SSR fluorescently labeled primer for poly-PCR of sparus dauricus and application thereof
By designing SSR fluorescently labeled primers and capillary electrophoresis technology for multiplex PCR of the two-spined seabream, the problems of accuracy and cost in assessing the genetic diversity of the two-spined seabream were solved, achieving efficient and low-cost genetic diversity assessment and fishery resource protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-31
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately assessing the genetic diversity of the two-spined seabream, and the experimental costs are high, which cannot effectively support the development and protection of fishery resources.
An SSR fluorescently labeled primer for multiplex PCR of the spiny seabream was designed, including 10 pairs of specific primers and 2 fluorescently labeled universal primers. Combined with capillary electrophoresis, it enables efficient and accurate genotyping and genetic diversity assessment.
This study enabled accurate assessment of the genetic diversity of the two-spined seabream, reduced experimental costs, improved experimental efficiency, and supported the development and protection of fishery resources.
Smart Images

Figure BDA0004055753860000071 
Figure BDA0004055753860000072 
Figure BDA0004055753860000081
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microsatellite labeling technology, specifically relating to an SSR fluorescent labeling primer for multiplex PCR of sea bream and its application. Background Technology
[0002] The two-spined seabream (Paerargyrops edita) belongs to the order Perciformes, family Seabreamidae, and genus Paerargyrops. It is a warm-temperate, near-bottom-dwelling fish distributed in the western Pacific Ocean, primarily found in the southern East China Sea and northern South China Sea in China. The two-spined seabream has a laterally compressed, oval-shaped body and significant economic value, making it an important target for bottom trawlers in the northern South China Sea. However, research based on catch data from the past 30 years indicates that the two-spined seabream is showing signs of degeneration, including smaller body length, precocious sexual maturity, and a simpler population structure.
[0003] Microsatellite DNA, also known as SSRs, typically consists of repetitive segments of 1 to 6 bases. Due to their wide distribution and diversity in eukaryotic genomes, as well as the high variability in the number of repetitions among individuals, SSRs offer significant advantages, including easy allelic typing, high polymorphism, and high codominance. Currently, SSRs are the most suitable molecular markers for analyzing genetic diversity in marine fish.
[0004] Multiplex PCR is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to amplify multiple nucleic acid fragments simultaneously. It can significantly reduce human error, save experimental materials, and make experiments more efficient, economical, and convenient. Currently, multiplex PCR is widely used in plant and animal research, especially providing a powerful technical means for population genetic diversity analysis, genetic segregation pattern analysis, and germplasm identification.
[0005] The combined use of microsatellite markers and universal fluorescent marker primers for multiplex PCR has the advantages of being simple and efficient to operate, low cost, low human error, and accurate results. Summary of the Invention
[0006] The purpose of this invention is to provide an SSR fluorescently labeled primer for multiplex PCR of sea bream, which has high polymorphism, stable products, and accurate and reliable results.
[0007] The present invention also aims to provide a method for assessing the genetic diversity of the fins of the long-spined seabream, which is accurate and has low experimental cost.
[0008] The final objective of this invention is to provide the application of the above primers in assessing the genetic diversity of the two-spined seabream and in the development and protection of fishery resources.
[0009] The first objective of the present invention is achieved by the following technical solution: an SSR fluorescently labeled primer for multiplex PCR of sea bream, comprising 10 pairs of specific primers, namely primer pairs Pae308, Pae654, Pae1218, Pae2027, Pae2333, Pae1291, Pae2105, Pae1271, Pae217 and Pae347, wherein each primer pair consists of a forward primer F and a reverse primer R;
[0010] in:
[0011] The base sequences of the forward and reverse primers for the primer pair Pae308 are shown in SEQ ID NO: 1-2, respectively;
[0012] The base sequences of the forward and reverse primers for the primer pair Pae654 are shown in SEQ ID NO: 3-4, respectively.
[0013] The base sequences of the forward and reverse primers for the primer pair Pae1218 are shown in SEQ ID NO: 5-6, respectively.
[0014] The base sequences of the forward and reverse primers for the primer pair Pae2027 are shown in SEQ ID NO: 7-8, respectively;
[0015] The base sequences of the forward and reverse primers for the primer pair Pae2333 are shown in SEQ ID NO: 9-10, respectively;
[0016] The base sequences of the forward and reverse primers for the primer pair Pae1291 are shown in SEQ ID NO: 11-12, respectively;
[0017] The base sequences of the forward and reverse primers for the primer pair Pae2105 are shown in SEQ ID NO: 13-14, respectively.
[0018] The base sequences of the forward and reverse primers for the primer pair Pae1271 are shown in SEQ ID NO: 15-16, respectively.
[0019] The base sequences of the forward and reverse primers for the primer pair Pae217 are shown in SEQ ID NO: 17-18, respectively.
[0020] The base sequences of the forward and reverse primers for the primer pair Pae347 are shown in SEQ ID NO: 19-20, respectively.
[0021] Furthermore, it also includes two fluorescently labeled universal primers M13 and PQE-F. The fluorescent label associated with universal primer M13 is 5-FAM, and the fluorescent label associated with universal primer PQE-F is 5-HEX. The base sequence of the universal primer M13 is shown in SEQ ID NO: 21, and the base sequence of the universal primer PQE-F is shown in SEQ ID NO: 22.
[0022] The present invention also provides a kit for multiplex PCR of sea bream, comprising the above-mentioned 10 pairs of specific primers or the above-mentioned 10 pairs of specific primers and 2 fluorescently labeled universal primers M13 and PQE-F.
[0023] The second objective of this invention is achieved through the following technical solution: a method for assessing the genetic diversity of the fins of the two-spined seabream, comprising the following steps:
[0024] (1) Extraction of DNA from two-spined seabream: Fin tissue was collected from two-spined seabream samples and genomic DNA was extracted;
[0025] (2) Synthesis of specific primers: The above 10 pairs of specific primers were screened and synthesized. The 10 pairs of specific primers were divided into G1 group and G2 group. G1 group includes primer pairs Pae308, Pae654, Pae1218, Pae2027, Pae2333 and fluorescently labeled universal primers. G2 group includes primer pairs Pae1291, Pae2105, Pae1271, Pae217, Pae347 and fluorescently labeled universal primers.
[0026] (3) Multiplex PCR amplification: The genomic DNA in step (1) is amplified by PCR using the two sets of specific primers and fluorescently labeled universal primers in step (2) to obtain the amplification product;
[0027] (4) Genetic diversity assessment: Genotyping of amplified products, counting alleles at each locus and individual, and comparing genetic diversity based on heterozygosity index.
[0028] In the above-mentioned methods for assessing the genetic diversity of the fins of the two-spined seabream:
[0029] In step (3), the reaction systems for PCR amplification in groups G1 and G2 are shown below:
[0030] The multiplex PCR amplification reaction system for group G1 is as follows:
[0031] G1 group PCR system reactants Content (μL) Pae308.F (10 μM) 0.06 Pae308.R (10μM) 0.24 Pae654.F (20 μM) 0.06 Pae654.R (20μM) 0.24 Pae1218.F (10 μM) 0.06 Pae1218.R (10μM) 0.24 Pae2027.F (5μM) 0.06 Pae2027.R (5μM) 0.24 Pae2333.F (5μM) 0.06 Pae2333.R (5μM) 0.24 M13 (10μM) 0.36 PQE-F (10μM) 0.36 BSA (2 mg / mL) 0.45 DNA (50 ng / μL) 2.0 Taq HS (Takara) 12.5 <![CDATA[ddH2O]]> 7.83 Total 25.0
[0032] The multiplex PCR amplification reaction system for group G2 is as follows:
[0033] G2 group PCR system reactants Content (μL) Pae1291.F (20 μM) 0.06 Pae1291.R (20 μM) 0.24 Pae2105.F (10 μM) 0.06 Pae2105.R (10 μM) 0.24 Pae1271.F (20 μM) 0.06 Pae1271R (20μM) 0.24 Pae217.F (10 μM) 0.06 Pae217.R (10μM) 0.24 Pae347.F (10 μM) 0.06 Pae347.R (10μM) 0.24 M13 (10μM) 0.36 PQE-F (10μM) 0.36 BSA (2 mg / mL) 0.45 DNA (50 ng / μL) 2.0 Taq HS (Takara) 12.5 <![CDATA[ddH2O]]> 7.83 Total 25.0
[0034] The system configuration process of this application is as follows: First, the primer concentration is adjusted and determined according to the amplification effect. Then, the forward and reverse primers are mixed in a 1:4 ratio, followed by equal proportioning of the pre-prepared mixture. Finally, the amplification system is configured according to the number of experimental samples. This configuration process has the advantages of saving experimental materials, improving experimental efficiency, reducing experimental time, and reducing human error caused by adding a single primer.
[0035] Preferably, the PCR amplification program used in step (3) is as follows: 98℃ for 10s, 57℃ for 40s, 72℃ for 60s, 35 cycles; 98℃ for 10s, 53℃ for 40s, 72℃ for 60s, 15 cycles; and finally, extension at 72℃ for 30min.
[0036] Preferably, in step (4), the genotyping method uses capillary electrophoresis to genotype the amplification products on an ABI3730XL gene analyzer.
[0037] The last objective of the present invention can be achieved by the following technical solution: the application of the above-mentioned SSR fluorescent marker primers and evaluation methods in assessing the genetic diversity of the two-spined seabream and the development and protection of fishery resources.
[0038] Compared with the prior art, the present invention has the following advantages:
[0039] (1) This invention utilizes a combination of microsatellite markers, multiplex PCR and universal amplification primers to screen 10 highly polymorphic microsatellite loci, and designs specific primers based on these microsatellite loci to genotype the two-spined seabream.
[0040] (2) In practical applications, the present invention can be used alone with group G1 to detect 5 sites; or with group G2 to detect 5 sites; or by combining groups G1 and G2 at once to detect 10 sites simultaneously. The appropriate number of primers can also be selected for amplification based on the number of samples, and the universal primers can be reused. Compared to simple single-site detection, this method reduces costs and increases experimental efficiency.
[0041] (3) The microsatellite loci contained in this invention are 3 to 6 bases, which makes the interpretation of allele size more accurate and improves the accuracy of genotype data;
[0042] (4) The method for assessing the genetic diversity of the fins of the two-spined seabream in this invention uses a reliable and effective combination of microsatellite primers to provide a method for typing the two-spined seabream population using multiplex PCR technology. Based on the developed primers, it can be used for germplasm resource assessment, genetic diversity assessment and fishery resource development and protection. Attached Figure Description
[0043] Figure 1 This is a detailed view of the capillary electrophoresis images of sites Pae308 and Pae654 in Example 2;
[0044] Figure 2 This is a detailed view of the capillary electrophoresis images of sites Pae1218, Pae2027, and Pae2333 in Example 2.
[0045] Figure 3 This is a detailed image of the capillary electrophoresis maps of sites Pae1291 and Pae2105 in Example 2.
[0046] Figure 4 This is a detailed image of the capillary electrophoresis maps of sites Pae1271 and Pae347 in Example 2;
[0047] Figure 5 This is a detailed image of the capillary electrophoresis map of site Pae217 in Example 2;
[0048] Figure 6 This is a panel image of the capillary electrophoresis of site Pae308 in Example 2;
[0049] Figure 7 This is a panel image of the capillary electrophoresis of site Pae654 in Example 2;
[0050] Figure 8 This is a panel image of the capillary electrophoresis of site Pae1218 in Example 2;
[0051] Figure 9 This is a panel image of the capillary electrophoresis of site Pae2027 in Example 2;
[0052] Figure 10 This is a panel image of the capillary electrophoresis of site Pae2333 in Example 2;
[0053] Figure 11 This is a panel image of the capillary electrophoresis of site Pae1291 in Example 2;
[0054] Figure 12 This is a panel image of the capillary electrophoresis of site Pae2105 in Example 2;
[0055] Figure 13 This is a panel image of the capillary electrophoresis of site Pae1271 in Example 2;
[0056] Figure 14 This is a panel image of the capillary electrophoresis of site Pae347 in Example 2;
[0057] Figure 15 This is a panel image of the capillary electrophoresis of site Pae217 in Example 2;
[0058] Figure 16 The image shown is a gel electrophoresis image from Example 3, with 10 bands from left to right, corresponding to sites Pae308, Pae1218, Pae2027, Pae2333, Pae654, Pae1291, Pae1271, Pae2105, Pae217 and Pae347, respectively. Detailed Implementation
[0059] The specific implementation of the present invention will be further illustrated below with examples.
[0060] Example 1
[0061] The SSR fluorescently labeled primers for multiplex PCR of *Sinocyclocheilus buxiflorus* provided in this embodiment include 10 pairs of specific primers, namely primer pairs Pae308, Pae654, Pae1218, Pae2027, Pae2333, Pae1291, Pae2105, Pae1271, Pae217, and Pae347. Each primer pair includes one forward primer and one reverse primer. The base sequences of the 10 pairs of specific primers are shown in SEQ ID NO: 1-20, respectively. It also includes two fluorescently labeled universal primers, M13 and PQE-F. The fluorescent label associated with universal primer M13 is 5-FAM, and the fluorescent label associated with universal primer PQE-F is 5-HEX. The base sequences of the universal primers are shown in SEQ ID NO: 21-22, respectively. Specific sequences are shown in Tables 1 and 2 below.
[0062] Table 1. Base sequences of the above-mentioned specific primers (10 pairs)
[0063] Primers Forward primer F Reverse primer R Pae308 tgtaaaacgacggccagtgtctattcttggagatgggcac aaagtccagcagcagcttatgt Pae654 tgtaaaacgacggccagttagaagcacagcagagagcaac aacaattgcataaggagaggga Pae1218 tgtaaaacgacggccagtaagacagacacatgcagacagg cattactgcagcatgcaagttt Pae2027 ttgagaggatcgcatccagcacagactttgaaagcaacag aggtgaagagattgcacagtga Pae2333 tgtaaaacgacggccagtggatttcaggtccagatcagag cagagacggtaccagatgttca Pae1291 tgtaaaacgacggccagtgtgtatcatgtcccgagattca gtagatgggcccaaactttatg Pae2105 tgtaaaacgacggccagttctgagacgacatcctcaaatg caatcctctacctgaccacaga Pae1271 tgtaaaacgacggccagttgcatcttctaaataatgccgc tcgttgttgctatgtgtggtg Pae217 ttgagaggatcgcatccaatgattcagagagcgtatgggt cattcaacagccatgacaaact Pae347 ttgagaggatcgcatccagtggccactgctagttatgtca acagccatagttactttgccga
[0064] Table 2. Two universal primers and fluorescent labels that work in conjunction with the universal primers.
[0065] primer pairs Primer sequence Fluorescent labeling M13 tgtaaaacgacggccagt 5-FAM PQE-F ttgagaggatcgcatcca 5-HEX
[0066] Example 2
[0067] The method for assessing the genetic diversity of the fins of the two-spined seabream provided in this embodiment firstly screens and designs a set of microsatellite amplification primer combinations based on microsatellite loci, containing a total of 10 pairs of specific primers. Then, the primers are divided into two groups, and the specific primer pairs and fluorescently labeled universal primers of each group are added to different reaction tubes. Multiple target fragments are amplified by PCR, and the multiple amplification products of different primers are separated by electrophoresis. Finally, the separated bands are statistically analyzed.
[0068] Specifically, the method for assessing the genetic diversity of the fins of the two-spined seabream provided in this embodiment includes the following steps:
[0069] (1) Extraction of DNA from two-spined seabream: fin tissue of two-spined seabream samples was collected and genomic DNA was extracted;
[0070] (2) Two sets of multiplex SSR-PCR primers were selected.
[0071] Based on the reference genome sequence of the two-spined seabream, the distribution and classification characteristics of microsatellites were statistically analyzed. Through population resequencing data analysis, microsatellites were genotyped, and microsatellites with high polymorphism and 3-6 base repeat units were screened. The amplification specificity of primers and the compatibility between primer combinations were evaluated, and two sets of multiplex SSR-PCR combinations, denoted as G1 and G2, were selected. Each set contains 5 microsatellite loci, as shown in Tables 3 and 4 below. The microsatellite sequences were labeled with fluorescent universal primers and automatically genotyped using capillary electrophoresis.
[0072] Table 3 Primer pairs for G1 group microsatellite locus amplification
[0073]
[0074] Table 4 Primer pairs for G2 group microsatellite locus amplification
[0075]
[0076]
[0077] (3) The above primers were synthesized in a commercial company.
[0078] (4) PCR amplification: The amplification program was 35 cycles of 98℃ for 10s, 57℃ for 40s, and 72℃ for 60s; followed by 15 cycles of 98℃ for 10s, 53℃ for 40s, and 72℃ for 60s; and a final extension at 72℃ for 30 min. The amplification system is shown in Table 5-6 below:
[0079] Table 5. Multiplex PCR amplification system of group G1
[0080] PCR system reactants Content (μL) Pae308.F (10 μM) 0.06 Pae308.R (10μM) 0.24 Pae654.F (20 μM) 0.06 Pae654.R (20μM) 0.24 Pae1218.F (10 μM) 0.06 Pae1218.R (10μM) 0.24 Pae2027.F (5μM) 0.06 Pae2027.R (5μM) 0.24 Pae2333.F (5μM) 0.06 Pae2333.R (5μM) 0.24 M13 (10μM) 0.36 PQE-F (10μM) 0.36 BSA (2 mg / mL) 0.45 DNA (50 ng / μL) 2.0 Taq HS (Takara) 12.5 <![CDATA[ddH2O]]> 7.83 Total 25.0
[0081] Table 6. Multiplex PCR amplification reaction system of group G2
[0082] PCR system reactants Content (μL) Pae1291.F (20 μM) 0.06 Pae1291.R (20 μM) 0.24 Pae2105.F (10 μM) 0.06 Pae2105.R (10 μM) 0.24 Pae1271.F (20 μM) 0.06 Pae1271R (20μM) 0.24 Pae217.F (10 μM) 0.06 Pae217.R (10μM) 0.24 Pae347.F (10 μM) 0.06 Pae347.R (10μM) 0.24 M13 (10μM) 0.36 PQE-F (10μM) 0.36 BSA (2 mg / mL) 0.45 DNA (50 ng / μL) 2.0 Taq HS (Takara) 12.5 <![CDATA[ddH2O]]> 7.83 Total 25.0
[0083] (5) The amplified samples were sent to a commercial company for genotyping using an ABI 3730XL.
[0084] (6) Genetic diversity analysis: Multiplex PCR products were genotyped on an automated sequencer (ABI 3730XL) to read individual genotypes.
[0085] Figures 1-5 This is a detailed image of the sites in a capillary electrophoresis pattern. Figures 6-15 This is a panel diagram of capillary electrophoresis. Numbers 1-10 in the diagram correspond to sites Pae308, Pae654, Pae1218, Pae2027, Pae2333, Pae1291, Pae2105, Pae1271, Pae217, and Pae347, respectively. See Table 7 for details.
[0086] Table 71-10 Relationship with loci
[0087] Serial Number 1 2 3 4 5 6 7 8 9 10 site Pae308 Pae654 Pae1218 Pae2027 Pae2333 Pae1291 Pae2105 Pae1271 Pae217 Pae347
[0088] from Figure 1-15 The peaks in the spectrum are neat and stable, and the allele lengths strictly conform to the characteristics of repetitive motifs, indicating that the developed multiplex PCR-SSR can be used stably.
[0089] Example 3
[0090] The following specific examples illustrate the application of the SSR fluorescent marker primers in Example 1 and the evaluation method in Example 2 in assessing the genetic diversity of the two-spined seabream and the development and protection of fishery resources.
[0091] (1) Extract DNA from two-spined seabream: fin rays from 30 individuals of two-spined seabream were cut and immediately preserved in 95% ethanol. These samples are designated as P1-P30. Total genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit. For specific steps, please refer to the kit instructions. After DNA extraction, the concentration was detected using a UV spectrophotometer.
[0092] (2) Synthetic primers
[0093] Primers were synthesized according to the sequence and fluorescent labeling requirements in Tables 1 and 2.
[0094] (3) Multiplex PCR amplification
[0095] Each individual underwent PCR amplification according to the systems in Tables 5 and 6.
[0096] PCR reaction program settings: 98℃ for 10s, 59℃ for 30s, 72℃ for 60s, 30 cycles; 98℃ for 10s, 53℃ for 30s, 72℃ for 60s, 15 cycles; final extension at 72℃ for 30min.
[0097] After PCR, 5 μL was electrophoresed on an agarose gel to detect diffuse bands of the expected size, and the rest were sent to a commercial company for genotyping using an ABI 3730XL.
[0098] Figure 16 The image shows a gel electrophoresis result with 10 bands from left to right, corresponding to loci Pae308, Pae1218, Pae2027, Pae2333, Pae654, Pae1291, Pae1271, Pae2105, Pae217, and Pae347. First, gel electrophoresis confirms the amplification of bands of a confirmed size. Then, capillary electrophoresis is used to detect the genotyping of each locus. Stable genotyping allows for population detection.
[0099] (4) The peak shape was converted into alleles using the software GeneMarker V2.2.2.0. Table 8 shows the genetic parameters of the sample population.
[0100] Table 8. Genetic parameters of 10 microsatellite loci in *Spinycticebus nigra*.
[0101] Locus N Na Ne I Ho He uHe F Pae308 30 6.000 2.432 1.102 0.433 0.589 0.599 0.264 Pae654 30 6.000 4.138 1.550 0.500 0.758 0.771 0.341 Pae1218 30 7.000 2.715 1.257 0.367 0.632 0.642 0.420 Pae2027 30 7.000 4.737 1.714 0.167 0.789 0.802 0.789 Pae2333 30 6.000 4.737 1.539 0.367 0.754 0.767 0.767 Pae1291 30 5.000 2.013 0.919 0.533 0.503 0.512 -0.060 Pae2105 30 18.000 9.836 2.558 0.833 0.898 0.914 0.072 Pae1271 30 3.000 1.850 0.762 0.467 0.459 0.467 -0.016 Pae217 30 17.000 9.677 2.517 0.733 0.897 0.912 0.182 Pae347 30 10.000 6.977 2.096 0.267 0.880 0.871 0.689 Mean 30 8.500 4.845 1.601 0.467 0.714 0.726 0.319
[0102] Note: Locus: locus, N: number of individuals, Na: number of alleles, Ne: effective number of alleles, I: Shannon information index, Ho: observed heterozygosity; He: expected heterozygosity; F: fixation index.
[0103] The above results demonstrate that the multiplex PCR method based on the microsatellite primers of this invention is stable and accurate in the genotyping of the *Echinochloa spp.* population, meeting the requirements for genetic diversity analysis, evaluation of stock enhancement and release effects, and protection of fishery resources.
[0104] The above description is only a non-limiting embodiment of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention and without creative effort, and these all fall within the protection scope of the present invention.
Claims
1. A method for assessing the genetic diversity of the fins of the two-spined seabream, characterized by: Includes the following steps: (1) Extraction of DNA from two-spined seabream: Fin tissue was collected from two-spined seabream samples and genomic DNA was extracted; (2) Synthesis of specific primers: 10 pairs of specific primers and 2 fluorescently labeled universal primers M13 and PQE-F were screened and synthesized. The 10 pairs of specific primers and 2 fluorescently labeled universal primers M13 and PQE-F were divided into G1 group and G2 group. G1 group includes primer pairs Pae308, Pae654, Pae1218, Pae2027, Pae2333 and fluorescently labeled universal primers. G2 group includes primer pairs Pae1291, Pae2105, Pae1271, Pae217, Pae347 and fluorescently labeled universal primers. The base sequences of the universal primers M13 and PQE-F are shown in SEQ ID NO: 21~22, respectively; (3) Multiplex PCR amplification: The genomic DNA in step (1) was amplified by PCR using the two sets of specific primers and fluorescently labeled universal primers in step (2) to obtain the amplification products; (4) Genetic diversity assessment: Genotyping of amplified products, counting alleles at each locus and in each individual, and comparing genetic diversity based on heterozygosity index; In step (2), there are 10 pairs of specific primers, namely primer pairs Pae308, Pae654, Pae1218, Pae2027, Pae2333, Pae1291, Pae2105, Pae1271, Pae217 and Pae347, each of which consists of a forward primer F and a reverse primer R; in: The base sequences of the forward and reverse primers for the primer pair Pae308 are shown in SEQ ID NO: 1-2, respectively; The base sequences of the forward and reverse primers for the primer pair Pae654 are shown in SEQ ID NO: 3-4, respectively. The base sequences of the forward and reverse primers for the primer pair Pae1218 are shown in SEQ ID NO: 5-6, respectively. The base sequences of the forward and reverse primers for the primer pair Pae2027 are shown in SEQ ID NO: 7-8, respectively; The base sequences of the forward and reverse primers for the primer pair Pae2333 are shown in SEQ ID NO: 9-10, respectively; The base sequences of the forward and reverse primers for the primer pair Pae1291 are shown in SEQ ID NO: 11-12, respectively; The base sequences of the forward and reverse primers for the primer pair Pae2105 are shown in SEQ ID NO: 13-14, respectively. The base sequences of the forward and reverse primers for the primer pair Pae1271 are shown in SEQ ID NO: 15-16, respectively. The base sequences of the forward and reverse primers for the primer pair Pae217 are shown in SEQ ID NO: 17-18, respectively. The base sequences of the forward and reverse primers for the primer pair Pae347 are shown in SEQ ID NO: 19-20, respectively; In step (3), the multiplex PCR amplification reaction system for group G1 is as follows: ; The multiplex PCR amplification reaction system for group G2 is as follows: 。 2. The application of the method of claim 1 in assessing the genetic diversity of the two-spined seabream.
Citation Information
Patent Citations
Specific primers of acanthopagrus latus microsatellite marker and application of specific primer
CN109055571A
microsatellite marker for identification of geographical origin of Pagrus major and its use
KR102491088B1