A microRNA marker composition and detection reagent, detection kit for colorectal cancer diagnosis

Abstract

The application provides a microRNA marker composition and detection reagent and kit for colorectal cancer diagnosis, the microRNA comprising miR-135b-5p, miR-29a-3p and miR-18a-5p. The application sets the target of multiple primer probe groups as miRNA related to colorectal cancer, so that the composition of the application can effectively amplify miRNA. Meanwhile, the primer probe group of the application comprises a stem loop reverse transcription primer, a forward primer, a reverse primer and a probe, reverse transcription to generate cDNA and probe method qPCR can be completed in one tube in one step, and then detection is realized, and the operation is simple.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and medicine, specifically to a composition and detection kit for the early diagnosis of colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is one of the most common malignant tumors of the digestive tract and a major threat to the health and lives of Chinese residents. CRC is the second most common adult cancer in women and the third most common in men, with 5-year and 10-year survival rates of 65% and 58%, respectively. Men have a 25% higher incidence and mortality rate than women. The development of CRC typically progresses from normal mucosa to adenoma to adenocarcinoma. Adenocarcinoma is the most prevalent histological type of colorectal cancer, and adenoma is recognized as the most important precancerous lesion. It is difficult to detect in the early stages of colorectal cancer, and most patients are already in the middle or late stages when they seek medical attention. The 5-year survival rate for patients with early-stage localized disease (stage I and II) is close to 90%, while the survival rate for advanced colorectal cancer is only 13.1%. The lack of effective diagnostic methods for early diagnosis and treatment of colorectal adenocarcinoma and its precancerous lesions is one of the main reasons for this. Early detection and resection of colorectal adenocarcinoma and its adenoma lesions will help reduce its incidence and mortality. To date, colonoscopy, serological markers such as carcinoembryonic antigen (CEA), and imaging examinations are the main basis for the early diagnosis of colorectal cancer. However, their disadvantages are that they are invasive and lack specificity and sensitivity, which cannot meet the needs of current clinical cases.

[0003] Serum miRNAs are mainly found in exosomes formed from phospholipid membranes and can be specifically and stably detected in blood or tissues, making them ideal potential tumor markers. Therefore, there is an urgent need to find miRNA markers with high specificity and sensitivity for early diagnosis of colorectal cancer, making early diagnosis of colorectal cancer simpler and more effective. Summary of the Invention

[0004] This invention provides a microRNA biomarker composition, detection reagent, and detection kit for the diagnosis of colorectal cancer, so as to achieve the diagnosis of early colorectal cancer.

[0005] The first aspect of the present invention provides a microRNA biomarker composition for the diagnosis of colorectal cancer, wherein the microRNA includes miR-135b-5p, miR-29a-3p and miR-18a-5p.

[0006] A second aspect of the present invention provides a detection reagent for detecting the above-mentioned microRNA biomarker composition, wherein the detection reagent is a reagent used for PCR, Northern blotting analysis or microarray analysis.

[0007] Furthermore, the detection reagent is a primer and / or a probe.

[0008] Furthermore, the primers include stem-loop reverse transcription primers, forward primers, and reverse primers.

[0009] Furthermore, the stem-loop reverse transcription primers for miR-135b-5p, miR-29a-3p, and miR-18a-5p in the detection reagent include one or more of SEQ ID No. 1, SEQ ID No. 5, and SEQ ID No. 9.

[0010] Furthermore, the forward primers, reverse primers, and probes for miR-135b-5p, miR-29a-3p, and miR-18a-5p in the detection reagent include SEQ ID No. 2-4, SEQ ID No. 6-8, and SEQ ID No. 10-12.

[0011] A third aspect of the present invention discloses a test kit comprising the above-described test reagent.

[0012] Furthermore, the detection kit also includes a PCR amplification buffer, Mg ions, dNTPS, Rnasin, reverse transcriptase, and Taq enzyme.

[0013] Furthermore, the method of using the detection kit is as follows: mix the composition in the detection kit with the sample to be tested, and perform reverse transcription PCR.

[0014] Furthermore, the sample to be tested is derived from plasma or blood.

[0015] Compared to existing technologies, this invention targets colorectal cancer-related miRNAs with multiple primer-probe sets, enabling the composition of this invention to effectively amplify miRNAs. Furthermore, the primer-probe set of this invention includes stem-loop reverse transcription primers, forward primers, reverse primers, and probes, allowing reverse transcription to generate cDNA and probe-based qPCR to be completed in a single tube in one step, thus achieving detection with simple operation. Attached Figure Description

[0016] Figure 1 This is a flowchart of the one-step stem-loop reverse transcription amplification method according to an embodiment of the present invention;

[0017] Figure 2 The amplification curves of positive samples of miR-135b-5p, miR-29a-3p, miR-18a-3p and internal standard in the embodiments of the present invention are shown.

[0018] Figure 3 The amplification curves of negative samples and internal standards in embodiments of the present invention are shown.

[0019] Figure 4 This is the ROC analysis chart of miR-135b-5p in an embodiment of the present invention;

[0020] Figure 5 This is the ROC analysis chart of miR-29a-3p in an embodiment of the present invention;

[0021] Figure 6 This is the ROC analysis chart of miR-18a-3p in an embodiment of the present invention;

[0022] Figure 7 This is the ROC analysis chart of the joint detection of three targets, miR-135b-5p, miR-29a-3p, and miR-18a-3p, in an embodiment of the present invention. Detailed Implementation

[0023] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0024] miRNAs participate in a wide variety of regulatory pathways, including development, viral defense, hematopoiesis, organogenesis, cell proliferation and apoptosis, and lipid metabolism. miRNAs are closely related to cellular carcinogenesis and the development of various tumors. During cancer development, the expression of various miRNAs in cancer cells changes, leading to alterations in the expression of downstream target genes, thereby affecting the occurrence and development of cancer.

[0025] The first aspect of this invention provides a microRNA biomarker composition for the diagnosis of colorectal cancer, wherein the microRNA includes miR-135b-5p, miR-29a-3p and miR-18a-5p.

[0026] A second aspect of the present invention provides a detection reagent for detecting the above-mentioned microRNA biomarker composition, wherein the detection reagent is a reagent used for PCR, Northern blotting analysis or microarray analysis.

[0027] Specifically, the compositions in the embodiments of this invention refer to those used simultaneously in the RT-PCR process, rather than being limited to n primer and probe sets stored in a mixture. In fact, the compositions referred to in the embodiments of this invention can be packaged separately and stored together, or they can be stored as a mixture.

[0028] miRNAs are very short, only about 23 nucleotides long. The stem-loop reverse transcription primers of this invention extend the cDNA length by reverse transcribing miRNAs, thereby enriching the binding sites of forward and reverse primers and probes. Furthermore, the reverse transcription process can be carried out in one tube with the real-time PCR amplification process, which has the advantages of simple operation, short time required, and low risk of contamination.

[0029] Plasma miRNAs are stored in exosomes and are not degraded by RNase enzymes during PCR cycles. They are tumor markers that can be stably detected in the blood. Therefore, non-invasive screening for colorectal cancer can be achieved by detecting the content of colorectal cancer-related miRNAs in the blood. In this embodiment of the invention, by setting the target of at least one primer probe set to colorectal cancer-related miRNAs, the composition of the present invention can effectively amplify miRNAs, thereby achieving effective detection of colorectal cancer.

[0030] Optionally, the miRNA includes miR-135b-5p, miR-29a-3p, and miR-18a-5p.

[0031] This invention, through bioinformatics analysis, PCR system construction, and sample detection verification, has determined that a combined detection reagent for three miRNA molecular markers—hsa-miR-135b-5p, hsa-miR-29a-3p, and hsa-miR-18a-5p—can diagnose early-stage colorectal cancer, with sensitivity and specificity reaching 86.7% and 96.7%, respectively, in actual tests. The sequences of hsa-miR-135b-5p, hsa-miR-29a-3p, and hsa-miR-18a-5p are shown in the table below.

[0032] miRNA name Sequence (5'-3') miR-135b-5p UAUGGCUUUUCAUUCCUAUGUGA miR-29a-3p UAGCACCAUCUGAAAUCGGUUA miR-18a-5p UAAGGUGCAUCUAGUGCAGAUAG

[0033] Optionally, the detection reagent is a primer and / or a probe.

[0034] Specifically, the primers include stem-loop reverse transcription primers, forward primers, and reverse primers.

[0035] Specifically, the stem-loop reverse transcription primers for miR-135b-5p, miR-29a-3p, and miR-18a-5p in the detection reagent include one or more of SEQ ID No. 1, SEQ ID No. 5, and SEQ ID No. 9.

[0036] Specifically, the forward primers, reverse primers, and probes for miR-135b-5p, miR-29a-3p, and miR-18a-5p in the detection reagent include SEQ ID No. 2-4, SEQ ID No. 6-8, and SEQ ID No. 10-12.

[0037] The sequences SEQ ID No. 1 to SEQ ID No. 12 of the embodiments of the present invention are shown in the table below.

[0038]

[0039] The four fluorescence channels used in this embodiment of the invention are FAM, HEX, CY5 and ROX channels, but in actual use they are not limited to these and can be any combination of other fluorescence channels; at the same time, different targets should correspond to different fluorescence channels to facilitate the staff to obtain amplification results of different miRNAs.

[0040] Furthermore, the 3' end of the probe has a quenching group, such as MGB, BHQ1, or BHQ2.

[0041] It should be noted that the aforementioned primer and probe sequences are suitable for the amplification of miR-135b-5p, miR-29a-3p, and miR-18a-3p in the embodiments of the present invention, but are not the only ones. Other suitable primers and probes that can meet the amplification effects of miR-135b-5p, miR-29a-3p, and miR-18a-3p should also be included in the protection scope of the present invention.

[0042] Optionally, in this embodiment of the invention, the molar concentration ratio of every two primer-probe sets is 1.

[0043] Another aspect of the present invention discloses a detection kit comprising the above-described composition.

[0044] Optionally, the detection kit may also include a PCR amplification buffer, Mg ions, dNTPS, Rnasin, reverse transcriptase, and Taq enzyme.

[0045] Those skilled in the art, having knowledge of conventional RT-PCR technology, are motivated to independently select the amounts of PCR amplification buffer, Mg ions, dNTPS, Rnasin, reverse transcriptase, and Taq enzyme. Therefore, this embodiment of the invention does not impose specific amount restrictions.

[0046] Optionally, the method of using the test kit is as follows: mix the composition in the test kit with the sample to be tested, and perform RT-PCR.

[0047] Specifically, the sample to be tested is derived from plasma or blood.

[0048] The samples to be tested are specifically derived from plasma, and miRNA in the plasma can be used for diagnostic screening.

[0049] This invention uses plasma miRNA as a sample for the diagnosis and screening of colorectal cancer. It is a non-invasive diagnostic technique that can effectively reduce patient suffering and facilitate early and large-scale colorectal cancer screening and diagnosis, thus having high clinical application value.

[0050] To illustrate the solutions and effects of the embodiments of the present invention, Embodiment 1 and Embodiment 2 are hereby disclosed.

[0051] Example 1: Reference Specimen Testing

[0052] The positive samples in Example 1 of this invention include: miR-135b-5p; miR-29a-3p; miR-18a-5p, and the detection internal standard RNU6-2 at a concentration of 100 copies / mL;

[0053] The negative sample in Example 1 of this invention is: TE buffer;

[0054] The detection process of Embodiment 1 of the present invention is as follows: Figure 1 As shown, the specific stem-loop reverse transcription amplification method consists of two stages: In the first stage, specific stem-loop primers are designed with their 3' ends complementary to the miRNA target sequence, and under the action of reverse transcriptase, cDNA is formed through reverse transcription; in the second stage, probe-based qPCR is performed.

[0055] The sequence of internal standard RNU6-2 in Embodiment 1 of the present invention is shown in the table below:

[0056]

[0057] The primer and probe sequences of Example 1 of this invention are shown in the table below.

[0058]

[0059]

[0060] The PCR system configuration components of Example 1 of this invention are shown in the table below. The PCR reaction solution is prepared according to the reagent formula in the table below.

[0061]

[0062]

[0063] The specific detection process of Embodiment 1 of the present invention is as follows:

[0064] S1. Add 20 μL of sample to the PCR reaction tube, then add 30 μL of PCR reaction solution, cap the PCR tube, vortex to mix, and centrifuge for 5 seconds.

[0065] S2. Perform fluorescent PCR reaction detection and result analysis:

[0066] S201. Place the PCR reaction tube into the sample slot of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0067] S202. Fluorescence detection channel selection: Select the ROX channel (Reportere:ROX, Quencher:None) to detect miR-29a-3p; select the FAM channel (Reportere:FAM, Quencher:None) to detect miR-135b-5p; select the HEX channel (Reportere:HEX, Quencher:None) to detect miR-18a-5p; select the CY5 channel (Reportere:CY5, Quencher:None) as an internal standard to detect the internal reference RNU6-2;

[0068] S203. The reaction conditions for quantitative real-time PCR are set as shown in the table below:

[0069]

[0070] S204. Detection and structural analysis: After the reaction is completed, the instrument automatically saves the results. The instrument can be automatically analyzed using its built-in software (or the start value, end value, and threshold value of the baseline can be manually adjusted for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the number of cycles that the fluorescence signal in the PCR reaction tube takes to reach the set threshold).

[0071] The amplification curve of the positive sample in Example 1 of this invention is as follows: Figure 2 , Figure 3 As shown, the detection reagent provided by this invention has a sensitivity of 100 copies / mL, exhibits no nonspecific amplification in TE, and simultaneously... Figure 2 , Figure 3 The comparison of the amplification curves shows that the multiple primer and probe sets used in Example 1 of this invention can simultaneously amplify multiple miRNAs in one tube without interfering with each other.

[0072] Example 2: Clinical Sample Testing

[0073] The specific process of Embodiment 2 of the present invention is as follows:

[0074] Step 1. Collect 60 clinical plasma samples, including 30 plasma samples from colorectal cancer patients and 30 plasma samples from healthy individuals;

[0075] Step 2. Plasma miRNA was extracted using the miRcute serum / plasma miRNA extraction and isolation kit. Following the procedure and PCR system in Example 1, miRNA stem-loop reverse transcription and PCR amplification were performed in the same reaction tube to detect the three targets in combination.

[0076] Clinical results should be interpreted as follows: the experimental results should be judged based on the Ct value of the internal reference gene U6 to determine whether they meet the quality control requirements. If the Ct value is <27, the quality control requirements are met.

[0077] The embodiments of the present invention calculate the log of each target. 10 (2 -ΔCt This reflects the difference in expression level, log 10 (2 -ΔCt The calculation result is the relative expression level of each miRNA. Where ΔCt = Ct target - Ct internal reference, the expression level of each target is calculated based on the sample detection results, and the logistic regression model formula is logistics = -3.2765 - 4.5004 * miR - 135b - 5p - 1.3773 * miR - 29a - 3p - 1.3816 * miR - 18a - 5p.

[0078] Log was obtained from 60 clinical plasma samples. 10 (2 -ΔCt A model was constructed to obtain the logistic formula. A result <1.087 indicates colorectal cancer, while a result ≥1.087 indicates a low probability of colorectal cancer. The kit in Example 2 of this invention exhibits a specificity and sensitivity of 96.7% and 86.7% for plasma sample detection, respectively, as shown in the table below:

[0079]

[0080] Among them, the sensitivity of plasma sample detection (%) = number of positive detections / total number of positive cases * 100% = 86.7%;

[0081] Plasma sample testing specificity (%) = total number of negative detections / total number of negative samples * 100% = 96.7%.

[0082] ROC analysis of miR-135b-5p, miR-29a-3p, miR-18a-3p and the joint detection of the three targets in Example 2 of this invention is as follows: Figure 4-7As shown, the AUCs of the three miRNA biomarkers miR-135b-5p, miR-29a-3p, and miR-18a-3p in Example 2 of this invention were 0.917 (95% CI: 0.850-0.983), 0.709 (95% CI: 0.579-0.839), and 0.853 (95% CI: 0.761-0.945), respectively, while the AUC of the miRNA combination biomarker was 0.969 (95% CI: 0.929-1.000). This indicates that the combined detection of the three targets in Example 2 of this invention has good sensitivity and specificity. The detection sensitivity of the target combination biomarker in the plasma samples of gastric cancer patients reached 86.7%, and the specificity reached 96.7%, demonstrating good detection performance. It can be well used as a supplementary technology for the early diagnosis and screening of colorectal cancer.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that after reading this application specification, they can still modify or make equivalent substitutions to the specific implementation of the present invention, but these modifications or changes do not depart from the protection scope of the pending claims of the present invention.

Claims

1. The application of a detection reagent for detecting a microRNA biomarker composition in the preparation of a diagnostic kit for early colorectal cancer, characterized in that, The microRNA biomarker composition consists of miR-135b-5p, miR-29a-3p, and miR-18a-5p.

2. The application according to claim 1, characterized in that, The detection reagents are those used for PCR, Northern spectroscopy, or microarray analysis.

3. The application according to claim 2, characterized in that, The detection reagents are primers and / or probes.

4. The application according to claim 3, characterized in that, The primers include stem-loop reverse transcription primers, forward primers, and reverse primers.

5. The application according to claim 4, characterized in that, The detection reagent includes one or more of the stem-loop reverse transcription primers for miR-135b-5p, miR-29a-3p, and miR-18a-5p, comprising SEQ ID No. 1, SEQ ID No. 5, and SEQ ID No.

9.

6. The application according to claim 4 or 5, characterized in that, The detection reagents include forward primers, reverse primers, and probes for miR-135b-5p, miR-29a-3p, and miR-18a-5p, including SEQ ID No. 2~4, SEQ ID No. 6~8, and SEQ ID No. 10~12.

7. The application according to claim 1, characterized in that, The detection kit also includes PCR amplification buffer, Mg ions, dNTPS, Rnasin, reverse transcriptase, and Taq enzyme.

8. The application according to claim 1, characterized in that, The method of using the test kit is as follows: mix the composition in the test kit with the sample to be tested, and perform reverse transcription PCR.

9. The application according to claim 8, characterized in that, The sample to be tested is derived from plasma or blood.

Images