating in various life processes. Due to their high biocompatibility, bioavailability and ability to cross the blood-brain barrier, they are used as delivery carriers for nucleic acid drugs.

[0003] So far, exosomes have been successfully used to deliver small molecules, short RNAs, and proteins in vivo and in vitro. Compared with synthetic materials, exosome delivery systems have many advantages, such as their endogenous nature, stability, biocompatibility, nanosize, ability to cross the blood-brain barrier, and designability of components. Currently, the loading strategies using exosomes mainly include methods such as electroporation and transfection reagents, but there are problems such as low loading efficiency and influence on drug activity.

[0004] Recently, the engineering modification of exosomes has received extensive attention. This method can improve the controllability and loading efficiency of exosome loading to a certain extent. However, the limited vesicle space still affects the loading efficiency. How to improve the effective loading rate of exosomes and deliver drugs to the target in a targeted manner is a problem that needs to be solved.

[0005] The delivery system is the key to the function of nucleic acid drugs such as mRNA. It is responsible for delivering small molecule drug components intact to the target and releasing them at the right time and under the right environmental conditions. However, the delivery carrier needs to go through layers of protection of the human immune system and is prone to cause immune reactions such as allergies. The delivery system also largely determines the storage conditions and storage time limit of small molecule drugs. Currently, there are very few companies that have this technology, and there are patent protection barriers, which is one of the "bottleneck" problems including the mRNA vaccine industry.

[0006] Traditional nucleic acid drug delivery vehicles include synthetic lipid nanoparticles and viral vectors, which are currently used in the COVID-19 vaccines from BioNTech / Pfizer and Oxford / AstraZeneca, respectively, as well as many protein, RNA, and gene therapies. But both methods have significant limitations, including the areas of the body they can reach, the number of cells within a tissue they can reach, and their ability to avoid triggering harmful immune responses.

[0007] Exosomes are endogenous lipid nanoparticles that are similar to synthetic nanoparticles in size and function. As natural endogenous transport carriers, they have the advantages of low toxicity, no immunogenicity, long half-life, good permeability and the ability to cross biological barriers such as the blood-brain barrier (BBB). Exosomes also play a key role in mediating intercellular communication and regulating immune responses. In addition, studies have shown that exosomes have innate homing ability due to homologous surface adhesion proteins, mRNA, DNA and lipid molecules from their parent cells. More importantly, the expression of CD47 (a transmembrane protein) on the surface of exosomes is conducive to avoiding immune clearance by the mononuclear macrophage system (MPS) and prolonging blood circulation time. More importantly, compared with other delivery methods such as viral vectors and lipid nanoparticles, a key advantage of exosomes is that they can accurately deliver payloads without activating the innate or acquired immune system, so patients will not develop immunity to the delivery vehicle after the first treatment, which makes repeated dosing easier.

[0008] At present, the loading strategies of exosomes mainly include electroporation and transfection reagents, which have some problems, including low loading efficiency (loading efficiency 10-40%), damage to exosome structure and activity, and influence on drug activity. Recently, there are also designs for engineering exosomes, which improve the controllability and loading efficiency of exosome loading to a certain extent. However, further improving the loading efficiency of exosomes within the limited vesicle space is still an urgent problem to be solved. Summary of the invention

[0009] The purpose of the present invention is to provide a method and application thereof for increasing the loading capacity of specific nucleic acid molecules in cell exosomes. Based on the autonomous docking of L7Ae-C / D box, nucleic acids are successfully loaded onto a fusion protein (i.e., scaffold protein) composed of exosome membrane protein CD47 and L7Ae and its variants by screening exosome membrane proteins, and a high-load exosome-nucleic acid loading system based on exosome membrane protein CD47-LAe (n) is established. At the same time, the protein structure of CD47 and the structure of L7Ae are deeply analyzed, and the loading efficiency of the loading system is successfully improved by structural optimization, and a new high-load exosome-nucleic acid loading system based on P4 scaffold protein (CD47-L7Ae (n)) is established.

[0010] In order to solve the above technical problems, the first aspect of the present invention adopts the following technical scheme: a high-load exosome-nucleic acid loading system, comprising a scaffold protein expression plasmid for exosome loading nucleic acid and a specific nucleic acid sequence expression plasmid to be loaded;

[0011] The scaffold protein expression plasmid for exosome loading nucleic acid contains a coding sequence of an exosome membrane protein and a coding sequence of at least one bridging protein L7Ae or a variant thereof;

[0012] The specific nucleic acid sequence expression plasmid to be loaded includes a specific nucleic acid molecule to be loaded and a special sequence directly or indirectly connected to the specific nucleic acid molecule to be loaded, wherein the special sequence is a C / D box and its functional derivative sequence (i.e., a C / D box derivative sequence having the same function as the C / D box), and the special sequence is autonomously docked with L7Ae or / and its variants.

[0013] The specific nucleic acid molecule to be loaded is RNA, such as mRNA, circRNA and lncRNA.

[0014] Preferably, the scaffold protein, i.e., the exosome membrane protein, is fused with multiple bridging proteins L7Ae or / and its variants in series to form an exosome membrane protein-L7Ae(n) fusion protein, the exosome membrane protein-L7Ae(n) fusion protein is the scaffold protein, and n is the number of L7Ae and its variants; the exosome nucleic acid is loaded with a scaffold protein expression plasmid and a specific nucleic acid sequence expression plasmid to be loaded, and the specific nucleic acid molecule to be loaded is loaded into the exosome by co-transfection. The special sequence is a C / D box sequence or a derivative sequence with the same function, which can specifically recognize and bind to the L7Ae protein and its variants.

[0015] The scaffold protein is an exosome membrane protein such as CD63, CD47, CD9 and CD81 or a variant thereof.

[0016] Preferably, the specific nucleic acid sequence expression plasmid to be loaded also includes a specific nucleic acid molecule and a C / D box sequence connected to each other. In actual pharmaceutical applications, it is only necessary to connect the specific nucleic acid molecule to be loaded with the C / D box sequence, without adding EGFP or its equivalent analogs (only for fluorescent labeling).

[0017] The exosome membrane protein and the bridging protein L7Ae (or its variant) are connected by a flexible connector; when more than one of the bridging proteins L7Ae or their variants form a concatemer, the exosome membrane protein and the first bridging protein L7Ae (or its variant) are connected by a flexible connector. In order to reduce the mutual interference between the bridging proteins and the loaded nucleic acids, the first bridging protein and the second bridging protein and the subsequent bridging proteins are connected by a rigid connector, for example, the first bridging protein and the second bridging protein are connected by a rigid connector, the second bridging protein and the third bridging protein are connected by a rigid connector, and so on.

[0018] The variant of the bridging protein L7Ae refers to the L7Ae variant (i.e., L7Ae_delC21) obtained by removing 21 amino acids (the entire α helix) from the carboxyl terminus of the wild-type L7Ae (i.e., L7Ae-WT), or other variants of L7Ae that can reduce steric hindrance, such as truncations or mutants of other lengths.

[0019] Preferably, the flexible linker includes but is not limited to GSSS, GSSSGSSSGS or GGS, and the rigid linker includes but is not limited to PWRPWRP or PWRP, and may also be other flexible or rigid linkers; in an exosome-loaded nucleic acid scaffold protein expression plasmid, when more than one bridging protein L7Ae or its variants form a concatemer, the flexible linker and / or rigid linker is more than one or only one sequence, and the bridging protein L7Ae or its variants is more than one or only one sequence.

[0020] Furthermore, the specific nucleic acid molecule to be loaded is an RNA nucleic acid drug molecule or an RNA nucleic acid molecule.

[0021] Furthermore, the specific nucleic acid molecules to be loaded are nucleic acid sequences encoding vaccine antigens, anti-tumor nucleic acid drugs, nucleic acid antibody drugs and other nucleic acid molecules encoding various growth factors, antibodies and proteins.

[0022] More specifically, the specific nucleic acid molecule to be loaded is a nucleic acid sequence encoding EGF, a nucleic acid sequence encoding insulin, or a nucleic acid molecule of other growth factors.

[0023] In one embodiment, the C / D box sequence is as shown in SEQ ID NO. 17 or a functionally equivalent derivative sequence thereof.

[0024] A second aspect of the present invention is to provide a method for increasing the loading of specific nucleic acid molecules in exosomes, comprising the following steps:

[0025] Constructing a scaffold protein expression plasmid for exosome-loaded nucleic acid and a specific nucleic acid sequence expression plasmid to be loaded; the scaffold protein expression plasmid for exosome-loaded nucleic acid contains a coding sequence of an exosome membrane protein and a coding sequence of at least one bridging protein L7Ae or a variant thereof; the specific nucleic acid sequence expression plasmid to be loaded includes a specific nucleic acid molecule to be loaded and a C / D box sequence directly or indirectly connected to the specific nucleic acid molecule to be loaded;

[0026] The scaffold protein expression plasmid for loading nucleic acid on exosomes and the expression plasmid of the specific nucleic acid sequence to be loaded are co-transfected into cells, and the exosome membrane protein is fused with the bridging protein L7Ae or its variant to form a fusion protein (i.e., scaffold protein), wherein the C / D box is autonomously docked with L7Ae or / and its variant, so that the specific nucleic acid molecule to be loaded is loaded into the exosome through the fusion protein, and the exosome is secreted outside the cell while carrying the specific nucleic acid molecule outside the cell;

[0027] Exosomes containing specific nucleic acid molecules were enriched from cell culture supernatants.

[0028] Preferably, the specific nucleic acid molecule is loaded into the exosomes by transient transfection or construction of a stable cell line; the specific nucleic acid molecule is an RNA nucleic acid drug or an RNA nucleic acid molecule.

[0029] The third aspect of the present invention is to provide a nucleic acid drug or nucleic acid molecule comprising the aforementioned high-load exosome-nucleic acid loading system.

[0030] Preferably, a nucleic acid vaccine, a nucleic acid antibody drug, an anti-tumor drug, a nucleic acid molecule for gene therapy or tumor cell therapy, or a regenerative medicine drug comprising the aforementioned high-load exosome-nucleic acid loading system is provided.

[0031] The fourth aspect of the present invention is to provide the use of a high-load exosome-nucleic acid loading system in the preparation of nucleic acid drugs.

[0032] Preferably, the nucleic acid drug is used in the fields of nucleic acid vaccines, anti-tumor, gene therapy, cell therapy or regenerative medicine.

[0033] Based on the autonomous docking of L7Ae protein or its variants with nucleic acid drugs containing C / D box sequences, and through the fusion expression of L7Ae protein or its variants with exosomal membrane proteins such as CD47, nucleic acid drugs are targeted and loaded into exosomes.

[0034] A method for increasing the loading of a specific nucleic acid drug in exosomes of engineered cells, the method comprising:

[0035] 1) A nucleic acid molecule containing a specific sequence to achieve targeted enrichment of exosomes.

[0036] 2) Scaffold proteins, which are assembled into exosomes during exosome biogenesis.

[0037] 3) Bridging protein, which is fused with exosome membrane protein and can bind to specific sequences on nucleic acid molecules, ultimately achieving targeted enrichment of nucleic acid drugs in exosomes.

[0038] 4) The GSSS flexible linker fused to the exosome membrane protein and the first bridge protein, and the flexible linker GSSSGSSSGS or the rigid linker PWRPWRP between the second bridge protein and the subsequent L7Ae variants. The rigid linker PWRPWRP can maintain a better spatial structure between multiple bridge proteins, reduce the steric hindrance between the bridge proteins and the loaded nucleic acids, thereby enhancing the loading efficiency and stability of the bridge protein and the nucleic acid molecule; the flexible linker GSSSGSSSGS causes the connected L7Ae to swing or fold and bend, thereby increasing the steric hindrance, resulting in low nucleic acid loading efficiency and loading capacity.

[0039] 5) Structural modification of scaffold proteins and bridging proteins. The structure can enhance the binding of bridging proteins to specific sequences on nucleic acid molecules through multiple series of bridging proteins, ultimately increasing the loading capacity of exosomes for nucleic acid drugs.

[0040] Design a nucleic acid drug sequence containing a C / D box and construct the corresponding plasmid.

[0041] Design a fusion protein of an exosomal membrane protein and L7Ae or its variants (ie, a scaffold protein), for example, P1, P2, P3, P4, and construct the corresponding plasmid.

[0042] The plasmid is transfected into cells, such as HEK293T (abbreviated as 293T), HEK293F (abbreviated as 293F), stem cells or immune cells or other eukaryotic cells, by transfection reagent or electroporation to establish a stable cell line or simply achieve the purpose of transient transfection.

[0043] When cells transfected with the above plasmids produce exosomes, nucleic acid molecules containing specific sequences will be enriched into exosomes through fusion protein expression plasmids P1, P2, P3 and P4. When the exosomes are secreted outside the cells, these nucleic acid molecules will be carried outside the cells. When the exosomes carrying the target nucleic acid molecules are phagocytosed by the recipient cells, the exosome cargo is released from the exosomes by the recipient cells and exerts its function.

[0044] Exosomes are enriched from cell supernatants by ultracentrifugation or molecular sieve methods.

[0045] 1) Extract total RNA from exosomes and detect whether nucleic acid molecules are enriched in exosomes by qPCR.

[0046] 2) Add the enriched exosomes to the culture supernatant of recipient cells, such as 293T, 293F, stem cells or immune cells or other eukaryotic cells, and detect the expression of mRNA or the regulation of nucleic acids such as miRNA.

[0047] Compared with the prior art, the advantages of the present invention are: it can increase the loading capacity of targeted nucleic acid drugs in engineered cell exosomes; it can load nucleic acid drugs of different sequences; and it can be implemented in different cell lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 is the cell fluorescence image for plasmid verification;

[0049] Figure 2 It is the quantitative result of luciferase reporter gene assay, through which CD47-L7Ae scaffold protein was screened;

[0050] Figure 3 It is the quantitative result of luciferase reporter gene assay, through which P4 scaffold protein was screened;

[0051] Figure 4 is the cell fluorescence image for plasmid verification;

[0052] Figure 5 is the qPCR result;

[0053] Figure 6 is the plasmid map of P1;

[0054] Figure 7 is the plasmid map of P2;

[0055] Figure 8 is the plasmid map of P3;

[0056] Fig. 9 This is the plasmid map of P4. DETAILED DESCRIPTION

[0057] The present invention will be further described in detail below in conjunction with the embodiments and drawings, but they are not intended to limit the scope of the present invention.

[0058] The relevant nucleic acids used in the present invention were synthesized by Bioengineering (Shanghai) Co., Ltd. P1, P2, P3 and P4 sequences were synthesized by Bioengineering (Shanghai) Co., Ltd. Transfection reagent: Polyethylenimine was purchased from Sigma; lipofectamine3000 was purchased from ThermoFisher. Luciferase Reporter Gene Assay Kit Firefly luciferase reporter gene detection kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. RNA extraction kit MiniBESTUniversal RNA Extraction Kit was purchased from TaKaRa, and HiScript III 1st Strand cDNASynthesis Kit reverse transcription kit was purchased from Novazon. Premix Ex Taq TM II qPCR kit was purchased from TaKaRa.

[0059] The experimental principle of the following embodiment is based on the autonomous docking of the bridging protein L7Ae protein with the C / D box. The present invention connects the membrane protein of the exosome with the bridging protein L7Ae, and at the same time connects the nucleic acid molecule to be loaded with the C / D box. Through the autonomous docking of the bridging protein L7Ae with the C / D box, the nucleic acid molecule to be loaded can be loaded onto the exosome. The specific experimental operation method is to co-transfect the cell with the scaffold protein expression plasmid containing the bridging protein L7Ae and the specific nucleic acid sequence expression plasmid to be loaded containing the C / D box. After the transfection is successfully verified, the supernatant of the exosome containing the loaded nucleic acid molecule is enriched. The supernatant of the enriched exosome is then added to the new recipient cells for cell culture (wherein the nucleic acid molecule loaded in the exosome is a preset mRNA, circRNA and / or lncRNA carrying a C / D box or a derivative sequence with the same function). The recipient cells are recovered for verification and quantification. If the loading is successful, the recipient cells will absorb the exosomes in the supernatant and express the exosome-loaded nucleic acid drug.

[0060] Example 1: Screening of scaffold proteins for exosome nucleic acid loading

[0061] (1) Screening using GFP fluorescence

[0062] Construct a scaffold protein plasmid containing L7Ae and a C / D box-GFP expression plasmid. After the plasmid is constructed, prepare 293T cells in a 24-well plate, co-transfect the scaffold protein plasmid containing L7Ae and the C / D box-GFP plasmid, remove the supernatant and replace it with a medium without exosome serum for continued culture. The culture conditions are 37°C and 5% CO 2, 24h microscope observation, green fluorescence was observed, such as Figure 1 As shown in 1A, the plasmid co-transfection was successful. The supernatant of the culture medium after 34 hours of enrichment culture was collected and centrifuged at 300×g for 5 minutes. The supernatant was transferred to a new 1.5mL tube and centrifuged again at 2000×g for 5 minutes. The supernatant was added to the 293T recipient cells in a new 24-well plate. After 48 hours, the fluorescence was observed under a microscope. Weak green fluorescence was observed in the co-transfection group of CD47-L7Ae scaffold protein plasmid and C / D box-GFP plasmid, as shown in Figure 1A. Figure 1 As shown in Figure 1B, there was no fluorescence in the 293T blank control group and the C / D box-GFP plasmid transfection group alone. At the same time, weak green fluorescence was observed in the co-transfection group with other scaffold proteins. The experimental results prove that CD47-L7Ae can be used as a scaffold protein for loading exosomes, but the fluorescence of GFP in this experiment is relatively weak, and only a few cells can be observed to emit light, so the exosome content in the supernatant is increased to increase the fluorescence intensity of the recipient cells.

[0063] The inability to accurately measure fluorescence intensity is a problem in this experiment, so the plasmid was improved on the basis of this experiment, and the GFP part in the C / D box-GFP plasmid was converted into a Luciferase reporter gene. The Luciferase reporter gene system is an experiment that uses luciferin as a substrate to detect the activity of firefly luciferase. The luciferin substrate will emit light (wavelength 540-600nm) under the action of luciferase, and the light intensity can reflect the expression level of luciferase.

[0064] (2) Screening using Luciferase reporter gene

[0065] After the GFP part of the C / D box-GFP plasmid sequence was converted to the Luciferase reporter gene, the plasmid was constructed and the screening experiment of the scaffold protein was performed again. 293T cells in a 6-well plate were prepared for plasmid co-transfection. After removing the supernatant, the medium without exosome serum was replaced and continued to be cultured. The culture conditions were 37°C and 5% CO 2 , the supernatant of the culture medium after 34h of enrichment culture was collected, centrifuged at 300×g for 5min, transferred to a new 1.5mL tube, centrifuged again at 2000×g for 5min, added to the 293T recipient cells in a new 24-well plate, and the cells were collected for luciferase activity detection after 48h. The results of luciferase activity detection showed that the co-transfection group of CD47-L7Ae scaffold protein plasmid and C / D box-Luc plasmid was higher than that of the 293T blank control group and the C / D box-Luc plasmid alone transfection group, such as Figure 2The experimental results show that CD47-L7Ae can be used as a scaffold protein for loading exosomes.

[0066] Although the experimental results showed that CD47-L7Ae can be used as a scaffold protein for loading exosomes, its loading efficiency is not very high. In order to improve its loading efficiency, we conducted in-depth analysis and modification of the CD47-L7Ae structure.

[0067] Example 2: Structural optimization and verification of scaffold protein

[0068] (1) Modification of the structure of the scaffold protein and the bridging protein L7Ae

[0069] In order to improve the nucleic acid drug loading efficiency of exosomes, the present invention has conducted in-depth analysis and modification of the structures of the exosomal membrane protein CD47 and the bridging protein L7Ae, and designed a new GSSS flexible linker for the connection method of the two proteins. At the same time, by modifying the structure of the bridging protein L7Ae, a concatemer composed of multiple bridging proteins was realized. Four plasmids P1, P2, P3 and P4 were designed, and the plasmids included CD47 exosomal membrane protein, GSSS flexible linker and bridging protein L7Ae. In order to better connect the two proteins, the present invention designed a rigid linker sequence of PWRPWRP and applied it to the P4 plasmid. The maps of the four plasmids are as follows: Figure 6-9 As shown, the following are the amino acid sequences of the scaffold proteins expressed by the four plasmids respectively.

[0070] P1 scaffold protein amino acid sequence (CD47-GSSS-1×L7Ae-WT sequence, in which the italic part is the GSSS flexible linker sequence, and the capital letters are amino acid abbreviations, SEQ ID NO.1)

[0071]

[0072] P2 scaffold protein amino acid sequence (CD47-GSSS-1×L7Ae-del-C21 sequence, where the italic part is the GSSS flexible linker sequence, and the capitalized parts are amino acid abbreviations, SEQ ID NO.2)

[0073]

[0074] P3 scaffold protein sequence (CD47-GSSSGSSSGS×3-3×L7Ae-WT sequence, in which the italic part is the GSSSGSSSGS flexible linker sequence, and the capitalized parts are amino acid abbreviations, SEQ ID NO.3)

[0075]

[0076] P4 scaffold protein sequence (CD47-GSSS-2×L7Ae_delC21-1×L7Ae-WT sequence, in which the italic part is the GSSS flexible linker sequence and the PWRPWRP rigid linker sequence, and the capitalized parts are amino acid abbreviations, in which the first two bridge proteins are L7Ae_delC21, the third bridge protein is L7Ae-WT, CD47 is connected to the first bridge protein through GSSS, the first bridge protein is connected to the second bridge protein through PWRPWRP, and the second bridge protein is connected to the third bridge protein through PWRPWRP, corresponding to SEQ ID NO.4)

[0077]

[0078] The method for constructing the P1-P4 plasmid is: inserting the nucleotide sequences encoding the above-mentioned P1-P4 scaffold proteins into the target vector pCDNA3(+), wherein the 5' end of the nucleotide sequence encoding the above-mentioned P1-P4 scaffold proteins is added with the nucleic acid sequence AAGCTT (restriction site), and the 3' end is added with the nucleic acid sequence GAATTC (restriction site).

[0079] (2) Verification and screening using Luciferase reporter gene

[0080] Plasmids (such as Figure 6-9 After the construction was completed, 293T cells cultured in 6-well plates were co-transfected with P1, P2, P3 and P4 membrane protein-L7Ae fusion scaffold protein plasmids and C / D box-Luc plasmids, and then replaced with medium without exosome serum for continued culture at 37°C and 5% CO 2 , the supernatant of the culture medium after 34h of enrichment culture was collected, centrifuged at 300×g for 5min, the supernatant was transferred to a new 1.5mL tube, centrifuged once at 2000×g for 5min, and the supernatant was added to the 293T recipient cells in a new 24-well plate. After 48h of culture, the cells were recovered for luciferase activity detection. The results of luciferase activity detection showed that the co-transfection group of the newly constructed P1 and P4 plasmids and the C / D box-Luc plasmid significantly improved the loading efficiency of exosomes, such as Figure 3 As shown. In particular, the loading efficiency of the P4 group was increased by about 3 times compared with the control group, of which the CD47-L7Ae (i.e., the plasmid corresponding to the fusion protein formed by CD47 directly with a wild-type L7Ae) and the C / D box-Luc group were the control group, and the 293T group was the blank control group. The experimental results prove that the newly constructed P4 can be used as a scaffold protein (i.e., the exosome membrane protein CD47-L7Ae (n) fusion protein, where n is 3) for the loading of exosomes.

[0081] Example 3: P4 enriches mRNA of nucleic acid drugs linked to C / D box in exosomes

[0082] After screening the strong scaffold protein P4 at the cell protein level, the present invention detected the ability of P4 to enrich the nucleic acid drug in the exosomes by qPCR. The preparation and application of the engineered exosomes involved in this embodiment mainly include the following steps:

[0083] (1) Plasmid design of nucleic acid drugs and protein expression of nucleic acid drugs:

[0084] The present invention designs two nucleic acid drug plasmids, one of which is an amino acid sequence of insulin connected to EGFP protein, and a C / D box sequence is added after the stop codon (I01-EGFP-C / D box, p458); the other is an IL-2 signal peptide connected to Flag-EGF and EGFP, and a C / D box sequence is added after the stop codon (E01-EGFP-C / D box, p459).

[0085] I01-EGFP-C / D box sequence (the bold is the I01 sequence, the I01 sequence is the insulin amino acid sequence, the italic part is the EGFP (enhanced green fluorescent protein) amino acid sequence, and the capital letters are amino acid abbreviations. Among them, SEQ ID NO.5 is the amino acid sequence of the insulin and EGFP fusion protein. When constructing the plasmid, the C / D box sequence is immediately followed by the insulin-EGFP fusion protein CDS sequence, SEQ ID NO.17)

[0086]

[0087] When constructing the corresponding plasmid, the nucleic acid sequence encoding insulin, the nucleic acid sequence encoding EGFP protein, the stop codon, and the C / D box sequence are connected in sequence. The nucleic acid sequence encoding EGFP protein is followed by the stop codon, and the C / D box sequence is followed by the stop codon. The C / D box sequence is 5'gggcgtgatccgaaaggtgaccc3' (SEQ ID NO.17).

[0088] The sequence of E01-EGFP-C / D box (the uppercase and underlined ones are the IL2 signal peptide sequence, the bold and italic sequences are is the Flag sequence, the bold is the E01 sequence, E01 is the EGF (epidermal growth factor) sequence, the italic non-bold part is the EGFP sequence, and the capital letters are amino acid abbreviations, where SEQ ID NO.6 is the amino acid sequence of the EGF and EGFP fusion protein. When constructing the plasmid, the EGF-EGFP fusion protein CDS sequence is followed by a C / D box sequence, SEQ ID NO.17)

[0089]

[0090] When constructing the corresponding plasmid, the nucleic acid sequence encoding the IL2 signal peptide, the nucleic acid sequence encoding the Flag, the nucleic acid sequence encoding the EGF, the nucleic acid sequence encoding the EGFP protein, the stop codon and the C / D box sequence are connected in sequence. The nucleic acid sequence encoding the EGFP protein is followed by the stop codon, and the C / D box sequence is followed by the stop codon. The C / D box sequence is 5'gggcgtgatccgaaaggtgaccc3' (SEQ ID NO.17).

[0091] Among them, the amino acid sequence of CD47 is shown in SEQ ID NO.18, the amino acid sequence of L7Ae-del-C21 is shown in SEQ ID NO.19, the amino acid sequence of L7Ae-WT is shown in SEQ ID NO.20, and the amino acid sequence of EGFP is shown in SEQ ID NO.21.

[0092] The present invention first verified the expression of two plasmids in 293T cells, such as Figure 4 As shown. 24 hours after 293T cells were transfected with Lipo3000 reagent, we observed the expression of EGFP under a fluorescence microscope. The experimental results show that the nucleic acid drug sequence can normally express the corresponding target protein.

[0093] (2) RT-qPCR verification of target mRNA loading in P4-mediated exosomes

[0094] The samples were divided into the following 6 groups: P458 group, P459 group, P458+P1 group, P458+P4 group, P459+P1 group and P459+P4 group. The constructed scaffold protein plasmids (P1 and P4) were co-transfected with the target nucleic acid plasmids carrying C / D box (P458 and P459) into suspension cultured 293F cells by PEI. The cell density before transfection was 1×10 6 / mL, prepare two bottles of T75 cells for each group for the experiment. Take group c as an example for the cell transfection experiment: first prepare solution A: use a pipette to add 10μgp458+10μg p1 (about 20μg in total) plasmid to a 1.5mL sterile centrifuge tube, then use a pipette to draw 375μL of Opti-MEM into the centrifuge tube, use a pipette to gently mix with a pipette, and let it stand at room temperature for 5min. While preparing solution A, prepare solution B, use a pipette to add 37.5μL of PEI (final concentration: 1μg / μL) to 375μL Opti-MEM, gently blow and mix, and let it stand at room temperature for 5min. Use a 1mL pipette to add solution B to solution A, mix gently, and let it stand at room temperature for 20min. After 5h of transfection, replace with fresh complete culture medium and continue cell culture. The culture conditions are 37°C and 5% CO 2 In order to increase the content of exosomes in the supernatant, the cells were cultured for about 50 hours. After 50 hours of cell culture, the cell suspension was transferred to a 50 mL centrifuge tube and centrifuged at 3,000 × g for 30 minutes. The supernatant was transferred to the Enze Kangtai SEC column, and the exosomes in the supernatant were separated and purified using the SEC column.

[0095] It is necessary to perform quantitative analysis of the mRNA in the enriched exosomes by qPCR. First, use an RNA kit to extract the mRNA in the exosomes, then use a reverse transcription kit to reverse transcribe the mRNA into cDNA, and finally perform relative quantification of the mRNA by fluorescent quantitative PCR experiment. The specific operation process is as follows:

[0096] a) Removal of genomic DNA

[0097] Table 1 shows the reaction system. Reaction conditions: 42°C, 2 min; stored at 4°C;

[0098] Table 1 Genomic DNA removal system

[0099] Components volume RNA(<5μg) 8μL 5×gDNA wiper Mix 2μL

[0100] b) Reverse transcription

[0101] Table 2 shows the reaction system. The reaction conditions are: 37°C, 15 min; 85°C, 5 s; stored at 4°C;

[0102] Table 2 Reverse transcription system

[0103] Components volume The reaction solution of the above steps 10μL 10×RT Mix 2μL HiScript III Enzyme Mix 2μL <![CDATA[Oligo(dT) 20 VN]]> 1μL Random hexamers 1μL RNase Free dH2O 4μL

[0104] c) qPCR detection

[0105] h-GAPDH was used as an internal reference, and the primer sequences were referred to Table 3 (corresponding to SEQ ID NOs. 7-16 in sequence);

[0106] Table 3 Primer information

[0107]

[0108]

[0109] Table 4 shows the reaction system, reaction conditions: 95°C for 10 min; 95°C for 10 s, 60°C for 30 s (45 cycles); 4°C for 10 min;

[0110] Table 4 qPCR system

[0111] Components volume 2×SYBR green 10μL Primer F (10uM) 0.4μL Primer R (10uM) 0.4μL cDNA template 2μL <![CDATA[RNase Free-H 2 The]]> 7.2μL

[0112] The qPCR results showed that co-transfection of the C / D box and the plasmid encoding the scaffold protein P4 could significantly enhance the loading amount of the target protein mRNA carrying the C / D box in the exosomes, which was the same as the screening results at the cellular protein level, e.g. Figure 5 As shown, the P458 and P459 groups were control groups, and the 293F group was a blank control group.

[0113] The present invention achieves the effect of increasing the loading capacity of the exosomes of the engineered cells for specific nucleic acid molecules by directing engineering transformation of the cells. The present invention discloses the engineering design principle of obtaining high-load target nucleic acid exosomes by engineering transformation of cells, based on the autonomous docking of multiple L7Ae proteins or / and their variants with the nucleic acid to be loaded containing the C / D box sequence, and through the fusion protein constructed by the bridge protein L7Ae or / and its variants and the exosome membrane protein such as CD47, the nucleic acid drug is targeted and loaded into the exosome. This method can effectively increase the loading capacity of exosomes for specific nucleic acids to be loaded, and provides an important theoretical and technical basis for the development of drugs in the directions of nucleic acid vaccines, anti-tumor drugs, nucleic acid antibody drugs, cell therapy and regenerative medicine using exosomes as nucleic acid drug delivery systems. The engineered exosomes produced by the present invention can carry a wide variety of nucleic acid drugs, strong functions, and have the versatility of nucleic acid drug delivery.

[0114] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the essential scope of the present invention shall also fall within the protection scope of the present invention, and the protection scope of the present invention shall be subject to the claims.

Claims

1. A high-load exosome-nucleic acid loading system, characterized in that: Including scaffold protein expression plasmid for exosome loading nucleic acid and specific nucleic acid sequence expression plasmid to be loaded; The scaffold protein expression plasmid for exosome loading nucleic acid contains the coding sequence of the exosome membrane protein and the coding sequence of at least one bridging protein L7Ae or / and its variant; The specific nucleic acid sequence expression plasmid to be loaded comprises a specific nucleic acid molecule to be loaded and a special sequence directly or indirectly connected to the specific nucleic acid molecule to be loaded, wherein the special sequence is a C / D box sequence, and the special sequence is autonomously docked with L7Ae or a variant thereof; The variant of the bridging protein L7Ae refers to the L7Ae variant obtained by removing 21 amino acids from the carboxyl terminus of the wild-type L7Ae; the C / Dbox sequence is shown in SEQ ID NO. 17; The specific nucleic acid molecule to be loaded is a nucleic acid sequence; the amino acid sequence of the scaffold protein is shown in SEQ ID NO.

4.

2. A high-load exosome-nucleic acid loading system according to claim 1, characterized in that: The exosome-loaded nucleic acid scaffold protein expression plasmid and the specific nucleic acid sequence expression plasmid to be loaded are co-transfected to load the specific nucleic acid molecules to be loaded into the cell exosomes.

3. A high-load exosome-nucleic acid loading system according to claim 1, characterized in that: The specific nucleic acid molecules to be loaded are nucleic acid sequences encoding vaccine antigens, anti-tumor nucleic acid drugs, nucleic acid antibody drugs or other nucleic acid molecules encoding various growth factors, antibodies and proteins.

4. A high-load exosome-nucleic acid loading system according to claim 1, characterized in that: The specific nucleic acid molecule to be loaded is a nucleic acid sequence encoding EGF, a nucleic acid sequence encoding insulin or a nucleic acid molecule of other growth factors.

5. A method for increasing the loading of specific nucleic acid molecules in cell exosomes, characterized in that: The steps include: Constructing a scaffold protein expression plasmid for loading nucleic acid on cell exosomes and a specific nucleic acid sequence expression plasmid to be loaded; the scaffold protein expression plasmid for loading nucleic acid on exosomes contains the coding sequence of exosome membrane protein and the coding sequence of at least one bridging protein L7Ae or / and its variant; the specific nucleic acid sequence expression plasmid to be loaded includes a specific nucleic acid molecule to be loaded and a C / D box sequence directly or indirectly connected to the specific nucleic acid molecule to be loaded; The scaffold protein expression plasmid for loading nucleic acid on exosomes and the expression plasmid of the specific nucleic acid sequence to be loaded are co-transfected into the exosome donor cells, the exosome donor cells are HEK293T, HEK293F, stem cells or immune cells, the exosome membrane protein is fused with the bridging protein L7Ae or / and its variant to form a fusion protein, the fusion protein is the scaffold protein, wherein the C / D box sequence is autonomously docked with L7Ae and its variant, so that the specific nucleic acid molecule to be loaded is loaded into the exosome through the fusion protein, and the exosome is secreted outside the cell while carrying the specific nucleic acid sequence molecule outside the cell; exosomes containing the specific nucleic acid molecule are enriched from the cell supernatant; the variant of the bridging protein L7Ae refers to the L7Ae variant obtained by removing 21 amino acids from the carboxyl terminus of the wild-type L7Ae; the C / D box sequence is shown in SEQ ID NO. 17; the specific nucleic acid molecule to be loaded is a nucleic acid sequence; the amino acid sequence of the scaffold protein is shown in SEQ ID NO.

4.

6. The method according to claim 5, characterized in that The specific nucleic acid molecules to be loaded are loaded into the cell exosomes by transient transfection or construction of stably transfected cell lines; the specific nucleic acid molecules to be loaded are any RNA nucleic acid drugs or RNA nucleic acid molecules carrying a C / D box sequence.

7. A nucleic acid drug or nucleic acid molecule comprising the high-load exosome-nucleic acid loading system according to any one of claims 1 to 4, characterized in that: The nucleic acid drugs or nucleic acid molecules are nucleic acid vaccines, anti-tumor nucleic acid drugs, nucleic acid antibody drugs, nucleic acid molecules for gene therapy or tumor cell therapy, and regenerative medicine drugs.

8. Use of the high-load exosome-nucleic acid loading system as claimed in any one of claims 1 to 4 in the preparation of nucleic acid drugs, characterized in that: The nucleic acid drug is used in the fields of nucleic acid vaccines, anti-tumor, gene therapy, cell therapy or regenerative medicine.

Images