Salt-inducible kinase inhibitors

Abstract

The present application provides compounds that modulate the activity of one or more salt-inducible kinases (SIKs). Also provided are pharmaceutical compositions and methods of treating diseases associated with abnormal expression and / or activity of one or more SIKs.

Description

[0001] CLAIM OF PRIORITY

[0002] This application claims priority to U.S. Patent Application Serial No. 63 / 061,515, filed August 5, 2020, the entire contents of which are hereby incorporated by reference.

[0003] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This application was made with government support under Grant Numbers AR067285, DK116716, and AR072150 awarded by the National Institutes of Health. The government has certain rights in the application. TECHNICAL FIELD

[0005] The present application provides compounds that modulate the activity of one or more salt-inducible kinases (SIKs) and are useful in the treatment of diseases associated with SIKs. BACKGROUND

[0006] Currently, analogs of parathyroid hormone (PTH) are the most commonly used bone anabolic treatment option for patients at high risk for osteoporosis. These agents, while effective, are limited in their widespread use by the requirement for daily subcutaneous injection and the risk of hypercalcemia and osteosarcoma (see, e.g., Compston et al., Lancet, 2019, 393(10169):364-376; and Ardura et al., Trends Endocrinol. Metab. 2019, 30(10):756-766). SUMMARY

[0007] The present application provides, inter alia, compounds of Formula I:

[0008]

[0009] or a pharmaceutically acceptable salt thereof, wherein:

[0010] V, W, X, Y, and Z are each independently C or N;

[0011] wherein at least two of V, W, X, Y, and Z are N, and the ring comprising V, W, X, Y, and Z forms a heteroaromatic ring;

[0012] U is CR 3或 N;

[0013] U' is CR 5 or N;

[0014] U" is CR6 or N;

[0015] R 1 selected from C 6-10 aryl, C 3-10 cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (5-10 membered heteroaryl)-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl-, OR a1 , C(O)R b1 , C(O)NR c1 R d1 , NR c1 C(O)R b1 , C(O)OR a1 , OC(O)R b1 , OC(O)NR c1 R d1 and NR c1 C(O)OR a1 , wherein said C 6-10 aryl, said C 3-10 cycloalkyl, said 5-10 membered heteroaryl, said 4-10 membered heterocycloalkyl, said C 6-10 aryl-C 1-6 alkyl-, said C 3-10 cycloalkyl-C 1-6 alkyl-, said (5-10 membered heteroaryl)-C 1-6 alkyl- and said (4-10 membered heterocycloalkyl)-C 1-6 alkyl- are each optionally substituted with 1, 2, 3, or 4 R 1A substituents, each independently selected;

[0016] R a1 , R b1 , R c1 and R d1 are each independently selected from H, C 1-6 alkyl, C 1-6 haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C1-6 alkyl and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein the C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 alkynyl, the C 6-10 aryl, the C 3-10 cycloalkyl, the 4-10 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 aryl-C 1-6 alkyl-, the C 3-10 cycloalkyl-C 1-6 alkyl-, the (4-10 membered heterocycloalkyl)-C 1-6 alkyl and the (5-10 membered heteroaryl)-C 1-6 each alkyl is optionally substituted with 1, 2, 3, or 4 independently selected R 1A substituents;

[0017] or R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl or 10-14 membered heteroaryl, wherein each of the 10-14 membered heterocycloalkyl and the 10-14 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 independently selected R 1A substituents;

[0018] each R 1A is independently selected from halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 1-6 alkoxy, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, NO2, CN, wherein each of the C 1-6 alkyl, the C 2-6 alkenyl, and the C 2-6 alkynyl is optionally substituted with C 1-4 alkoxy;

[0019] R 2 is selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, and C 1-6 alkoxy;

[0020] R 3 is selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C2-6 alkynyl group, C 1-6 Halogenated alkyl and C 1-6 Alkoxy;

[0021] R 4 Selected from H, halogen, C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Haloalkyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 Aryl-C 1-6 Alkyl-, C 3-10 cycloalkyl-C 1-6 Alkyl-, (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl, (5-10-membered heteroaryl)-C 1-6 Alkyl, NO2, CN, OR a4 C(O)R b4 C(O)NR c4 R d4 C(O)N(R) c4 )NR c4 R d4 NR c4 C(O)R b4 C(O)OR a4 OC(O)R b4 OC(O)NR c4 R d4 and NR c4 C(O)OR a4 Wherein C 6-10 Aryl, the C 3-10 Cycloalkyl, the 4-10 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 Aryl-C 1-6 Alkyl-, the C 3-10 cycloalkyl-C 1-6 Alkyl-, the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one, two, three or four independently chosen R groups. 4A Substituent substitution;

[0022] R a4 R b4 R c4 and R d4 Each is independently selected from H and C. 1-6 Alkyl, C 2-6 alkenyl, C2-6 alkynyl group, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy;

[0023] Each R 4A Selected independently from C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy;

[0024] R 5 Selected from H, halogen, C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy;

[0025] Or R 4 and R 5 Together with the carbon atom it is attached to, it forms a 5-6 membered aromatic ring, which is optionally bounded by one, two, three, or four independently selected R atoms. 7 Substituent substitution;

[0026] R 6 Selected from H, C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy;

[0027] Each R 7 Selected independently from C 6-10 Aryl, C 3-10 Cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 Aryl-C 1-6 Alkyl-, C 3-10 cycloalkyl-C 1-6 Alkyl-, (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl, (5-10-membered heteroaryl)-C 1-6 Alkyl, NO2, CN and OR a7 Wherein C 6-10 Aryl, the C 3-10 Cycloalkyl, the 4-14 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 Aryl-C 1-6 Alkyl-, the C 3-10 cycloalkyl-C 1-6 Alkyl-, the (4-10 membered heterocyclic alkyl)-C 1-6alkyl, said (5-10 membered heteroaryl)-C 1-6 each R 7A is optionally substituted with 1, 2, 3, or 4 independently selected R

[0028] each R a7 is independently selected from C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl and (5-10 membered heteroaryl)-C 1-6 alkyl; and

[0029] each R 7A is independently selected from C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 1-6 alkoxy, amino, C 1-6 alkylamino, di(C 1-6 alkyl)amino, phenyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl, 5-6 membered heteroaryl, and wherein said C 1-6 alkyl, said C 2-6 alkenyl and said C 2-6 alkynyl are each optionally substituted with amino or C 1-4 alkoxy.

[0030] In some aspects of the above embodiments, R 4 is selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, (5-10 membered heteroaryl)-C 1-6 alkyl, NO2, CN, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , NRc4 C(O)R b4 , C(O)OR a4 , OC(O)R b4 , OC(O)NR c4 R d4 and NR c4 C(O)OR a4 , wherein the C 6-10 aryl, the C 3-10 cycloalkyl, the 4-10 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 aryl-C 1-6 alkyl-, the C 3-10 cycloalkyl-C 1-6 alkyl-, the (4-10 membered heterocycloalkyl)-C 1-6 alkyl and the (5-10 membered heteroaryl)-C 1-6 alkyl are each optionally substituted with 1, 2, 3, or 4 R 4A substituents, which are independently selected.

[0031] In some embodiments, V, X, and Z are each C, and W and Y are each N.

[0032] In some embodiments, X, Y, and Z are each C, and V and W are each N.

[0033] In some embodiments, V, Y, and Z are each C, and W and X are each N.

[0034] In some embodiments, V and Y are each C, and W, X, and Z are each N.

[0035] In some embodiments, R 1 is selected from 5-10 membered heteroaryl, OR a1 , C(O)NR c1 R d1 and NR c1 C(O)R b1 , wherein the 5-10 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 R 1A substituents, which are independently selected. In some embodiments, R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NR c1 R d1 and NR c1 C(O)R b1 , wherein the 5-6 membered heteroaryl is optionally substituted with 1 or 2 R 1A substituents, which are independently selected.

[0036] In some embodiments, R a1R b1 R c1 and R d1 Each is independently selected from H, 4-10 membered heterocyclic alkyl, (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl groups, wherein the 4-10 membered heterocyclic alkyl group, and the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one or two independently chosen R groups. 1A Substituent substitution;

[0037] Or R c1 and R d1 Together with the nitrogen to which it is attached, it forms a 10-14 membered heterocyclic alkyl or a 10-14 membered heteroaryl.

[0038] In some embodiments, R a1 R b1 R c1 and R d1 Each is independently selected from H, methyl, pyrazolyl, pyridylmethyl, pyridylethyl, imidazo[1,2-a]pyridylmethyl, benzimidazolylmethyl, imidazo[4,5-c]pyridylmethyl, benzoxazolylmethyl, oxetanemethyl, oxetaneethyl, thiohexanebutyl-(1,1-dioxide)methyl, 2-oxespiro[3.3]heptane, and 2-oxespiro[3.5]nonane, wherein the methyl, the pyrazolyl, the pyridyl... The methyl group, the pyridylethyl group, the imidazo[1,2-a]pyridylmethyl group, the benzimidazolylmethyl group, the imidazo[4,5-c]pyridylmethyl group, the benzoxazolylmethyl group, the oxacyclobutylmethyl group, the oxacyclobutylethyl group, the thiohexacyclobutyl-(1,1-dioxide)methyl group, the 2-oxaspiro[3.3]heptyl group, and the 2-oxaspiro[3.5]nonyl group are each optionally selected by one or two independently chosen R groups. 1A Substituent substitution;

[0039] Or R c1 and R d1 Together with the nitrogen to which it is attached, it forms 1,2,3,4-tetrahydrobenzo[4,5]imidazo[1,2-a]pyrazinyl.

[0040] In some embodiments, each R 1A Selected independently from C 1-6 Alkyl, C 3-10 Cycloalkyl, 4-10 membered heterocyclic alkyl and CN, wherein each C 1-6 Alkyl groups are optionally C 1-4alkoxy. In some embodiments, R 1A is independently selected from methyl, ethyl, methoxymethyl, cyclopropyl, oxetanyl, and CN.

[0041] In some embodiments, R 2 is selected from H and C 1-6 alkyl. In some embodiments, R 2 is selected from H and methoxy.

[0042] In some embodiments, U is CR 3 . In some embodiments, R 3 is selected from H, halo, and C 1-6 alkyl. In some embodiments, R 3 is selected from H, fluoro, chloro, and methoxy.

[0043] In some embodiments, U is N.

[0044] In some embodiments, U" is CR 6 . In some embodiments, R 6 is selected from H and C 1-6 alkyl. In some embodiments, R 6 is H.

[0045] In some embodiments, U" is N.

[0046] In some embodiments, R 4 is selected from H, 5-10 membered heteroaryl, CN, and C(O)NR c4 R d4 , wherein the 5-10 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 independently selected R 4A substituents.

[0047] In some embodiments, R 4 is selected from H, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4 , wherein the 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 4A substituents.

[0048] In some embodiments, R c4 and R d4 are each independently selected from H, C 1-6 alkyl, and C 1-6 haloalkyl.

[0049] In some embodiments, R c4 and R d4 are each independently selected from H, ethyl, and trifluoroethyl.

[0050] In some embodiments, R 4 is selected from H, CN, oxadiazolyl, and C(O)NHCH2CF3, wherein the oxadiazolyl is optionally substituted with 1 or 2 R 4A substituents.

[0051] In some embodiments, each R 4A is an independently selected C 1-6 alkyl. In some embodiments, each R 4A is ethyl.

[0052] In some embodiments, U' is CR 5 . In some embodiments, R 5 is selected from H, halo, C 1-6 alkyl, and C 1-6 alkoxy. In some embodiments, R 5 is selected from H, fluoro, chloro, methyl, and methoxy.

[0053] In some embodiments, U' is N.

[0054] In some embodiments, R 4 and R 5 together with the carbon atom to which they are attached form a 5-6 membered aromatic ring optionally substituted with 1, 2, 3, or 4 independently selected R 7 substituents. In some embodiments, R 4 and R 5 together with the carbon atom to which they are attached form a 6 membered aromatic ring optionally substituted with 1 or 2 independently selected R 7 substituents.

[0055] In some embodiments, each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 , wherein the C 3-10 cycloalkyl, the 4-14 membered heterocycloalkyl, and the 5-10 membered heteroaryl are each optionally substituted with 1 or 2 independently selected R 7A substituents.

[0056] In some embodiments, each R a7 is an independently selected 4-10 membered heterocycloalkyl. In some embodiments, each R a7 is azetidinyl.

[0057] In some embodiments, each R 7independently selected from bicyclo[l. l. l]pentanyl, azetidinyl, pyrrolidinyl, piperidinyl, morpholinyl, imidazolyl, azaspiro[3.3]heptanyl, diazaspiro[3.5]nonanyl, oxadiazaspiro[5.5]undecanyl, diazaspiro[4.4]nonanyl, and azetidinyloxy, wherein the bicyclo[l. l. l]pentanyl, the azetidinyl, the pyrrolidinyl, the piperidinyl, the morpholinyl, the imidazolyl, the azaspiro[3.3]heptanyl, the diazaspiro[3.5]nonanyl, the oxadiazaspiro[5.5]undecanyl, and the diazaspiro[4.4]nonanyl are each optionally substituted with 1 or 2 R 7A substituents.

[0058] In some embodiments, each R 7A is independently selected from C 1-6 alkyl, amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy. In some embodiments, each R 7A is independently selected from methyl, methoxyethyl, aminomethyl, amino, cyclopropyl, and oxetanyl.

[0059] In some embodiments:

[0060] V, X, and Z are each C, and W and Y are each N; or

[0061] X, Y, and Z are each C, and V and W are each N; or

[0062] V, Y, and Z are each C, and W and X are each N; or

[0063] V and Y are each C, and W, X, and Z are each N;

[0064] R 1 is selected from 5-10 membered heteroaryl, OR a1 , C(O)NR c1 R d1 , and NR c1 C(O)R b1 , wherein the 5-10 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 independently selected R 1A substituents;

[0065] R a1 , R b1 , R c1 , and R d1 are each independently selected from H, 4-10 membered heterocycloalkyl, (4-10 membered heterocycloalkyl)-C 1-6Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl groups, wherein the 4-10 membered heterocyclic alkyl group, and the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one or two independently chosen R groups. 1A Substituent substitution;

[0066] Or R c1 and R d1 Together with the nitrogen to which it is attached, it forms a 10-14 membered heterocyclic alkyl group or a 10-14 membered heteroaryl group;

[0067] Each R 1A Selected independently from C 1-6 Alkyl, C 3-10 Cycloalkyl, 4-10 membered heterocyclic alkyl and CN, wherein each C 1-6 Alkyl groups are optionally C 1-4 Alkyl substitution;

[0068] R 2 For H or C 1-6 Alkoxy;

[0069] U is CR 3或 N;

[0070] U' is CR 5 Or N;

[0071] U" is CR 6 Or N;

[0072] R 3 Selected from H, halogen and C 1-6 Alkoxy;

[0073] R 4 Selected from H, 5-10 heteroaryl groups, CN and C(O)NR c4 R d4 The 5-10 heteroaryl group is optionally composed of one, two, three, or four independently selected R groups. 4A Substituent substitution;

[0074] R c4 and R d4 Each is independently selected from H and C. 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0075] Each R 4A C chosen independently 1-6 alkyl;

[0076] R 5 Selected from H, halogen, C 1-6alkyl and C 1-6 alkoxy;

[0077] or R 4 and R 5 together with the carbon atom to which they are attached form a 5-6 membered aromatic ring, which is optionally substituted with 1, 2, 3, or 4 independently selected R 7 substituents;

[0078] R 6 is selected from H and C 1-6 alkyl;

[0079] each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 , wherein the C 3-10 cycloalkyl, the 4-14 membered heterocycloalkyl, and the 5-10 membered heteroaryl are each optionally substituted with 1 or 2 independently selected R 7A substituents;

[0080] each R a7 is an independently selected 4-10 membered heterocycloalkyl; and

[0081] each R 7A is independently selected from C 1-6 alkyl, amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy.

[0082] In some embodiments:

[0083] V, X, and Z are each C, and W and Y are each N; or

[0084] X, Y, and Z are each C, and V and W are each N; or

[0085] V, Y, and Z are each C, and W and X are each N; or

[0086] V and Y are each C, and W, X, and Z are each N;

[0087] R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NR c1 R d1 , and NR c1 C(O)R b1 , wherein the 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 1A substituents;

[0088] R a1 , R b1 , R c1 and R d1 are each independently selected from H, 4-10 membered heterocycloalkyl, (4-10 membered heterocycloalkyl)-C 1-6 alkyl and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein said 4-10 membered heterocycloalkyl, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl and said (5-10 membered heteroaryl)-C 1-6 alkyl are each optionally substituted with 1 or 2 R 1A substituents independently selected;

[0089] or R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl or 10-14 membered heteroaryl;

[0090] each R 1A is independently selected from C 1-6 alkyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl and CN, wherein each C 1-6 alkyl is optionally substituted with C 1-4 alkoxy;

[0091] R 2 is H or C 1-6 alkoxy;

[0092] U is CR 3或 N;

[0093] U' is CR 5 or N;

[0094] U" is CR 6 or N;

[0095] R 3 is selected from H, halo and C 1-6 alkoxy;

[0096] R 4 is selected from H, 5-6 membered heteroaryl, CN and C(O)NR c4 R d4 , wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 R 4A substituents independently selected;

[0097] R c4 and R d4 are each independently selected from H, C 1-6 alkyl and C 1-6 haloalkyl;

[0098] each R 4A is independently selected C 1-6 alkyl;

[0099] R 5 is selected from H, halo, C 1-6 alkyl and C 1-6 alkoxy;

[0100] or R 4 and R 5 together with the carbon atom to which they are attached form a 6-membered aromatic ring optionally substituted with 1 or 2 independently selected R 7 substituents;

[0101] each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 , wherein the C 3-10 cycloalkyl, the 4-14 membered heterocycloalkyl, and the 5-10 membered heteroaryl are each optionally substituted with 1 or 2 independently selected R 7A substituents;

[0102] each R a7 is independently selected 4-10 membered heterocycloalkyl; and

[0103] each R 7A is independently selected from C 1-6 alkyl, amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy.

[0104] In some embodiments:

[0105] V, X, and Z are each C, and W and Y are each N; or

[0106] X, Y, and Z are each C, and V and W are each N; or

[0107] V, Y, and Z are each C, and W and X are each N; or

[0108] V and Y are each C, and W, X, and Z are each N;

[0109] R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NR c1 R d1 , and NR c1 C(O)R b1wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 1A substituents;

[0110] R a1 , R b1 , R c1 , and R d1 each independently is selected from H, methyl, pyrazolyl, pyridinylmethyl, pyridinylethyl, imidazo[l,2-a]pyridinylmethyl, benzoimidazolylmethyl, imidazo[4,5- c]pyridinylmethyl, benzoxazolylmethyl, oxetanylmethyl, oxetanylethyl, thietanyl-(l,l-dioxide)methyl, 2-oxaspiro[3.3]heptyl, and 2-oxaspiro[3.5]nonanyl, wherein said methyl, said pyrazolyl, said pyridinylmethyl, said pyridinylethyl, said imidazo[l,2-a]pyridinylmethyl, said benzoimidazolylmethyl, said imidazo[4,5-c]pyridinylmethyl, said benzoxazolylmethyl, said oxetanylmethyl, said oxetanylethyl, said thietanyl-(l,l-dioxide)methyl, said 2-oxaspiro[3.3]heptyl, and said 2-oxaspiro[3.5]nonanyl are each optionally substituted with 1 or 2 independently selected R 1A substituents;

[0111] or R c1 and R d1 together with the nitrogen to which they are attached form a 1,2,3,4-tetrahydrobenzo[4,5]imidazo[l,2-a]pyrazinyl;

[0112] each R 1A is independently selected from methyl, ethyl, methoxymethyl, and CN;

[0113] R 2 is H or C 1-6 alkoxy;

[0114] U is CR 3或 N;

[0115] U' is CR 5 or N;

[0116] U" is CR 6 or N;

[0117] R 3 is selected from H, halo, and C 1-6 alkoxy;

[0118] R 4 is selected from H, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 4A substituents;

[0119] R c4 and R d4 are each independently selected from H, C 1-6 alkyl, and C 1-6 haloalkyl;

[0120] each R 4A is an independently selected C 1-6 alkyl;

[0121] R 5 is selected from H, halo, C 1-6 alkyl, and C 1-6 alkoxy;

[0122] or R 4 and R 5 together with the carbon atom to which they are attached form a 6-membered aromatic ring, said 6-membered aromatic ring optionally substituted with 1 or 2 independently selected R 7 substituents;

[0123] each R 7 is independently selected from bicyclo[l.l.l]pentanyl, azetidinyl, pyrrolidinyl, piperidinyl, morpholinyl, imidazolyl, azaspiro[3.3]heptanyl, diazaspiro[3.5]nonanyl, oxadiazaspiro[5.5]undecanyl, diazaspiro[4.4]nonanyl, and azetidinyloxy, wherein said bicyclo[l.l.l]pentanyl, said azetidinyl, said pyrrolidinyl, said piperidinyl, said morpholinyl, said imidazolyl, said azaspiro[3.3]heptanyl, said diazaspiro[3.5]nonanyl, said oxadiazaspiro[5.5]undecanyl, and said diazaspiro[4.4]nonanyl are each optionally substituted with 1 or 2 R 7A substituents; and

[0124] each R 7A is independently selected from methyl, methoxyethyl, aminomethyl, amino, cyclopropyl, and oxetanyl.

[0125] In some embodiments, the compound of Formula I is a compound of Formula II:

[0126]

[0127] or a pharmaceutically acceptable salt thereof.

[0128] In some embodiments, the compound of Formula I is a compound of Formula III:

[0129]

[0130] or a pharmaceutically acceptable salt thereof.

[0131] In some embodiments, the compound of Formula I is a compound of Formula IV:

[0132]

[0133] or a pharmaceutically acceptable salt thereof.

[0134] In some embodiments, the compound of Formula I is a compound of Formula V:

[0135]

[0136] or a pharmaceutically acceptable salt thereof.

[0137] In some embodiments, the compound provided herein is selected from:

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145] or a pharmaceutically acceptable salt thereof.

[0146] In some embodiments, the compound of Formula (I) has the formula:

[0147]

[0148] or a pharmaceutically acceptable salt thereof.

[0149] The application further provides pharmaceutical compositions comprising a compound provided herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0150] The application further provides methods of inhibiting the activity of salt-inducible kinase (SIK), comprising contacting the kinase with a compound provided herein, or a pharmaceutically acceptable salt thereof.

[0151] In some embodiments, the compound provided herein is a selective inhibitor of salt-inducible kinase 2 (SIK2) and salt-inducible kinase 3 (SIK3) and not one of salt-inducible kinase 1 (SIK1).

[0152] The application further provides a method of treating a disease in a patient, wherein the disease is associated with abnormal expression or activity of a salt-inducible kinase, the method comprising administering to the patient a therapeutically effective amount of a compound provided herein, or a pharmaceutically acceptable salt thereof.

[0153] In some embodiments, the salt-inducible kinase is one or more of salt-inducible kinase 2 (SIK2) and salt-inducible kinase 3 (SIK3).

[0154] In some embodiments, the disease is selected from cancer, inflammatory bowel disease, diabetes, skin pigmentation disorder, osteoporosis, and musculoskeletal disease.

[0155] In some embodiments, the disease is cancer. In some embodiments, the cancer is selected from ovarian cancer, breast cancer, acute myeloid leukemia, and multiple myeloma.

[0156] In some embodiments, the disease is inflammatory bowel disease.

[0157] In some embodiments, the disease is diabetes.

[0158] In some embodiments, the disease is a skin pigmentation disorder.

[0159] In some embodiments, the disease is osteoporosis.

[0160] In some embodiments, the disease is osteoarthritis.

[0161] In some embodiments, the disease is a musculoskeletal disease.

[0162] In some embodiments, the disease is inflammatory arthritic skin rash. In some embodiments, the inflammatory arthritic skin rash is rheumatoid arthritis.

[0163] In some embodiments, the treatment comprises one or more of increasing bone formation in the patient, increasing bone anabolic metabolism in the patient, and increasing bone mass in the patient.

[0164] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Methods and materials are described herein for use of the present application; other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. BRIEF DESCRIPTION OF DRAWINGS

[0165] Figure 1A PTH and SIKi treatment increases bone density and bone formation rate. Shown are femur micro-CT showing increased bone mass after whole body / induced SIK2 / 3 deletion. SIK2 / 3 floxed mice were crossed with ubiquitin-Cre

[0166] Figure 1B Fasting blood glucose and BUN levels are elevated in response to 4 week YKL-05-099 treatment of mice. Shown are serum markers showing increased bone formation (P1NP) but no change in BUN and glucose in SIK2 / 3 mutants. SIK2 / 3 floxed mice were crossed with ubiquitin-Cre

[0167] Figure 2A Fasting blood glucose and BUN levels are elevated in response to 4 week YKL-05-099 treatment of mice. Shown are serum markers showing increased bone formation (P1NP) but no change in BUN and glucose in SIK2 / 3 mutants. SIK2 / 3 floxed mice were crossed with ubiquitin-Cre ERt2 Animal cross. Mice at 6 weeks of age were treated with tamoxifen for 3 weeks before analysis. Controls (SIK2 / 3 floxed, but negative for ubiquitin-Cre ERt2 transgene) were also treated with tamoxifen.

[0168] Figure 2B Fasting blood glucose and BUN levels are elevated in response to 4 week YKL-05-099 treatment of mice. Shown are serum markers showing increased bone formation (P1NP) but no change in BUN and glucose in SIK2 / 3 mutants. SIK2 / 3 floxed mice were crossed with ubiquitin-Cre ERt2 Animal cross. Mice at 6 weeks of age were treated with tamoxifen for 3 weeks before analysis. Controls (SIK2 / 3 floxed, but negative for ubiquitin-Cre ERt2 transgene) were also treated with tamoxifen.

[0169] Figure 3The relationship between in vitro SIK2 inhibition and cellular activity across 80 representative compounds is shown. CRTC2 is a SIK2 / 3 substrate that translocates to the nucleus upon dephosphorylation. A relationship was observed where potent SIK2 inhibitors also stimulate CRTC2 translocation in cells.

[0170] Figure 4A Nuclear CRTC2 translocation in U20S CRTC2 (TORC2) PathHunter cells treated with the indicated doses of the compound of Example 51 is shown (presented as % of positive control (forskolin) signal).

[0171] Figure 4B SOST and RANKL expression in Ocy454 cells treated with the indicated doses of the compound of Example 51 is shown, measured by RT-qPCR.

[0172] Figure 4C HDAC4 / 5 phosphorylation in Ocy454 cells treated with the indicated doses of the compound of Example 51 is shown.

[0173] Figure 5A The results of the following experiment are shown: Ocy454 cells grown for 7 days at 37°C were treated with the indicated doses of SK-124 for 2 hours, after which immunoblots for phosphorylated HDAC4 / 5 (S246 / S259, top) and total HDAC5 (bottom) were performed. Compound 51 treatment decreased phosphorylated HDAC4 / 5 levels without affecting total protein levels of these SIK substrates.

[0174] Figure 5B The results of the following experiment are shown: Ocy454 cells grown for 14 days at 37°C were treated with the indicated doses of compound 51 for 4 hours, after which RT-qPCR for SOST (blue, left axis) and RANKL (blue, right axis) was performed. Compound increased RANKL expression and inhibited SOST expression.

[0175] Figure 6A The results of the following experiment are shown: SIK isoform nanoBRET assays were performed by Reaction Biology in HEK293T cells in response to compound 51.

[0176] Figure 6B The results of the following experiment are shown: SIK isoform nanoBRET assays were performed by Reaction Biology in HEK293T cells in response to compound 55.

[0177] Figure 6CResults from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0178] Figure 7 A flow chart showing the in vivo study design for testing the effects of compound 51 on bone and mineral metabolism endpoints is shown. For oral gavage, compound 51 was dissolved in a vehicle solution of 15% hydroxy-propyl-beta-cyclodextrin in sterile water.

[0179] Figure 8A Results from the next experiment are shown: mice in the indicated treatment groups were weighed twice per week. No differences in body weight were noted between the different treatment groups.

[0180] Figure 8B Results from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0181] Figure 9A Results from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0182] Figure 9B Results from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0183] Figure 9C Results from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0184] Figure 9D Results from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0185] Figure 9E Results from the next experiment are shown: serum was collected 2 hours after oral gavage on study day 13 and compound 51 levels were measured by mass spectrometry. A dose-dependent increase in compound 51 levels was observed in the 3 treatment groups.

[0186] Figure 10A Results from the following experiment are shown: P1NP (a marker of bone formation) was measured in serum collected in Figures 9A-9E Compound 51 treatment showed PTH-like benefit by increasing this marker of bone remodeling in the 40 mg / kg treated group.

[0187] Figure 10B Results from the following experiment are shown: CTX (a marker of bone resorption) was measured in serum collected in Figures 9A-9E Compound 51 treatment showed PTH-like benefit by increasing this marker of bone remodeling in the 40 mg / kg treated group.

[0188] Figure 11A Data from the femur of mice treated for 3 weeks as indicated (vehicle, Compound 51 : 40 mg / kg and PTH 80 meg / kg) are shown. Representative images from micro-CT scans are shown, arrows indicate increased trabecular bone in the primary spongiosa region of the distal femur.

[0189] Figure 11B Analysis of trabecular bone in the primary spongiosa (PS) of the distal femur is shown. Analysis indicates that Compound 51 treatment increased the bone volume fraction (BV / TV) at this skeletal site.

[0190] Figure 11C Analysis of trabecular bone in the primary spongiosa (PS) of the distal femur is shown. Analysis indicates that Compound 51 treatment increased the bone mineral density (BMD) at this skeletal site.

[0191] Figure 11D Analysis of mid-shaft cortical bone tissue mineral density (TMD) is shown. Analysis revealed a gain in bone mass at this skeletal site in response to Compound 51.

[0192] Figure 12 Images showing the results from the following experiment are shown: tibiae from experimental mice were decalcified for paraffin-embedded sections. The top row shows hematoxylin-eosin staining, which shows increased trabecular bone and increased osteoblasts in mice treated with Compound 51 (40 mg / kg) and PTH. The bottom row shows images of TRAP staining, which indicates increased osteoblasts on the trabecular surface (black) in response to Compound 51 treatment and PTH treatment.

[0193] Figure 13A Histomorphometry results from the distal femoral metaphysis are shown. Compound 51 treatment and PTH treatment increased the bone volume fraction (BV / TV).

[0194] Figure 13BHistomorphometric results are shown for the distal femoral metaphysis. Compound 51 treatment and PTH treatment increased the number of osteoblasts in primary bone marrow (N.Oc / B.Pm).

[0195] Figure 13C Histomorphometric results are shown for the distal femoral metaphysis. Compound 51 treatment and PTH treatment increased the number of osteoblasts (Ob.S.BS).

[0196] Figure 13D Histomorphometric results are shown for the distal femoral metaphysis: neither Compound 51 treatment nor PTH treatment increased the mineralizing surface (MS / BS) at this skeletal site.

[0197] Figure 13E Histomorphometric results are shown for the distal femoral metaphysis. Compound 51 treatment and PTH treatment increased the rate of matrix deposition (MAR).

[0198] Figure 13F Histomorphometric results are shown for the distal femoral metaphysis. Compound 51 treatment and PTH treatment increased the rate of bone formation (BFR / BS).

[0199] Figure 14 Representative images are shown indicating increased distance between the calcein / demeclocycline dye fronts in mice treated with Compound 51 (40 mg / kg) and PTH.

[0200] Figure 15A Results from the next experiment are shown: cortical bone RNA was isolated after 3 weeks of compound treatment, followed by RT-qPCR. Spp1 (osteopontin) is a well-established osteoblast marker gene whose expression was increased by Compound 51 treatment and PTH treatment.

[0201] Figure 15B Results from the next experiment are shown: cortical bone RNA was isolated after 3 weeks of compound treatment, followed by RT-qPCR. Ctsk (cathepsin K) is a well-established osteoblast marker gene whose expression was increased by Compound 51 treatment and PTH treatment.

[0202] Figure 16A Sost mRNA was measured in cortical bone by RT-qPCR. Both Compound 51 and PTH decreased sclerostin gene expression.

[0203] Figure 16B Sclerostin was evaluated in bone sections by immunohistochemistry. Bar graphs show quantification of sclerostin-positive osteocytes in the indicated treatment groups.

[0204] Figure 16C Bone sclerostin protein was assessed by immunohistochemistry in bone sections. Images show bone sclerostin positive (dark) osteocytes.

[0205] Figure 17 Chemical structure of compound 55A intro IC 50 Values. DETAILED DESCRIPTION

[0206] Recent reports describe the signaling pathway used by PTH in its target cells in bone (see, e.g., Wein et al., Nature Communications, 2016, 7:13176; Wein et al., Trends Endocrinol Metab. 2018; and Nishimori et al., J. Clin. Invest. 2019). One step in this cascade is that PTH signaling causes PKA-dependent inhibition of salt-inducible kinase (SIK). Small molecule SIK inhibitors, such as YKL-05-099 (see, e.g., Sundberg et al., ACS chemical biology, 2016; and Tarumoto et al., Blood, 2019), a tool compound that inhibits all 3 SIK isoforms, mimic the effects of PTH (see, e.g., Wein et al., Nature Communications, 2016, 7:13176). The efficacy of YKL-05-099 has been tested in mice rendered hypogonadal by surgical removal of the ovaries, a model of postmenopausal osteoporosis. YKL-05-099 showed comparable / more superior efficacy in promoting bone formation and bone mass compared to daily injections of PTH, as shown in Figure 1A However, hyperglycemia and impaired kidney function were observed in mice treated with this non-specific tool SIK inhibitor, as shown in Figure 1B Genetics in mice suggest that a specific SIK2 / 3 inhibitor can be sufficient to promote bone formation and bone mass (see, e.g., Nishimori et al., J. Clin. Invest. 2019). Therefore, mice were generated in which SIK2 / 3 can be globally deleted in a tamoxifen-dependent manner to assess the safety and bone efficacy of selective SIK2 / 3 deletion in adult animals. Induced SIK2 / 3 deletion was found to increase bone anabolic effects with no effects on blood glucose or BUN, as shown in Figure 2.

[0207] The present application provides new SIK2 / 3 inhibitors with improved potency, selectivity, and drug-like properties. The compounds have been tested for SIK inhibition, stimulation of CRTC2 nuclear translocation, and modulation of osteoblast gene expression and differentiation, as shown in Figure 3 The kinome selectivity, microbiological stability, CYP isoform inhibition, kinetic solubility, plasma protein binding, Caco2 efflux, and high dose mouse PK of selected compounds that inhibit SIK2 / 3 to a greater extent than SIK1 with cellular efficacy have been tested, with quite favorable results observed (e.g., sub-nM potency against SIK2 / 3 and favorable kinome selectivity).

[0208] In addition to osteoporosis, SIK inhibitors have been investigated as research tools and potential therapeutics for cancer (see, e.g., Miranda et al., Cancer Cell, 2016, 30(2):273-289; Zhou et al., Clinical Cancer Research: An Official Journal of the American Association for Cancer Research, 2016; Tarumoto et al., Molecular Cell, 2018, 69(6):1017-1027e6; and Maxfield et al., Mol. Cell Biol. 2016, 36(24):3048-3057), inflammatory bowel disease (see, e.g., Sundberg et al., ACS Chemical Biology, 2016), diabetes (see, e.g., Sakamoto et al., Endocrine and Metabolic Trends, 2018, 29(12):827-840), and skin pigmentation (see, e.g., Mujahid et al., Cell Reports, 2017, 19(11):2177-2184). Thus, the compounds provided herein can be used to treat the indicated indications and other indications associated with one or more SIKs (e.g., SIK2 and / or SIK3).

[0209] Compounds

[0210] The present application provides compounds of Formula I:

[0211]

[0212] or a pharmaceutically acceptable salt thereof, wherein:

[0213] V, W, X, Y, and Z are each independently C or N;

[0214] wherein at least two of V, W, X, Y, and Z are N, and the ring comprising V, W, X, Y, and Z forms a heteroaromatic ring;

[0215] U is CR 3或 N;

[0216] U' is CR 5 or N;

[0217] U" is CR 6 or N;

[0218] R 1 is selected from C 6-10 aryl, C 3-10 cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (5-10 membered heteroaryl)-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl-, OR a1 , C(O)R b1 , C(O)NR c1 R d1 , NR c1 C(O)R b1 , C(O)OR a1 , OC(O)R b1 , OC(O)NR c1 R d1 and NR c1 C(O)OR a1 , wherein said C 6-10 aryl, said C 3-10 cycloalkyl, said 5-10 membered heteroaryl, said 4-10 membered heterocycloalkyl, said C 6-10 aryl-C 1-6 alkyl-, said C 3-10 cycloalkyl-C 1-6 alkyl-, said (5-10 membered heteroaryl)-C 1-6 alkyl-, and said (4-10 membered heterocycloalkyl)-C 1-6 alkyl- are each optionally substituted with 1, 2, 3, or 4 R 1A substituents, which are independently selected;

[0219] R a1 , R b1 , R c1 , and R d1each independently selected from H, C 1-6 alkyl, C 1-6 haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein the C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 alkynyl, the C 6-10 aryl, the C 3-10 cycloalkyl, the 4-10 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 aryl-C 1-6 alkyl-, the C 3-10 cycloalkyl-C 1-6 alkyl-, the (4-10 membered heterocycloalkyl)-C 1-6 alkyl and the (5-10 membered heteroaryl)-C 1-6 each R 1A is optionally substituted with 1, 2, 3, or 4 independently selected R

[0220] or R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl or 10-14 membered heteroaryl, wherein the 10-14 membered heterocycloalkyl and the 10-14 membered heteroaryl are each optionally substituted with 1, 2, 3, or 4 independently selected R 1A substituents;

[0221] each R 1A is independently selected from halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 1-6 alkoxy, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, NO2, CN, wherein the C 1-6 alkyl, the C 2-6 alkenyl, and the C 2-6 alkynyl are each optionally substituted with C 1-4 alkoxy;

[0222] R 2 selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl and C 1-6 alkoxy;

[0223] R 3 selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl and C 1-6 alkoxy;

[0224] R 4 selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl and (5-10 membered heteroaryl)-C 1-6 alkyl, NO2, CN, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , NR c4 C(O)R b4 , C(O)OR a4 , OC(O)R b4 , OC(O)NR c4 R d4 and NR c4 C(O)OR a4 , wherein the C 6-10 aryl, the C 3-10 cycloalkyl, the 4-10 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 aryl-C 1-6 alkyl-, the C 3-10 cycloalkyl-C 1-6 alkyl-, the (4-10 membered heterocycloalkyl)-C 1-6 alkyl and the (5-10 membered heteroaryl)-C 1-6each alkyl is optionally substituted with 1, 2, 3, or 4 R 4A substituents;

[0225] R a4 , R b4 , R c4 , and R d4 are each independently selected from H, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, and C 1-6 alkoxy;

[0226] each R 4A is independently selected from C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, and C 1-6 alkoxy;

[0227] R 5 is selected from H, halo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, and C 1-6 alkoxy;

[0228] or R 4 and R 5 together with the carbon atom to which they are attached form a 5-6 membered aromatic ring, which is optionally substituted with 1, 2, 3, or 4 R 7 substituents;

[0229] R 6 is selected from H, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, and C 1-6 alkoxy;

[0230] each R 7 is independently selected from C 6-10 aryl, C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, (5-10 membered heteroaryl)-C 1-6 alkyl, NO2, CN, and ORa7 wherein the C 6-10 aryl, the C 3-10 cycloalkyl, the 4-14 membered heterocycloalkyl, the 5-10 membered heteroaryl, the C 6-10 aryl-C 1-6 alkyl-, the C 3-10 cycloalkyl-C 1-6 alkyl-, the (4-10 membered heterocycloalkyl)-C 1-6 alkyl, the (5-10 membered heteroaryl)-C 1-6 alkyl groups are each optionally substituted with 1, 2, 3, or 4 independently selected R 7A substituents;

[0231] each R a7 is independently selected from C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, C 6-10 aryl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and (5-10 membered heteroaryl)-C 1-6 alkyl; and

[0232] each R 7A is independently selected from C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 1-6 alkoxy, amino, C 1-6 alkylamino, di(C 1-6 alkyl)amino, phenyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl, 5-6 membered heteroaryl, and wherein the C 1-6 alkyl, the C 2-6 alkenyl, and the C 2-6 alkynyl groups are each optionally substituted with amino or C 1-4 alkoxy.

[0233] In some embodiments, two of V, W, X, Y, and Z are N.

[0234] In some embodiments, three of V, W, X, Y, and Z are N.

[0235] In some embodiments, four of V, W, X, Y, and Z are N.

[0236] In some embodiments, V, X, and Z are each C, and W and Y are each N.

[0237] In some embodiments, X, Y, and Z are each C, and V and W are each N.

[0238] In some embodiments, V, Y, and Z are each C, and W and X are each N.

[0239] In some embodiments, V and Y are each C, and W, X, and Z are each N.

[0240] In some embodiments, R 1 is selected from phenyl, C 3-6 cycloalkyl, 5-6 membered heteroaryl, 4-6 membered heterocycloalkyl, OR a1 , C(O)NR c1 R d1 , and NR c1 C(O)R b1 , C(O)OR a1 , OC(O)R b1 , OC(O)NR c1 R d1 , and NR c1 C(O)OR a1 , wherein the phenyl, the C 3-6 cycloalkyl, the 5-10 membered heteroaryl, and the 4-6 membered heterocycloalkyl are each optionally substituted with 1, 2, 3, or 4 R 1A substituents, which are independently selected.

[0241] In some embodiments, R 1 is selected from 5-10 membered heteroaryl, OR a1 , C(O)NR c1 R d1 , and NR c1 C(O)R b1 , wherein the 5-10 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 R 1A substituents, which are independently selected.

[0242] In some embodiments, R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NR c1 R d1 , and NR c1 C(O)R b1 , wherein the 5-6 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 R 1A substituents, which are independently selected.

[0243] In some embodiments, R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NRc1 R d1 and NR c1 C(O)R b1 wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 1A substituents.

[0244] In some embodiments, R a1 , R b1 , R c1 , and R d1 are each independently selected from H, 4-10 membered heterocycloalkyl, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein said 4-10 membered heterocycloalkyl, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and said (5-10 membered heteroaryl)-C 1-6 alkyl are each optionally substituted with 1 or 2 independently selected R 1A substituents;

[0245] or R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl or 10-14 membered heteroaryl.

[0246] In some embodiments, R a1 , R b1 , R c1 , and R d1 are each independently selected from H, 4-10 membered heterocycloalkyl, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein said 4-10 membered heterocycloalkyl, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and said (5-10 membered heteroaryl)-C 1-6 alkyl are each optionally substituted with 1, 2, 3, or 4 independently selected R 1A substituents.

[0247] In some embodiments, R a1 , R b1 , R c1 , and R d1 are each independently selected from H, 4-10 membered heterocycloalkyl, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein said 4-10 membered heterocycloalkyl, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl, and said (5-10 membered heteroaryl)-C 1-6each alkyl is optionally substituted with 1 or 2 independently selected R 1A substituted.

[0248] In some embodiments, R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl or a 10-14 membered heteroaryl.

[0249] In some embodiments, R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl.

[0250] In some embodiments, R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heteroaryl.

[0251] In some embodiments, R a1 , R b1 , R c1 and R d1 are each independently selected from H, methyl, pyrazolyl, pyridinylmethyl, pyridinylethyl, imidazo[l,2-a]pyridinylmethyl, benzoimidazolylmethyl, imidazo[4,5-c]pyridinylmethyl, benzoxazolylmethyl, oxetanylmethyl, oxetanylethyl, thietanyl-(l,l-dioxide)methyl, 2-oxaspiro[3.3]heptyl, and 2-oxaspiro[3.5]nonanyl, wherein the methyl, the pyrazolyl, the pyridinylmethyl, the pyridinylethyl, the imidazo[l,2-a]pyridinylmethyl, the benzoimidazolylmethyl, the imidazo[4,5-c]pyridinylmethyl, the benzoxazolylmethyl, the oxetanylmethyl, the oxetanylethyl, the thietanyl-(l,l-dioxide)methyl, the 2-oxaspiro[3.3]heptyl, and the 2-oxaspiro[3.5]nonanyl are each optionally substituted with 1 or 2 independently selected R 1A substituents;

[0252] or R c1 and R d1 together with the nitrogen to which they are attached form a 1,2,3,4-tetrahydrobenzo[4,5]imidazo[l,2-a]pyrazinyl.

[0253] In some embodiments, each R 1A is independently selected from C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 haloalkyl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, and CN, wherein the C1-6 alkyl, the C 2-6 alkenyl, and the C 2-6 alkynyl are each optionally substituted with C 1-4 alkoxy.

[0254] In some embodiments, each R 1A is independently selected from C 1-6 alkyl, C 1-6 haloalkyl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, and CN, wherein the C 1-6 alkyl is optionally substituted with C 1-4 alkoxy.

[0255] In some embodiments, each R 1A is independently selected from C 1-6 alkyl, C 1-6 haloalkyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl, and CN, wherein the C 1-6 alkyl is optionally substituted with C 1-4 alkoxy.

[0256] In some embodiments, each R 1A is independently selected from C 1-6 alkyl, and CN, wherein each C 1-6 alkyl is optionally substituted with C 1-4 alkoxy.

[0257] In some embodiments, each R 1A is independently selected from C 1-4 alkyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl, and CN, wherein each C 1-4 alkyl is optionally substituted with methoxy.

[0258] In some embodiments, each R 1A is independently selected from C 1-4 alkyl, and CN, wherein each C 1-4 alkyl is optionally substituted with methoxy.

[0259] In some embodiments, each R 1A is independently selected from methyl, ethyl, methoxymethyl, cyclopropyl, oxetanyl, and CN.

[0260] In some embodiments, R 2 is selected from H, C 1-6 alkyl, C 1-6 haloalkyl, and C 1-6 alkoxy.

[0261] In some embodiments, R 2Selected from H, C 1-6 Alkyl and C 1-6 Alkyl group.

[0262] In some embodiments, R 2 Selected from H and C 1-6 Alkyl group.

[0263] In some embodiments, R 2 Selected from H and C 1-4 Alkyl group.

[0264] In some embodiments, R 2 Selected from H and methoxy groups.

[0265] In some embodiments, R 2 For H.

[0266] In some embodiments, R 2 It is a methoxy group.

[0267] In some embodiments, U is CR 3 .

[0268] In some embodiments, R 3 Selected from H, halogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 Alkyl group.

[0269] In some embodiments, R 3 Selected from H, halogen, C 1-6 Alkyl and C 1-6 Alkyl group.

[0270] In some embodiments, R 3 Selected from H, halogen and C 1-6 Alkyl group.

[0271] In some embodiments, R 3 Selected from H, halogen and C 1-4 Alkyl group.

[0272] In some embodiments, R 3 Selected from H, fluorine, chlorine and methoxy groups.

[0273] In some embodiments, R 3 For H.

[0274] In some embodiments, R 3 It is fluorine-based.

[0275] In some embodiments, R 3 It is a chlorine group.

[0276] In some embodiments, R 3is methoxy.

[0277] In some embodiments, U is N.

[0278] In some embodiments, U" is CR 6 .

[0279] In some embodiments, R 6 is selected from H, C 1-6 alkyl, and C 1-6 alkoxy.

[0280] In some embodiments, R 6 is selected from H and C 1-6 alkoxy.

[0281] In some embodiments, R 6 is selected from H and C 1-4 alkoxy.

[0282] In some embodiments, R 6 is selected from H and methoxy.

[0283] In some embodiments, R 6 is H.

[0284] In some embodiments, U" is N.

[0285] In some embodiments, U is CR 3 , and U" is CR 6 .

[0286] In some embodiments, U is N, and U" is CR 6 .

[0287] In some embodiments, U is CR 3 , and U" is N.

[0288] In some embodiments, U is N, and U" is N.

[0289] In some embodiments, R 4 is selected from H, C 6-10 aryl, C 3-10 cycloalkyl, 4-10 membered heterocycloalkyl, 5-10 membered heteroaryl, CN, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , NR c4 C(O)R b4 , C(O)OR a4 , OC(O)R b4 , OC(O)NR c4 R d4 , and NRc4 C(O)OR a4 wherein the C 6-10 aryl, the C 3-10 cycloalkyl, the 4-10 membered heterocycloalkyl, and the 5-10 membered heteroaryl are each optionally substituted with 1, 2, 3, or 4 independently selected R 4A substituents.

[0290] In some embodiments, R 4 is selected from H, phenyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein the phenyl, the C 3-6 cycloalkyl, the 4-6 membered heterocycloalkyl, and the 5-6 membered heteroaryl are each optionally substituted with 1 or 2 independently selected R 4A substituents.

[0291] In some embodiments, R 4 is selected from H, 5-10 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein the 5-10 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 independently selected R 4A substituents.

[0292] In some embodiments, R 4 is selected from H, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein the 5-6 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 independently selected R 4A substituents.

[0293] In some embodiments, R 4 is selected from H, 5-6 membered heteroaryl, CN, C(O)NR c4 R d4 and C(O)N(R c4 )NR c4 R d4 wherein the 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 4A substituents.

[0294] In some embodiments, R 4 is selected from H, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein the 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 4A substituents.

[0295] In some embodiments, R 4 is C(O)N(R c4 )NR c4 R d4 .

[0296] In some embodiments, R a4 , R b4 , R c4 , and R d4 are each independently selected from H, C 1-6 alkyl, and C 1-6 haloalkyl.

[0297] In some embodiments, R c4 and R d4 are each independently selected from H, C 1-6 alkyl, and C 1-6 haloalkyl.

[0298] In some embodiments, R a4 , R b4 , R c4 , and R d4 are each independently selected from H, C 1-4 alkyl, and C 1-4 haloalkyl.

[0299] In some embodiments, R c4 and R d4 are each independently selected from H, C 1-4 alkyl, and C 1-4 haloalkyl.

[0300] In some embodiments, R a4 , R b4 , R c4 , and R d4 are each independently selected from H, ethyl, and trifluoroethyl.

[0301] In some embodiments, R c4 and R d4 are each independently selected from H, ethyl, and trifluoroethyl.

[0302] In some embodiments, R 4 is selected from H, CN, oxadiazolyl, and C(O)NR c4 R d4 , wherein the oxadiazolyl is optionally substituted with 1, 2, 3, or 4 independently selected R 4A substituents; and R c4 and R d4 are each independently selected from H, C 1-4 alkyl, and C 1-4 haloalkyl.

[0303] In some embodiments, R 4 is selected from H, CN, oxadiazolyl, and C(O)NR c4 R d4 wherein the oxadiazolyl is optionally substituted with 1 or 2 independently selected R 4A substituents; and R c4 and R d4 are each independently selected from H, C 1-4 alkyl, and C 1-4 haloalkyl.

[0304] In some embodiments, R 4 is selected from H, CN, oxadiazolyl, and C(O)NHCH2CF3, wherein the oxadiazolyl is optionally substituted with 1, 2, 3, or 4 independently selected R 4A substituents.

[0305] In some embodiments, R 4 is selected from H, CN, oxadiazolyl, and C(O)NHCH2CF3, wherein the oxadiazolyl is optionally substituted with 1 or 2 independently selected R 4A substituents.

[0306] In some embodiments, each R 4A is independently selected from C 1-6 alkyl, C 1-6 haloalkyl, and C 1-6 alkoxy.

[0307] In some embodiments, each R 4A is independently selected from C 1-6 alkyl, and C 1-6 haloalkyl.

[0308] In some embodiments, each R 4A is independently selected from C 1-4 alkyl, and C 1-4 haloalkyl.

[0309] In some embodiments, each R 4A is independently selected C 1-6 alkyl.

[0310] In some embodiments, each R 4A is independently selected C 1-6 haloalkyl.

[0311] In some embodiments, each R 4A is independently selected C 1-4 alkyl.

[0312] In some embodiments, each R 4Afor each R 1-4 haloalkyl.

[0313] In some embodiments, each R 4A is ethyl.

[0314] In some embodiments, U' is N.

[0315] In some embodiments, U' is CR 5 .

[0316] In some embodiments, one of U, U', and U" is N.

[0317] In some embodiments, two of U, U', and U" are N.

[0318] In some embodiments, R 5 is selected from H, halo, C 1-6 alkyl, C 1-6 haloalkyl, and C 1-6 alkoxy.

[0319] In some embodiments, R 5 is selected from H, halo, C 1-6 alkyl, and C 1-6 alkoxy.

[0320] In some embodiments, R 5 is selected from H, halo, and C 1-6 alkoxy.

[0321] In some embodiments, R 5 is selected from H, halo, C 1-4 alkyl, and C 1-4 alkoxy.

[0322] In some embodiments, R 5 is selected from H, halo, and C 1-4 alkoxy.

[0323] In some embodiments, R 5 is selected from H, fluoro, chloro, and methoxy.

[0324] In some embodiments, R 5 is H.

[0325] In some embodiments, R 5 is fluoro.

[0326] In some embodiments, R 5 is chloro.

[0327] In some embodiments, R 5 is methoxy.

[0328] In some embodiments, R 3 and R 5 are each independently selected halo.

[0329] In some embodiments, R 3 and R 5 are each fluoro. In some embodiments, R 3 and R 5 are each chloro.

[0330] In some embodiments, R 3 and R 5 are each independently selected C 1-6 alkoxy.

[0331] In some embodiments, R 3 and R 5 are each methoxy.

[0332] In some embodiments, R 4 and R 5 together with the carbon atom to which they are attached form a 5-6 membered aromatic ring optionally substituted with 1, 2, 3, or 4 independently selected R 7 substituents.

[0333] In some embodiments, R 4 and R 5 together with the carbon atom to which they are attached form a 5-6 membered aromatic ring optionally substituted with 1 or 2 independently selected R 7 substituents.

[0334] In some embodiments, R 4 and R 5 together with the carbon atom to which they are attached form a 5 membered aromatic ring optionally substituted with 1 or 2 independently selected R 7 substituents.

[0335] In some embodiments, R 4 and R 5 together with the carbon atom to which they are attached form a 6 membered aromatic ring optionally substituted with 1 or 2 independently selected R 7 substituents.

[0336] In some embodiments, each R 7 is independently selected from phenyl, C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, phenyl-C 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6alkyl, (5-10 membered heteroaryl)-C 1-6 alkyl and OR a7 wherein said phenyl, said C 3-10 cycloalkyl, said 4-14 membered heterocycloalkyl, said 5-10 membered heteroaryl, said phenyl-C 1-6 alkyl-, said C 3-10 cycloalkyl-C 1-6 alkyl-, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl, said (5-10 membered heteroaryl)-C 1-6 each alkyl is optionally substituted with 1, 2, 3, or 4 independently selected R 7A substituents.

[0337] In some embodiments, each R 7 is independently selected from phenyl, C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR 1-6 alkyl-, C 3-10 cycloalkyl-C 1-6 alkyl-, (4-10 membered heterocycloalkyl)-C 1-6 alkyl, (5-10 membered heteroaryl)-C 1-6 alkyl and OR a7 wherein said phenyl, said C 3-10 cycloalkyl, said 4-14 membered heterocycloalkyl, said 5-10 membered heteroaryl, said phenyl-C 1-6 alkyl-, said C 3-10 cycloalkyl-C 1-6 alkyl-, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl, said (5-10 membered heteroaryl)-C 1-6 each alkyl is optionally substituted with 1 or 2 independently selected R 7A substituents.

[0338] In some embodiments, each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 wherein said C 3-10 cycloalkyl, said 4-14 membered heterocycloalkyl, and said 5-10 membered heteroaryl are each optionally substituted with 1, 2, 3, or 4 independently selected R 7A substituents.

[0339] In some embodiments, each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 wherein said C3-10 cycloalkyl, 4-6 membered heterocycloalkyl, 5-6 membered heteroaryl, phenyl-C 7A substituted with 1 or 2 independently selected R

[0340] In some embodiments, each R a7 is independently selected from phenyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl, 5-6 membered heteroaryl, phenyl-C 1-6 alkyl-, C 3-6 cycloalkyl-C 1-6 alkyl-, (4-6 membered heterocycloalkyl)-C 1-6 alkyl and (5-6 membered heteroaryl)-C 1-6 alkyl.

[0341] In some embodiments, each R a7 is independently selected from 4-10 membered heterocycloalkyl and 5-10 membered heteroaryl.

[0342] In some embodiments, each R a7 is independently selected from 4-6 membered heterocycloalkyl and 5-6 membered heteroaryl.

[0343] In some embodiments, each R a7 is an independently selected 4-10 membered heterocycloalkyl.

[0344] In some embodiments, each R a7 is an independently selected 4-6 membered heterocycloalkyl.

[0345] In some embodiments, each R a7 is azetidinyl.

[0346] In some embodiments, each R 7 is independently selected from bicyclo[1.1.1]pentanyl, azetidinyl, pyrrolidinyl, piperidinyl, morpholinyl, imidazolyl, azaspiro[3.3]heptanyl, diazaspiro[3.5]nonanyl, oxadiazaspiro[5.5]undecanyl, diazaspiro[4.4]nonanyl, and azetidinyloxy, wherein the bicyclo[1.1.1]pentanyl, the azetidinyl, the pyrrolidinyl, the piperidinyl, the morpholinyl, the imidazolyl, the azaspiro[3.3]heptanyl, the diazaspiro[3.5]nonanyl, the oxadiazaspiro[5.5]undecanyl, and the diazaspiro[4.4]nonanyl are each optionally substituted with 1, 2, 3, or 4 independently selected R 7A substituted with 1 or 2 independently selected R

[0347] In some embodiments, each R 7independently selected from bicyclo[l. l. l]pentanyl, azetidinyl, pyrrolidinyl, piperidinyl, morpholinyl, imidazolyl, azaspiro[3.3]heptanyl, diazaspiro[3.5]nonanyl, oxadiazaspiro[5.5]undecanyl, diazaspiro[4.4]nonanyl, and azetidinyloxy, wherein the bicyclo[l. l. l]pentanyl, the azetidinyl, the pyrrolidinyl, the piperidinyl, the morpholinyl, the imidazolyl, the azaspiro[3.3]heptanyl, the diazaspiro[3.5]nonanyl, the oxadiazaspiro[5.5]undecanyl, and the diazaspiro[4.4]nonanyl are each optionally substituted with 1 or 2 independently selected R 7A substituents.

[0348] In some embodiments, each R 7A is independently selected from C 1-6 alkyl, amino, C 1-6 alkylamino, di(C 1-6 alkyl)amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy.

[0349] In some embodiments, each R 7A is independently selected from C 1-6 alkyl, amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy.

[0350] In some embodiments, each R 7A is independently selected from C 1-6 alkyl, amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or methoxy.

[0351] In some embodiments, each R 7A is independently selected from methyl, ethyl, amino, cyclopropyl, and oxetanyl, wherein each methyl and ethyl is optionally substituted with amino or methoxy.

[0352] In some embodiments, each R 7A is independently selected from methyl, methoxyethyl, aminomethyl, amino, cyclopropyl, and oxetanyl.

[0353] In some embodiments:

[0354] V, X, and Z are each C, and W and Y are each N; or

[0355] X, Y, and Z are each C, and V and W are each N; or

[0356] V, Y, and Z are each C, and W and X are each N; or

[0357] V and Y are each C, and W, X and Z are each N;

[0358] R 1 Selected from 5-10 aryl aromatics, OR a1 C(O)NR c1 R d1 and NR c1 C(O)R b1 The 5-10 heteroaryl group is optionally composed of one, two, three, or four independently selected R groups. 1A Substituent substitution;

[0359] R a1 R b1 R c1 and R d1 Each is independently selected from H, 4-10 membered heterocyclic alkyl, (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl groups, wherein the 4-10 membered heterocyclic alkyl group, and the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one or two independently chosen R groups. 1A Substituent substitution;

[0360] Or R c1 and R d1 Together with the nitrogen to which it is attached, it forms a 10-14 membered heterocyclic alkyl group or a 10-14 membered heteroaryl group;

[0361] Each R 1A Selected independently from C 1-6 Alkyl, C 3-10 Cycloalkyl, 4-10 membered heterocyclic alkyl and CN, wherein each C 1-6 Alkyl groups are optionally C 1-4 Alkyl substitution;

[0362] R 2 For H or C 1-6 Alkoxy;

[0363] U is CR 3或 N;

[0364] U' is CR 5 Or N;

[0365] U" is CR6 or N;

[0366] R 3 is selected from H, halo, and C 1-6 alkyl;

[0367] R 4 is selected from H, 5-10 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein said 5-10 membered heteroaryl is optionally substituted with 1, 2, 3, or 4 R 4A substituents independently selected;

[0368] R c4 and R d4 are each independently selected from H, C 1-6 alkyl, and C 1-6 haloalkyl;

[0369] each R 4A is an independently selected C 1-6 alkyl;

[0370] R 5 is selected from H, halo, C 1-6 alkyl, and C 1-6 alkoxy;

[0371] or R 4 and R 5 together with the carbon atom to which they are attached form a 5-6 membered aromatic ring, said 5-6 membered aromatic ring optionally substituted with 1, 2, 3, or 4 R 7 substituents independently selected;

[0372] R 6 is selected from H and C 1-6 alkoxy;

[0373] each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 wherein said C 3-10 cycloalkyl, said 4-14 membered heterocycloalkyl, and said 5-10 membered heteroaryl are each optionally substituted with 1 or 2 R 7A substituents independently selected;

[0374] each R a7 is an independently selected 4-10 membered heterocycloalkyl; and

[0375] each R 7A is independently selected from C 1-6 alkyl, amino, C 3-6 cyclopropyl, and 4-6 membered heterocycloalkyl, wherein each C1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy.

[0376] In some embodiments:

[0377] V, X and Z are each C, and W and Y are each N; or

[0378] X, Y and Z are each C, and V and W are each N; or

[0379] V, Y and Z are each C, and W and X are each N; or

[0380] V and Y are each C, and W, X and Z are each N;

[0381] R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NR c1 R d1 and NR c1 C(O)R b1 , wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 1A substituents;

[0382] R a1 , R b1 , R c1 and R d1 are each independently selected from H, 4-10 membered heterocycloalkyl, (4-10 membered heterocycloalkyl)-C 1-6 alkyl and (5-10 membered heteroaryl)-C 1-6 alkyl, wherein said 4-10 membered heterocycloalkyl, said (4-10 membered heterocycloalkyl)-C 1-6 alkyl and said (5-10 membered heteroaryl)-C 1-6 alkyl are each optionally substituted with 1 or 2 independently selected R 1A substituents;

[0383] or R c1 and R d1 together with the nitrogen to which they are attached form a 10-14 membered heterocycloalkyl or 10-14 membered heteroaryl;

[0384] each R 1A is independently selected from C 1-6 alkyl, C 3-6 cycloalkyl, 4-6 membered heterocycloalkyl and CN, wherein each C 1-6 alkyl is optionally substituted with C 1-4 alkoxy;

[0385] R 2 is H or C 1-6alkoxy;

[0386] U is CR 3或 N;

[0387] U' is CR 5 or N;

[0388] U" is CR 6 or N;

[0389] R 3 is selected from H, halo, and C 1-6 alkoxy;

[0390] R 4 is selected from H, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 R 4A substituents independently selected;

[0391] R c4 and R d4 are each independently selected from H, C 1-6 alkyl, and C 1-6 haloalkyl;

[0392] each R 4A is an independently selected C 1-6 alkyl;

[0393] R 5 is selected from H, halo, C 1-6 alkyl, and C 1-6 alkoxy;

[0394] or R 4 and R 5 together with the carbon atom to which they are attached form a 6-membered aromatic ring, said 6-membered aromatic ring optionally substituted with 1 or 2 R 7 substituents independently selected;

[0395] each R 7 is independently selected from C 3-10 cycloalkyl, 4-14 membered heterocycloalkyl, 5-10 membered heteroaryl, and OR a7 wherein said C 3-10 cycloalkyl, said 4-14 membered heterocycloalkyl, and said 5-10 membered heteroaryl are each optionally substituted with 1 or 2 R 7A substituents independently selected;

[0396] each R a7 is an independently selected 4-10 membered heterocycloalkyl; and

[0397] each R 7A is independently selected from C1-6 alkyl, amino, C 3-6 cyclopropyl and 4-6 membered heterocycloalkyl, wherein each C 1-6 alkyl is optionally substituted with amino or C 1-4 alkoxy.

[0398] In some embodiments:

[0399] V, X and Z are each C, and W and Y are each N; or

[0400] X, Y and Z are each C, and V and W are each N; or

[0401] V, Y and Z are each C, and W and X are each N; or

[0402] V and Y are each C, and W, X and Z are each N;

[0403] R 1 is selected from 5-6 membered heteroaryl, OR a1 , C(O)NR c1 R d1 and NR c1 C(O)R b1 , wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 1A substituents;

[0404] R a1 , R b1 , R c1 and R d1 are each independently selected from H, methyl, pyrazolyl, pyridinylmethyl, pyridinylethyl, imidazo[l,2-a]pyridinylmethyl, benzoimidazolylmethyl, imidazo[4,5-c]pyridinylmethyl, benzoxazolylmethyl, oxetanylmethyl, oxetanylethyl, thietanyl-(l,l-dioxide)methyl, 2-oxaspiro[3.3]heptyl and 2-oxaspiro[3.5]nonanyl, wherein said methyl, said pyrazolyl, said pyridinylmethyl, said pyridinylethyl, said imidazo[l,2-a]pyridinylmethyl, said benzoimidazolylmethyl, said imidazo[4,5-c]pyridinylmethyl, said benzoxazolylmethyl, said oxetanylmethyl, said oxetanylethyl, said thietanyl-(l,l-dioxide)methyl, said 2-oxaspiro[3.3]heptyl and said 2-oxaspiro[3.5]nonanyl are each optionally substituted with 1 or 2 independently selected R 1A substituents;

[0405] or R c1 and R d1together with the nitrogen to which it is attached forms a 1,2,3,4-tetrahydrobenzo[4,5]imidazo[1,2- a]pyrazinyl group;

[0406] each R 1A is independently selected from the group consisting of H, halo, C

[0407] R 2 is H or C 1-6 alkyl;

[0408] U is CR 3或 N;

[0409] U' is CR 5 or N;

[0410] U" is CR 6 or N;

[0411] R 3 is selected from the group consisting of H, halo, and C 1-6 alkoxy;

[0412] R 4 is selected from the group consisting of H, 5-6 membered heteroaryl, CN, and C(O)NR c4 R d4 wherein said 5-6 membered heteroaryl is optionally substituted with 1 or 2 independently selected R 4A substituents;

[0413] R c4 and R d4 are each independently selected from the group consisting of H, C 1-6 alkyl, and C 1-6 haloalkyl;

[0414] each R 4A is independently selected C 1-6 alkyl;

[0415] R 5 is selected from the group consisting of H, halo, C 1-6 alkyl, and C 1-6 alkoxy;

[0416] or R 4 and R 5 together with the carbon atom to which they are attached form a 6-membered aromatic ring, which is optionally substituted with 1 or 2 independently selected R 7 substituents;

[0417] each R 7independently selected from bicyclo[l.l.l]pentanyl, azetidinyl, pyrrolidinyl, piperidinyl, morpholinyl, imidazolyl, azaspiro[3.3]heptanyl, diazaspiro[3.5]nonanyl, oxadiazaspiro[5.5]undecanyl, diazaspiro[4.4]nonanyl, and azetidinyloxy, wherein the bicyclo[l.l.l]pentanyl, the azetidinyl, the pyrrolidinyl, the piperidinyl, the morpholinyl, the imidazolyl, the azaspiro[3.3]heptanyl, the diazaspiro[3.5]nonanyl, the oxadiazaspiro[5.5]undecanyl, and the diazaspiro[4.4]nonanyl are each optionally substituted with 1 or 2 R 7A substituents; and

[0418] each R 7A is independently selected from methyl, methoxyethyl, aminomethyl, amino, cyclopropyl, and oxetanyl.

[0419] In some embodiments, the compound of Formula I is a compound of Formula II:

[0420]

[0421] or a pharmaceutically acceptable salt thereof, wherein the variables V, W, X, Y, Z, R c1 , R d1 , R 2 , R 3 , R 4 , and R 5 are defined according to the definitions provided herein for compounds of Formula I.

[0422] In some embodiments, the compound of Formula I is a compound of Formula III:

[0423]

[0424] or a pharmaceutically acceptable salt thereof, wherein R 1 is a 5-10 membered heteroaryl optionally substituted with 1, 2, 3, or 4 R 1A substituents, wherein the variables U', V, W, X, Y, Z, R 1A , R 3 , R 4 , and R 5 are defined according to the definitions provided herein for compounds of Formula I.

[0425] In some embodiments, the compound of Formula I is a compound of Formula IIIa:

[0426]

[0427] or a pharmaceutically acceptable salt thereof, wherein R1 is 5-10 membered heteroaryl optionally substituted with 1, 2, 3, or 4 R 1A substituents, wherein variables V, W, X, Y, Z, R 1A , R 3 , R 4 , and R 5 are defined according to the definitions provided herein for compounds of Formula I.

[0428] In some embodiments, the compound of Formula I is a compound of Formula IV:

[0429]

[0430] or a pharmaceutically acceptable salt thereof, wherein variables V, W, X, Y, Z, R a1 , R 3 , R 4 , and R 5 are defined according to the definitions provided herein for compounds of Formula I.

[0431] In some embodiments, the compound of Formula I is a compound of Formula V:

[0432]

[0433] or a pharmaceutically acceptable salt thereof, wherein variables U, V, W, Y, R 1 , and R 7 are defined according to the definitions provided herein for compounds of Formula I.

[0434] In some embodiments, the compound provided herein (e.g., a compound of any one of Formulas I-V), or a pharmaceutically acceptable salt thereof, is selected from:

[0435]

[0436]

[0437]

[0438]

[0439]

[0440]

[0441]

[0442]

[0443] or a pharmaceutically acceptable salt thereof.

[0444] In some embodiments, the compound is of Formula:

[0445]

[0446] or a pharmaceutically acceptable salt thereof.

[0447] It is to be further understood that, for clarity of disclosure, certain features of the application described in the context of separate embodiments can also be provided in combination in a single embodiment. Conversely, various features of the application described in the context of a single embodiment can also be provided separately or in any appropriate

[0448] At various places in the present specification, divalent linking substituents are described. It is especially intended that each divalent linking substituent include both the forward and reverse versions of the linking substituent. For example, -NR(CR'R") n - includes -NR(CR'R") n - and -(CR'R") n NR- both. In cases where the structure explicitly requires a linking group, the markush variable listed in reference to that group should be understood to be the linking group.

[0449] The integer n in the term "n-membered" is an integer that generally describes the number of ring-forming atoms in a moiety, where the number of ring-forming atoms is n. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, pyridinyl is an example of a 6-membered heteroaryl ring, and 1,2,3,4-tetrahydro-naphthalene is an example of a 10-membered cycloalkyl.

[0450] As used herein, the phrase "optionally substituted" means unsubstituted or substituted. Substituents are selected independently, and substitution can be at any chemically accessible position. As used herein, the term "substituted" means that a hydrogen atom is removed and replaced with a substituent. A single divalent substituent (e.g., oxy) can replace two hydrogen atoms. It is understood that substitution at a given atom is limited by valence.

[0451] As used herein, the phrase "each 'variable' is independently selected from" means essentially the same as where "in each occurrence 'variable' is selected from."

[0452] Throughout the definitions, the term "C n-m " indicates a range inclusive of the endpoints, where n and m are integers and represent the number of carbons. Examples include C 1-3 , C 1-4 , C 1-6 , etc.

[0453] As used herein, the term "C n-m Alkyl" refers to a saturated hydrocarbon group that can be straight-chain or branched, having n to m carbons. Examples of alkyl moieties include, but are not limited to: chemical groups such as methyl (Me), ethyl (Et), n-propyl (n-Pr), i-propyl (iPr), n-butyl, t-butyl, i-butyl, sec-butyl; higher homologues such as 2-methyl-l-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, and the like. In some embodiments, an alkyl group contains 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms.

[0454] As used herein, "C n-m Alkenyl" refers to an alkyl group having one or more double carbon-carbon bonds and having n to m carbons. Example alkenyl groups include, but are not limited to, ethenyl, n-propenyl, i-propenyl, n-butenyl, sec-butenyl, and the like. In some embodiments, an alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0455] As used herein, "C n-m Alkynyl" refers to an alkyl group having one or more triple carbon-carbon bonds and having n to m carbons. Example alkynyl groups include, but are not limited to, ethynyl, prop-1-ynyl, prop-2-ynyl, and the like. In some embodiments, an alkynyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0456] As used herein, the term "C n-m Alkoxy" refers to a group of the formula -O-alkyl, wherein alkyl has n to m carbons. Example alkoxy groups include, but are not limited to, methoxy, ethoxy, propyloxy (e.g., n-propyloxy and i-propyloxy), butyloxy (e.g., n-butyloxy and t-butyloxy), and the like. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0457] As used herein, the term "amino" refers to a group of the formula -NH2.

[0458] As used herein, the term "aryl" refers to an aromatic hydrocarbon group, which can be monocyclic or polycyclic (e.g., having 2 or more fused rings). The term "C n-m Aryl" refers to an aryl group having n to m ring carbon atoms. Aryl groups include, but are not limited to, phenyl, naphthyl, and the like. In some embodiments, an aryl group has 6 to 14 carbon atoms (i.e., C 6-14 Aryl). In some embodiments, an aryl group has 6 to 10 carbon atoms (i.e., C 6-10 Aryl). In some embodiments, an aryl group is phenyl.

[0459] As used herein, “halo” means F, Cl, Br, or I. In some embodiments, halo is F or Cl. In some embodiments, halo is F.

[0460] As used herein, the term “C n-m “Haloalkyl” means an alkyl group having one halo atom to 2s+1 halo atoms, which can be the same or different, where “s” is the number of carbon atoms in the alkyl group, wherein the alkyl group has n to m carbon atoms. In some embodiments, haloalkyl is fluorinated only. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. In some embodiments, haloalkyl is trifluoromethyl or trifluoroethyl.

[0461] As used herein, the term “C n-m “Alkylamino” means a group of the formula -NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0462] As used herein, the term “di(C n-m “Alkylamino” means a group of the formula -NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0463] As used herein, “cycloalkyl” means a non-aromatic ring hydrocarbon comprising a ring- cyclized alkyl and alkenyl group. Cycloalkyl groups can comprise single ring or polycyclic (e.g., having 2 or more fused rings) groups, spirocyclic and bridged cyclic (e.g., bridged bicyclic alkyl) groups. Ring- cyclized carbon atoms of cycloalkyl groups can optionally be substituted with oxo (i.e., =O). Also included within the definition of cycloalkyl are moieties having one or more aromatic rings fused (i.e., having bonds in common with) to a cycloalkyl ring, e.g., benzo- or thienyl derivatives of cyclobutane, cyclopentane, cyclohexane, and the like. Cycloalkyl groups containing fused aromatic rings can be attached through any ring- cyclized atom including the ring- cyclized atoms of the fused aromatic rings. Cycloalkyl groups can have 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 ring- cyclized carbons (i.e., C 3-14 ) in some embodiments, cycloalkyl is C 3-14 monocyclic or bicyclic cycloalkyl. In some embodiments, cycloalkyl is C 3-10 monocyclic or bicyclic cycloalkyl. In some embodiments, cycloalkyl is C 3-7 monocyclic cycloalkyl. In some embodiments, cycloalkyl is C 4-7 monocyclic cycloalkyl. In some embodiments, cycloalkyl is C 4-14spiro or bridged cycloalkyl (e.g., bridged bicycloalkyl). In some embodiments, the cycloalkyl is C 4-10 spiro or bridged cycloalkyl (e.g., bridged bicycloalkyl). Exemplary cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, adamantyl, bicyclo[1.1.1]pentyl, bicyclo[2.1.1]hexyl, bicyclo[2.2.1]heptane, bicyclo[3.1.1]heptane, bicyclo[2.2.2]octane, spiro[3.3]heptane, and the like.

[0464] As used herein, “heteroaryl” refers to a monocyclic or polycyclic (e.g., having 2 or more fused rings) aromatic heterocycle having at least one heteroatom ring member selected from N, O, and S. In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heteroatom ring members independently selected from N and O. In some embodiments, the heteroaryl group is a 5-14 membered monocyclic or bicyclic heteroaryl group having 1, 2, 3, or 4 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl group is a 5-10 membered monocyclic or bicyclic heteroaryl group having 1, 2, 3, or 4 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl group is a 5-14 membered monocyclic or bicyclic heteroaryl group having 1, 2, 3, or 4 heteroatom ring members independently selected from N and O. In some embodiments, the heteroaryl group is a 5-10 membered monocyclic or bicyclic heteroaryl group having 1, 2, 3, or 4 heteroatom ring members independently selected from N and O. In some embodiments, the heteroaryl group is a 5-6 membered monocyclic heteroaryl group having 1 or 2 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl group is a 5-6 membered monocyclic heteroaryl group having 1 or 2 heteroatom ring members independently selected from N and O. In some embodiments, the heteroaryl group has 1 to 4 ring-forming heteroatoms, 1 to 3 ring-forming heteroatoms, 1 to 2 ring-forming heteroatoms, or 1 ring-forming heteroatom. When the heteroaryl group contains more than one heteroatom ring member, the heteroatoms can be the same or different.Exemplary heteroaryl groups include, but are not limited to, thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, 1,3,4-oxadiazolyl, and 1,2-dihydro-l,2-azepinyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, oxazolyl, triazolyl, thiadiazolyl, quinolinyl, isoquinolinyl, indolyl, benzothienyl, benzofuranyl, benzisoxazolyl, imidazo[l,2-b]thiazolyl, purinyl, triazinyl, thieno[3,2-b]pyridyl, imidazo[l,2-a]pyridyl, 1,5-naphthyridinyl, lH-pyrrolo[4,3-b]pyridyl, triazolo[4,3-a]pyridyl, lH-pyrrolo[3,2-b]pyridyl, lH-pyrrolo[2,3-b]pyridyl, pyrrolo[l,5-a]pyridyl, indazolyl, and the like.

[0465] As used herein, "heterocycloalkyl" refers to a monocyclic or polycyclic heterocycle having at least one non-aromatic ring (i.e., a saturated or partially unsaturated ring), wherein one or more of the ring-forming carbon atoms of the heterocycloalkyl group is replaced by a heteroatom selected from N, O, and S, and wherein the ring-forming carbon atoms and heteroatoms of the heterocycloalkyl group can optionally be substituted with one or more oxo groups (i.e., with one or more =0 groups, such as S(O), C(O), S(O)2, and the like). When a ring-forming carbon atom or heteroatom of the heterocycloalkyl group is optionally substituted with one or more oxo groups, the O of the group plus the number of ring-forming atoms specified herein. Heterocycloalkyl groups include monocyclic and polycyclic (e.g., having 2 or more fused rings) systems. Provided heterocycloalkyl groups include monocyclic and polymeric 3- to 14-membered, 3- to 10-membered, 4- to 14-membered, 4- to 10-membered, 5- to 14-membered, 5- to 10-membered, 4- to 7-membered, 5- to 7-membered, or 5- to 6-membered heterocycloalkyl groups. Heterocycloalkyl groups can also include spirocyclic and bridged ring (e.g., 5- to 14-membered bridged bicyclic heterocycloalkyl rings having one or more of the ring-forming carbon atoms replaced by a heteroatom independently selected from N, O, and S). Heterocycloalkyl groups can be attached through a ring-forming carbon atom or a ring-forming heteroatom. In some embodiments, a heterocycloalkyl group contains 0 to 3 double bonds. In some embodiments, a heterocycloalkyl group contains 0 double bonds. In some embodiments, a heterocycloalkyl group contains 1, 2, or 3 double bonds.

[0466] The definition of heteroaryl also includes moieties having one or more aromatic rings fused (i.e., having bonds in common) with a non-aromatic heterocycle, e.g., benzofused or thienofused derivatives of piperidine, morpholine, azetidine, and the like. Heteroaryl groups containing fused aromatic rings can be attached through any ring atom of the fused aromatic ring, including the ring atoms of the non-aromatic heterocycle.

[0467] As used herein, "C o-p Cycloalkyl-C n-m "Alkyl-" refers to a group having from one to six carbon atoms, straight-chained or branched, saturated or unsaturated, and includes methyl, ethyl, propyl, isopropyl, butyl, s-butyl, t-butyl, 2-methylbutyl, 2-ethylbutyl, 2-propylbutyl, 3-methylpentyl, 3-ethylpentyl, 3-propylpentyl, 4-methylpentyl, 4-ethylpentyl, 4-propylpentyl, 5-methylhexyl, 5-ethylhexyl, 5-propylhexyl, 6-methylhexyl, 6-ethylhexyl, 6-propylhexyl, and the like.

[0468] As used herein, "C o-p Aryl-C n-m "Alkyl-" refers to a group having from one to six carbon atoms, straight-chained or branched, saturated or unsaturated, and includes methyl, ethyl, propyl, isopropyl, butyl, s-butyl, t-butyl, 2-methylbutyl, 2-ethylbutyl, 2-propylbutyl, 3-methylpentyl, 3-ethylpentyl, 3-propylpentyl, 4-methylpentyl, 4-ethylpentyl, 4-propylpentyl, 5-methylhexyl, 5-ethylhexyl, 5-propylhexyl, 6-methylhexyl, 6-ethylhexyl, 6-propylhexyl, and the like.

[0469] As used herein, "Heteroaryl-C n-m "Alkyl-" refers to a group having from one to six carbon atoms, straight-chained or branched, saturated or unsaturated, and includes methyl, ethyl, propyl, isopropyl, butyl, s-butyl, t-butyl, 2-methylbutyl, 2-ethylbutyl, 2-propylbutyl, 3-methylpentyl, 3-ethylpentyl, 3-propylpentyl, 4-methylpentyl, 4-ethylpentyl, 4-propylpentyl, 5-methylhexyl, 5-ethylhexyl, 5-propylhexyl, 6-methylhexyl, 6-ethylhexyl, 6-propylhexyl, and the like.

[0470] As used herein, "Heterocycloalkyl-C n-m "Alkyl-" refers to a group having from one to six carbon atoms, straight-chained or branched, saturated or unsaturated, and includes methyl, ethyl, propyl, isopropyl, butyl, s-butyl, t-butyl, 2-methylbutyl, 2-ethylbutyl, 2-propylbutyl, 3-methylpentyl, 3-ethylpentyl, 3-propylpentyl, 4-methylpentyl, 4-ethylpentyl, 4-propylpentyl, 5-methylhexyl, 5-ethylhexyl, 5-propylhexyl, 6-methylhexyl, 6-ethylhexyl, 6-propylhexyl, and the like.

[0471] As used herein, "Alkylene" is a divalent straight-chained or branched alkyl linking group. For example, "C o-p Cycloalkyl-C n-m "Alkyl-", "C o-p Aryl-C n-m "Alkyl-", "Phenyl-C n-m "Alkyl-", "Heteroaryl-C n-m "Alkyl-", and "Heterocycloalkyl-C n-m "Alkyl-" contains an alkyl linking group. Examples of "alkyl linking group" or "alkylene" include methylene, ethane-1, 1 -diyl, ethane-1,2-diyl, propane-1,3-diyl, propane-1,2-diyl, propane-1, 1 -diyl, and the like.

[0472] As used herein, the term "Oxy" refers to an oxygen atom as a divalent substituent (i.e., =0) which forms a carbonyl group (i.e., C=0 or C(O)) when attached to a carbon, or a nitroso, sulfinyl, or sulfonyl group when attached to a nitrogen or sulfur heteroatom.

[0473] In certain places, a definition or embodiment refers to a particular ring (e.g., azetidine ring, pyridine ring, etc.). Unless otherwise indicated, these rings can be attached with any ring member, provided that the atomic valence of the atom is not exceeded. For example, an azetidine ring can be attached at any position of the ring, while a pyridine-3-yl ring is attached at the 3-position.

[0474] As used herein, the term “independently selected from” means that each occurrence of a variable or substituent (e.g., “each R 1A ”) is independently selected from each occurrence of the applicable list.

[0475] The compounds described herein can be asymmetric (e.g., having one or more stereocenters). Unless otherwise indicated, all stereoisomers (e.g., enantiomers and diastereomers) are intended. Compounds of the present disclosure containing asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods on how to prepare optically active forms from optically inactive starting materials are known in the art, such as by resolution of racemic mixtures or by stereoselective synthesis. Many geometric isomers of alkenes, C=N double bonds, and the like can also exist in the compounds described herein, and all such isomers are contemplated in the present application. Cis and trans geometric isomers of the compounds of the disclosure are described and can be isolated as a mixture of isomers or as separate isomers. In some embodiments, the compound has the (R)-configuration. In some embodiments, the compound has the (S)-configuration. The formulae provided herein (e.g., Formula I, Formula la, etc.) include stereoisomers of the compounds.

[0476] Resolution of racemic mixtures of compounds can be performed by any of numerous methods known in the art. Exemplary methods include fractional recrystallization using a chiral resolving acid, which is an optically active, salt-forming organic acid. Suitable resolving agents for fractional recrystallization procedures are, for example, optically active acids, such as the D and L forms of tartaric acid, diacetyltartaric acid, binaphthyl tartaric acid, mandelic acid, malic acid, lactic acid or the various optically active camphor sulfonic acids, such as b-camphor sulfonic acid. Other resolving agents suitable for fractional crystallization procedures include a-methylbenzylamine in stereoisomerically pure form (e.g., S and R forms, or diastereomerically pure forms), 2- phenylglycinol, norephedrine, ephedrine, N-methylephedrine, cyclohexylethylamine, 1,2- diaminocyclohexane, and the like.

[0477] Resolution of racemic mixtures can also be performed by elution on a column packed with an optically active resolving agent, for example, dinitophenylphenylglycine. Suitable eluent solvent compositions can be determined by one skilled in the art.

[0478] The compounds provided herein also include tautomeric forms. Tautomeric forms result from the exchange of a single bond with an adjacent double bond and the concomitant migration of a proton. Tautomeric forms include prototropic tautomers, which are isomeric protonated states having the same empirical formula and overall charge. Example prototropic tautomers include keto-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs, and cyclic forms in which a proton can occupy two or more positions of a heterocyclic system, such as 1H- and 3H-imidazole, 1H-, 2H-, and 4H-1,2,4-triazole, 1H- and 2H-isoindole, 2-hydroxypyridine and 2-pyridone, and 1H- and 2H-pyrazole. Tautomeric forms can be in equilibrium, or, through appropriate substitution, locked in space as one form.

[0479] All compounds and pharmaceutically acceptable salts thereof can exist together with other substances such as water and solvents (e.g., hydrates and solvates) or can be isolated.

[0480] In some embodiments, the preparation of a compound can involve the addition of an acid or base to affect, for example, catalysis of a desired reaction or formation of a salt form such as an acid addition salt.

[0481] Example acids can be inorganic or organic acids, and include, but are not limited to, strong acids and weak acids. Some example acids include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, p-toluenesulfonic acid, 4-nitrobenzoic acid, methanesulfonic acid, benzenesulfonic acid, trifluoroacetic acid, and nitric acid. Some weak acids include, but are not limited to, acetic acid, propionic acid, butyric acid, benzoic acid, tartaric acid, valeric acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, and decanoic acid.

[0482] Example bases include lithium hydroxide, sodium hydroxide, potassium hydroxide, lithium carbonate, sodium carbonate, potassium carbonate, and sodium bicarbonate. Some example strong bases include, but are not limited to, hydroxides, alkoxides, metal amides, metal hydrides, metal dialkylamides, and aryl amines, where alkoxides include lithium, sodium, and potassium salts of methyl, ethyl, and tert-butyloxide; metal amides include sodium amide, potassium amide, and lithium amide; metal hydrides include sodium hydride, potassium hydride, and lithium hydride; and metal dialkylamides include lithium, sodium, and potassium salts of methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, trimethylsilyl, and cyclohexyl substituted amides.

[0483] As used herein, the term “room temperature” or “RT” is as understood in the art and generally refers to a temperature (e.g., reaction temperature), i.e., the approximate temperature of a room in which a reaction is being performed, e.g., a temperature of about 20 °C to about 30 °C.

[0484] In some embodiments, the compounds provided herein, or salts thereof, are substantially isolated. By "substantially isolated" is intended that the compound is partially or substantially separated from the environment in which it was formed or detected. Partial separation can include, for example, a composition enriched in the compound provided herein. Substantial separation can include compositions containing at least about 50% by weight, at least about 60% by weight, at least about 70% by weight, at least about 80% by weight, at least about 90% by weight, at least about 95% by weight, at least about 97% by weight, or at least about 99% by weight of the compound provided herein, or salts thereof.

[0485] As used herein, the term "compound" is intended to encompass all stereoisomers, geometric isomers, tautomers, and isotopologues of the depicted structures. Unless otherwise specified, a compound identified herein by name or structure as a particular tautomeric form is intended to include the other tautomeric forms.

[0486] The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio.

[0487] The present application also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting at least one of its existing acid or base moieties into its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkali salts of acidic residues such as carboxylic acids, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. As used herein, the pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent or in a mixture of both; usually, nonaqueous media like ether, ethyl acetate, alcohols (e.g., methanol, ethanol, isopropanol, or butanol) or acetonitrile (ACN) are preferred. Lists of suitable salts are found in, e.g., Remington's Pharmaceutical Sciences, 17th Ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418 and Journal of Pharmaceutical Science, 66, 2 (1977).

[0488] Synthesis

[0489] As will be appreciated by those skilled in the art, the compounds provided herein, including stereoisomers thereof, and intermediates useful in making the compounds provided herein, can be made using known organic synthesis techniques and can be synthesized according to any of a variety of possible synthetic routes.

[0490] The compounds provided herein, or intermediates useful in making the compounds provided herein, can be made, for example, using appropriately substituted starting materials according to the procedures described in one or more of Schemes 1-7.

[0491] Scheme 1.

[0492]

[0493] Scheme 2.

[0494]

[0495] Scheme 3.

[0496]

[0497] Scheme 4.

[0498]

[0499] Scheme 5.

[0500]

[0501] Scheme 6.

[0502]

[0503] Scheme 7.

[0504]

[0505] The skilled person will appreciate that the processes described herein are not the only means by which the compounds provided herein can be synthesised, and that a wide range of synthetic organic reactions can potentially be used to synthesise the compounds provided herein. The skilled person knows how to choose and implement appropriate synthetic routes. Suitable synthetic methods for starting materials, intermediates and products can be determined by reference to the literature, including the following reference sources, such as: Advances in Heterocyclic Chemistry, Vols. 1-107 (Elsevier, 1963-2012); Journal of Heterocyclic Chemistry, Vols. 1-49 (Journal of Heterocyclic Chemistry, 1964-2012); Carreira et al. (Eds.) Science of Synthesis, Vols. 1-48 (2001-2010) and Knowledge Updates KU 2010 / 1-4; 2011 / 1-4; 2012 / 1-2 (Thieme, 2001-2012); Katritzky et al. (Eds.) Comprehensive Organic Functional Group Transformations, (Pergamon Press, 1996); Katritzky et al. (Eds.) Comprehensive Organic Functional Group Transformations II (Pergamon Press, 2ndEd., 2004); Katritzky et al. (Eds.), Comprehensive Heterocyclic Chemistry (Pergamon Press, 1984); Katritzky et al., Comprehensive Heterocyclic Chemistry II, (Pergamon Press, 1996); Smith et al., March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 6thEd. (Wiley, 2007); Trost et al. (Eds.), Comprehensive Organic Synthesis (Pergamon Press, 1991).

[0506] The preparation of the compounds described herein can involve the protection and deprotection of various chemical groups. The need for protection and deprotection, and the selection of appropriate protecting groups can be readily determined by one skilled in the art. The chemistry of protecting groups can be found, for example, in T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 3rdEd., John Wiley & Sons, Inc., New York (1999).

[0507] The reactions can be monitored by any method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g.,1H 1 H or 13 C), infrared spectroscopy, spectrophotometry (e.g., UV visible), mass spectrometry, and the like, or by chromatographic means, such as high-performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LCMS), or thin layer chromatography (TLC). One skilled in the art can purify compounds by various methods, including high-performance liquid chromatography (HPLC) and normal phase silica gel chromatography.

[0508] Methods of use

[0509] The compounds provided herein can inhibit the activity of salt-inducible kinases (SIKs), such as SIK2 and / or SIK3. In some embodiments, the present application provides a method of inhibiting the activity of one or more salt-inducible kinases (SIKs), the method comprising contacting the kinase with a compound provided herein (e.g., a compound of any of Formulae I-V) or a pharmaceutically acceptable salt thereof. In some embodiments, the method is an in vitro method. In some embodiments, the method is an ex vivo method. In some embodiments, the method is an in vivo method.

[0510] As used herein, the term“contacting” refers to bringing together the indicated moieties in an in vitro system or in an in vivo system. For example, contacting a salt-inducible kinase with a compound provided herein includes administering a compound provided herein or a pharmaceutically acceptable salt thereof to an individual or patient (e.g., a human patient), the compound having a salt-inducible kinase, and, for example, introducing a compound described herein into a sample containing a cell preparation or a purified preparation containing the salt-inducible kinase.

[0511] In some embodiments, the compounds provided herein are selective inhibitors of one or more SIKs. In some embodiments, the compounds provided herein are selective inhibitors of salt inducible kinase 2 (SIK2) and not salt inducible kinase 1 (SIK1). In some embodiments, the compounds provided herein are selective inhibitors of salt inducible kinase 3 (SIK3) and not salt inducible kinase 1 (SIK1). In some embodiments, the compounds provided herein are selective inhibitors of salt inducible kinase 2 (SIK2) and salt inducible kinase 3 (SIK3) and not salt inducible kinase 1 (SIK1).

[0512] The application further provides methods of treating a disease in a patient (e.g., a patient in need thereof), wherein the disease is associated with abnormal expression and / or activity of a salt inducible kinase (e.g., SIK2 and / or SIK3). In some embodiments, the methods comprise administering to the patient a therapeutically effective amount of a compound provided herein, or a pharmaceutically acceptable salt thereof.

[0513] As used herein, the term“patient” refers to any animal, including a mammal, such as a mouse, rat, other rodent, rabbit, dog, cat, pig, cow, sheep, horse, or primate, and a human. In some embodiments, the patient is a human patient.

[0514] In some embodiments, the disease is associated with abnormal expression and / or activity of SIK2. In some embodiments, the disease is associated with abnormal expression and / or activity of SIK3. In some embodiments, the disease is associated with abnormal expression and / or activity of SIK2 and SIK3. In some embodiments, the methods provided herein further comprise identifying a patient who has been diagnosed as having abnormal expression and / or activity of one or more SIKs (e.g., SIK2 and / or SIK3).

[0515] In some embodiments, the disease is associated with elevated expression (i.e., overexpression) and / or activity of SIK2. In some embodiments, the disease is associated with elevated expression and / or activity of SIK3. In some embodiments, the disease is associated with elevated expression and / or activity of SIK2 and SIK3. In some embodiments, the methods provided herein further comprise identifying a patient who has been diagnosed as having elevated expression and / or activity of one or more SIKs (e.g., SIK2 and / or SIK3).

[0516] In some embodiments, the disease is selected from cancer, inflammatory bowel disease, diabetes, skin pigmentation disorders, osteoporosis, osteoarthritis, inflammatory arthritic skin rashes, and musculoskeletal diseases.

[0517] In some embodiments, the disease is cancer.

[0518] In some embodiments, the cancer is selected from ovarian cancer, breast cancer (e.g., triple negative breast cancer), acute myeloid leukemia (AML), and multiple myeloma.

[0519] In some embodiments, the disease is inflammatory bowel disease.

[0520] In some embodiments, the disease is diabetes.

[0521] In some embodiments, the disease is a skin pigmentation disorder.

[0522] In some embodiments, the disease is osteoporosis.

[0523] In some embodiments, the disease is osteoarthritis.

[0524] In some embodiments, the disease is inflammatory arthritic rash.

[0525] In some embodiments, the inflammatory arthritic rash is rheumatoid arthritis.

[0526] In some embodiments, the disease is a musculoskeletal disease.

[0527] In some embodiments, the treatment comprises one or more of increasing bone formation in the patient, increasing bone anabolic metabolism in the patient, and increasing bone mass in the patient.

[0528] As used herein, the phrase “therapeutically effective amount” means an amount of an active compound or pharmaceutical composition (e.g., an amount of any solid form provided herein or a salt thereof) that eliminates the biological response or the pharmacological response being sought by the researcher, veterinarian, medical doctor, or other clinician in the tissue, system, animal, individual, or human being being treated. An appropriate “effective amount” in any individual case can be determined using techniques known to the skilled artisan.

[0529] As used herein, the phrase “pharmaceutically acceptable” means those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, appropriate for use with human and animal tissues without excessive toxicity, irritation, allergic response, immunogenicity, or other problem or complication commensurate with a reasonable benefit / risk ratio.

[0530] As used herein, the phrase "pharmaceutically acceptable carrier or excipient" refers to a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, solvent or encapsulating material. Excipients or carriers are generally safe, nontoxic and neither biologically nor otherwise undesirable, and include excipients or carriers that are acceptable for use in veterinary applications as well as human pharmaceutical applications. In some embodiments, each component is "pharmaceutically acceptable" as defined herein (see, e.g., Remington: The Science and Practice of Pharmacy, 21stEd.; Lippincott Williams & Wilkins: Philadelphia, Pa., 2005; Handbook of Pharmaceutical Excipients, 6thEd.; Rowe et al., Eds.; The Pharmaceutical Press and the American Pharmaceutical Association: 2009; Handbook of Pharmaceutical Additives, 3rdEd.; Ash and Ash, Eds.; Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, 2ndEd.; Gibson, Ed.; CRC Press LLC: Boca Raton, Fla., 2009).

[0531] As used herein, the term "treating" or "treatment" refers to inhibiting the disease; e.g., arresting the development of a pathology or symptomology of a disease, condition, or disorder (i.e., preventing further development of pathology and / or symptomology) in a patient that is experiencing or displaying the pathology or symptomology of a disease, condition, or disorder or ameliorating the disease; e.g., ameliorating a pathology or symptomology of a disease, condition, or disorder (i.e., reversing the pathology and / or symptomology) in a patient that is experiencing or displaying the pathology or symptomology of a disease, condition, or disorder, such as reducing the severity of a disease.

[0532] In some embodiments, the compounds provided herein, and pharmaceutically acceptable salts thereof, can be used to prevent or reduce the risk of any of the diseases mentioned herein; for example, to prevent or reduce the risk of a disease, condition, or disorder in a patient who can be pre-diagnosed with the disease, condition, or disorder but has not yet experienced or displayed the pathology or symptomatology of the disease.

[0533] Combination therapy

[0534] One or more additional therapeutic agents, for example, anti-inflammatory agents, steroids, immunosuppressants, anesthetics (e.g., for use in combination with surgical procedures), or other agents useful in the treatment of one or more of the diseases described herein can be used in combination with the compounds and salts provided herein.

[0535] Example anti-inflammatory agents include, but are not limited to, aspirin, choline salicylate, celecoxib, diclofenac potassium, diclofenac sodium, diclofenac sodium with misoprostol, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, ketoprofen, meclofenamate sodium, mefenamic acid, nabumetone, naproxen, naproxen sodium, oxaprozin, piroxican, rofecoxib, salsalate, sodium salicylate, sulindac, tolmetin sodium, and valdecoxib.

[0536] Example steroids include, but are not limited to, corticosteroids such as cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, and prednisone.

[0537] Example immunosuppressants include, but are not limited to, azathioprine, chlorambucil, cyclophosphamide, cyclosporine, daclizumab, infliximab, methotrexate, and tacrolimus.

[0538] Example anesthetics include, but are not limited to, local anesthetics (e.g., lidocaine, procain, ropivacaine) and general anesthetics (e.g., desflurane, enflurane, halothane, isoflurane, methoxyflurane, nitrous oxide, sevoflurane, mmobarbital, methohexital, thiamylal, thiopental, diazepam, lorazepam, midazolam, etomidate, ketamine, propofol, alfentanil, fentanyl, remifentanil, buprenorphine, butorphanol, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxymorphone, pentazocine).

[0539] Additional therapeutic agents that can be used in combination with the compounds provided herein include, but are not limited to, therapeutic agents useful in the treatment of one or more of the diseases provided herein. For example, the compounds provided herein can be used in combination with one or more additional therapeutic agents useful in the treatment of osteoporosis, including but not limited to bisphosphonate agents, i.e., denosumab, raloxifene, teriparatide, abaloparatide, romosozumab, and the like.

[0540] In some embodiments, the additional therapeutic agent is administered simultaneously with the compounds or salts provided herein. In some embodiments, the additional therapeutic agent is administered after administration of the compounds or salts provided herein. In some embodiments, the additional therapeutic agent is administered before administration of the compounds or salts provided herein. In some embodiments, the compounds or salts provided herein are administered during a surgical procedure. In some embodiments, the compounds or salts provided herein are administered in combination with the additional therapeutic agent during a surgical procedure.

[0541] Pharmaceutical compositions and formulations

[0542] When used as pharmaceuticals, the compounds and salts provided herein can be administered in the form of pharmaceutical compositions. These compositions can be prepared as described herein or elsewhere, and can be administered by a variety of routes, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (including transdermal, epidermal, ophthalmic, and to mucous membranes including intranasal, vaginal, and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizers; intratracheal or intranasal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, intramuscular or injection or infusion; or intracranial (e.g., intrathecal or intracerebroventricular administration). Parenteral administration can be in the form of a single bolus dose, or can be, for example, by continuous perfusion pump. In some embodiments, the compounds, salts, and pharmaceutical compositions provided herein are suitable for parenteral administration. In some embodiments, the compounds, salts, and pharmaceutical compositions provided herein are suitable for intravenous administration.

[0543] In some embodiments, the compounds, salts, and pharmaceutical compositions provided herein are suitable for oral administration.

[0544] Also provided are pharmaceutical compositions containing, as an active ingredient, a compound provided herein or a pharmaceutically acceptable salt thereof in combination with one or more pharmaceutically acceptable carriers (excipients). In making the compositions provided herein, the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, e.g., a capsule, sachet, paper, or other container. When the excipient serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.

[0545] Some examples of suitable excipients include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginic acid, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, and methyl cellulose. The formulations can also include, but are not limited to, lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preservatives; flavoring agents; sweetening agents, or combinations thereof.

[0546] The active ingredient can be effective over a wide dosage range and is generally administered in a therapeutically effective amount. It will be understood, however, that the amount of the compound actually administered will usually be determined by a physician, according to the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual subject, the severity of the subject's symptoms, and the like.

[0547] It should be understood that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment (concurrently with these embodiments are intended to provide independent combinations one of which can be used even if multiple combinations are disclosed). Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable subcombination.

[0548] Examples

[0549] The present application will be described in greater detail by way of specific examples. The following examples are offered for illustrative purposes, and are not intended to limit the application in any way. Persons of ordinary skill in the art will readily recognize a variety of noncritical parameters that can be changed or modified to yield essentially the same results.

[0550] Intermediate 1: tert-Butyl N-[2-[2-[5-[(3-methyloxetan-3-yl) methoxy]benzoimidazol-1-yl]-8-quinolinyl]-2-azaspiro[3.3]heptan-6-yl]carbamate

[0551]

[0552] Step 1: 8-benzyloxyquinolin-2-ol

[0553]

[0554] To a mixture of quinoline-2,8-diol (10 g, 62.05 mmol, 1 eq) in DMF (100 mL) was added K2CO3 (17.15 g, 124.10 mmol, 2 eq) and BnBr (11.14 g, 65.15 mmol, 7.74 mL, 1.05 eq) at 20 °C, then the reaction mixture was heated at 60 °C for 12 h. The reaction mixture was poured into water (700 mL), then the mixture was filtered and the filter cake was dried in vacuum. The title compound was obtained as a white solid (14 g, crude).

[0555] Step 2: 8-benzyloxy-2-chloro-quinoline

[0556]

[0557] To a mixture of 8-benzyloxyquinolin-2-ol (14 g, 55.71 mmol, 1 eq) in DCE (200 mL) was added oxalyl chloride (17.68 g, 139.29 mmol, 12.19 mL, 2.5 eq) and DMF (4.07 g, 55.71 mmol, 4.29 mL, 1 eq), the resulting mixture was heated at 80 °C for 12 h. The reaction mixture was then washed with saturated NaHCO3 (500 mL) aqueous solution, and the aqueous layer was extracted with DCM (200 mL, 3x). The combined organic layers were dried over Na2SO4 and concentrated to yield the title compound as a yellow solid (14 g, crude).

[0558] Step 3: 8-benzyloxy-N-[4-[(3-methyloxetan-3-yl)methoxy]-2-nitro-phenyl]quinolin-2- amine

[0559]

[0560] To a mixture of 8-benzyloxy-2-chloro-quinoline (10 g, 37.07 mmol, 1 eq) and 4-[(3-methyloxetan-3-yl)methoxy]-2-nitro-aniline (8.83 g, 37.07 mmol, 1 eq) in dioxane (200 mL) was added Cs2CO3(24.16 g, 74.15 mmol, 2 eq), BINAP (2.31 g, 3.71 mmol, 0.1 eq) and Pd2(dba)3(1.70 g, 1.85 mmol, 0.05 eq) at 20 °C. The mixture was then stirred at 110 °C under N2for 12 h. The reaction mixture was then concentrated to yield crude product which was washed with petroleum ether: ethyl acetate (300 mL, 5:1) and dried in vacuum. The title compound was obtained as a red solid (15 g, 31.81 mmol, 85.81% yield). 1 H NMR (400 MHz, DMSO-d6) δ: 1.42 (s, 3H) 4.15 (s, 2H) 4.36 (d, J = 5.88 Hz, 2H) 4.55 (d, J = 5.75 Hz, 2H) 5.22 (s, 2H) 7.18 - 7.23 (m, 2H) 7.24 - 7.30 (m, 3H) 7.33 - 7.39 (m, 2H) 7.42 (t, J = 7.44 Hz, 2H) 7.58 (d, J = 7.38 Hz, 2H) 7.67 (d, J = 3.00 Hz, 1H) 8.14 (d, J = 8.88 Hz, 1H) 8.76 (d, J = 9.26 Hz, 1H) 9.79 (s, 1H)

[0561] Step 4: 2-[2-amino-4-[(3-methyloxetan-3-yl)methoxy]anilino]quinolin-8-ol

[0562]

[0563] To a mixture of 8-benzyloxy-N-[4-[(3-methyloxetan-3-yl)methoxy]-2-nitro-phenyl]quinolin-2-amine (10 g, 21.21 mmol, 1 eq) in MeOH (300 mL) was added Pd / C (5 g, 10% purity) and the reaction mixture was then stirred under H2for 12 h at 55 °C (15 psi). The reaction mixture was filtered and the filtrate was concentrated to obtain the title compound as a red solid (6 g, crude).

[0564] Step 5: 2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1-yl]quinolin-8-ol

[0565]

[0566] To a mixture of 2-[2-amino-4-[(3-methyloxetan-3-yl)methoxy]anilino]quinolin-8-ol (4.5 g, 12.81 mmol, 1 eq) in trimethoxymethane (40 mL) was added HCOOH (1.85 g, 38.42 mmol, 3 eq) and the reaction mixture was stirred at 100 °C for 1 h. The reaction mixture was then cooled to 20 °C, petroleum ether (PE) (50 mL) was added and the mixture was filtered and the filter cake was dried in vacuum to yield the title compound as a red solid (3.2 g, 8.85 mmol, 69.14% yield). 1 H NMR (400 MHz, DMSO-d6) δ: 1.42 (s, 3H) 4.16 (s, 2H) 4.35 (d, J = 5.75 Hz, 2H) 4.56 (d, J = 5.75 Hz, 2H) 7.11 (dd, J = 8.94, 2.44 Hz, 1H) 7.22 (dd, J = 7.19, 1.56 Hz, 1H) 7.39 (d, J = 2.38 Hz, 1H) 7.41 - 7.50 (m, 2H) 8.14 (d, J = 8.88 Hz, 1H) 8.55 (d, J = 9.00 Hz, 1H) 8.64 (d, J = 8.88 Hz, 1H) 9.28 (s, 1H)

[0567] Step 6: [2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1-yl]-8-quinolyl] trifluoromethanesulfonate

[0568]

[0569] To a mixture of 2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1-yl]quinolin-8-ol (1.5 g, 4.15 mmol, 1 eq) in DMF (10 mL) was added Et3N (840.00 mg, 8.30 mmol, 1.16 mL, 2 eq) and 1,1,1-trifluoro-N-phenyl-N-(trifluoromethylsulfonyl)methanesulfonamide (1.63 g, 4.57 mmol, 1.1 eq) at 20 °C and the reaction mixture was stirred at 20 °C for 1 h. The reaction mixture was poured into ice water (100 mL) and extracted with EtOAc (50 mL, 4x). The combined organic layers were dried over Na2S04and concentrated to yield the title compound as a red solid (1.0 g, crude).

[0570] Step 8: N-[2-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1-yl]-8-quinolyl]-2- azaspiro[3.3]heptan-6-yl]carbamic acid trifluoroacetate

[0571]

[0572] To a mixture of [2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]trifluoromethanesulfonate (200 mg, 405.31 pmol, 1 eq) and tert-butyl N-(2- azaspiro[3.3]heptan-6-yl)carbamate (86.04 mg, 405.31 pmol, 1 eq) in toluene (10 mL) was added Cs2CO3(264.11 mg, 810.61 pmol, 2 eq), BINAP (50.47 mg, 81.06 pmol, 0.2 eq) and Pd2(dba)3(37.11 mg, 40.53 pmol, 0.1 eq) and the reaction mixture was stirred at 100 °C under N2for 12 h. The reaction mixture was filtered and the filtrate was concentrated, then purified by preparative TLC (ethyl acetate:methanol = 10:1) to give the title compound (170 mg, 305.94 pmol, 75.48% yield) as a yellow oil.

[0573] Intermediate 2-7.

[0574] Intermediate 2-7 was prepared according to the procedure described for Intermediate 1 using appropriately substituted starting materials.

[0575] Table 1.

[0576]

[0577] Intermediate 8: tert-butyl 3-[[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]oxy]azetidine-1-carboxylate

[0578]

[0579] A mixture of 2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]quinolin-8-ol (200 mg, 553.41 μmol, 1 equiv), tert-butyl 3-hydroxyazetidine-l-carboxylate (124.61 mg, 719.44 μmol, 1.3 equiv) and 2-(tributyl-phosphoranylidene)acetonitrile (200.35 mg, 830.12 μmol, 1.5 equiv) in toluene (3 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 100 °C under N2for 12 h. The reaction mixture was then concentrated to yield the title compound as a yellow solid (100 mg, 193.58 μmol, 34.98% yield) which was purified by preparative TLC (SiO2, ethyl acetate:methanol, 10:1).

[0580] Intermediate 9: tert-butyl 4-oxa-l,9-diazaspiro[5.5]undecane-l-carboxylate

[0581]

[0582] Step 1: 8-benzyl-l,3,8-triazaspiro[4.5]decane-2,4-dione

[0583]

[0584] A solution of l-benzylpiperidin-4-one (29.4 g, 155.4 mmol, 28.8 mL, 1 equiv) in MeOH (210 mL) was added to a solution of carbamic acid ammonium salt (45.4 g, 574.8 mmol, 47.3 mL, 3.7 equiv) in H2O (210 mL). The mixture was cooled to 0 °C and a solution of NaCN (7.7 g, 157.1 mmol, 1.0 equiv) in H2O (20 mL) was added dropwise over 10 min and the reaction mixture was stirred at 25 °C for 20 h. The reaction mixture was then filtered and the filter cake was concentrated under reduced pressure to yield the title compound as a white solid (42 g, crude).

[0585] Step 2: 4-amino-l-benzyl-piperidine-4-carboxylic acid

[0586]

[0587] A mixture of 8-benzyl-l,3,8-triazaspiro[4.5]decane-2,4-dione (42 g, 161.9 mmol, 1 eq), LiOH H2O (33.9 g, 809.9 mmol, 5 eq) in H2O (500 mL) was stirred at 100 °C for 12 h. The reaction mixture was filtered and HCl (12 N) was added to the solution until the pH was about 2. The mixture was filtered and the filter cake was concentrated under reduced pressure to yield the title compound (21 g, crude) as a white solid.

[0588] Step 3: (4-amino-l-benzyl-4-piperidyl)methanol

[0589]

[0590] LiAlH4(3.2 g, 85.4 mmol, 2 eq) was added portionwise to a mixture of 4-amino-l-benzyl-piperidine-4-carboxylic acid (10 g, 42.68 mmol, 1 eq) in THF (200 mL) at 0 °C, after the addition, the reaction mixture was stirred at 70 °C under N2for 3 h. The mixture was then cooled to 20 °C, 10 mL of water was added, followed by NaOH (15 mL, 1 M). The resulting mixture was stirred at 20 °C for 10 min and then filtered. The filtrate was concentrated to yield the title compound as a yellow oil.

[0591] Step 4: 9-benzyl-4-oxa-l,9-diazaspiro[5.5]undecan-2-one

[0592]

[0593] A solution of 2-chloroacetyl chloride (974.0 mg, 8.6 mmol, 685.9 pL, 0.9 eq) in DCM (20 mL) was added dropwise to a mixture of (4-amino-l-benzyl-4-piperidyl)methanol (2.0 g, 9.1 mmol, 1 eq) and Et3N (918.6 mg, 9.1 mmol, 1.3 mL, 1 eq) in DCM (10 mL) at 0 °C, then the resulting mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated and the resulting residue was dissolved in THF (20 mL), t-BuOK (3.1 g, 27.2 mmol, 3 eq) was added, and the reaction mixture was stirred at 20 °C for 1 h. The reaction mixture was concentrated and the crude product was purified by column chromatography on silica gel (ethyl acetate:methanol = 1:0 to 10:1) to yield the title compound (1.3 g, 4.9 mmol, 55.0% yield) as a yellow solid.

[0594] Step 5: 9-benzyl-4-oxa-l,9-diazaspiro[5.5]undecan-2-one

[0595]

[0596] LiAlH4(947.7 mg, 24.9 mmol, 5 eq) was added portionwise to a mixture of 9-benzyl-4-oxa-l,9-diazaspiro[5.5]undecan-2-one (1.3 g, 5.0 mmol, 1 eq) in THF (50 mL) at 0 °C. After addition, the reaction mixture was stirred at 70 °C for 4 h. The reaction mixture was cooled to 0 °C and water (1 mL) was added, followed by NaOH (1 mL, aqueous, 1 M). After addition, the reaction mixture was stirred at 20 °C for 10 min and then filtered. The filtrate was dried over Na2S04and concentrated to yield the title compound as a yellow oil (1.2 g, crude).

[0597] Step 6: tert-butyl 9-benzyl-4-oxa-l,9-diazaspiro[5.5]undecane-l-carboxylate

[0598]

[0599] To a mixture of 9-benzyl-4-oxa-l,9-diazaspiro[5.5]undecan-2-one (500 mg, 2.03 mmol, 1 eq) in DCM (10 mL) was added Boc20 (442.9 mg, 2.0 mmol, 466.3 pL, 1 eq) and the reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated and the crude product was purified by flash column chromatography on silica gel (petroleum ether: ethyl acetate = 2: 1) to yield the title compound as a yellow oil (500 mg, 1.4 mmol, 71.1% yield).

[0600] Step 7: tert-butyl 4-oxa-l,9-diazaspiro[5.5]undecane-l-carboxylate

[0601]

[0602] To a mixture of tert-butyl 9-benzyl-4-oxa-l,9-diazaspiro[5.5]undecane-l- carboxylate (200 mg, 577.3 pmol, 1 eq) in MeOH (5 mL) was added Pd / C (100 mg, 10% purity) and ammonia, formic acid (182.0 mg, 2.9 mmol, 5 eq) at 25 °C and the reaction mixture was stirred at 70 °C for 1 h. The reaction mixture was filtered and the filtrate was concentrated to yield the title compound as a yellow oil (150 mg, crude).

[0603] Intermediate 10: Benzo[d]oxazol-2-ylmethanamine

[0604]

[0605] Step 1: N-[2-(2-hydroxyanilino)-2-oxo-ethyl]benzylcarbamate

[0606]

[0607] To a solution of 2-(benzyloxycarbonylamino)acetic acid (6.33 g, 30.2 mmol, 1.1 eq), 2-amino phenol (3 g, 27.5 mmol, 1 eq) in DMF (20 mL) was added DIEA (7.11 g, 55.0 mmol, 9.58 mL, 2 eq), HATU (12.5 g, 33.0 mmol, 1.2 eq) in one portion at 25 °C. The mixture was stirred at 25 °C for 12 h. The reaction mixture was quenched by the addition of water 100 mL, extracted with EtOAc 200 mL. The combined organic layers were washed with brine 100 mL, dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. The crude product was triturated with EtOAc (30 mL) at 25 °C for 10 min, filtered and concentrated under reduced pressure to yield the title compound as a yellow solid (3.6 g, crude).

[0608] Step 2: N-(1,3-benzoxazol-2-ylmethyl)benzylcarbamate

[0609]

[0610] A mixture of N-[2-(2-hydroxyanilino)-2-oxo-ethyl]benzylcarbamate (3.6 g, 12.0 mmol, 1 eq) in propanoic acid (19.9 g, 268 mmol, 20 mL, 22.4 eq) and then a mixture was stirred at 130 °C for 12 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column (Si02, petroleum ether / ethyl acetate = 50:1 to 3:1) to give the title compound as a yellow solid (2.1 g, crude).

[0611] Step 3: 1,3-benzoxazol-2-ylmethanamine

[0612]

[0613] A mixture of benzyl N-(l,3-benzoxazol-2-ylmethyl)carbamate (0.5 g, 1.77 mmol, 1 equiv), Pd / C (500 mg, 10% purity) in MeOH (50 mL), NH3H2O (2 mL) was degassed and purged with H2(3x) and then the mixture was stirred at 25 °C under H2(15 psi) atmosphere for 2 h. The resulting mixture was then filtered and the filtrate was concentrated to yield the title compound as a red solid (235 mg, crude).

[0614] Intermediate 11: 1,2,3,4-Tetrahydrobenzo[4,5]imidazo[l,2-a]pyrazine

[0615]

[0616] To a mixture of NaOH (3 g, 75.0 mmol, 21.2 equiv) in H2O (3 mL) was added lH-benzimidazol-2-ylmethanamine (0.52 g, 3.53 mmol, 1 equiv), to the mixture was added tetrabutylammonium, bromide (45.6 mg, 141 pmol, 0.04 equiv), then the mixture was stirred at 25 °C for 1 h. Next, 1,2-dibromoethane (1.33 g, 7.07 mmol, 533 pL, 2 equiv) dissolved in 10 mL DMF was added dropwise, and the reaction mixture was stirred at 25 °C for 2 h. The mixture was then filtered and the filtrate was concentrated to yield the crude product. The resulting residue was purified by preparative HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 5% - 30%, 8 min) to yield the title compound as a white solid (30 mg, crude).

[0617] Example 1: 8-(4-methylimidazol-l-yl)-2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l- yl]quinoline

[0618]

[0619] A mixture of [2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]trifluoromethanesulfonate (Intermediate 1, Step 7, 0.1 g, 202.65 pmol, 1 eq), 4- methyl-lH-imidazole (24.96 mg, 303.98 pmol, 1.5 eq), K3PO4(86.03 mg, 405.31 pmol, 2 eq), Pd2(dba)3(92.79 mg, 101.33 pmol, 0.5 eq) and di-tert-butyl-[2-(2,4,6- triisopropylphenyl)phenyl]phosphane (43.03 mg, 101.33 pmol, 0.5 eq) in toluene (3 mL) and dioxane (0.6 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 120 °C under N2atmosphere for 12 h. The reaction mixture was filtered, concentrated under reduced pressure and purified by preparative HPLC (basic conditions; Column: Waters Xbridge Prep OBD C18 150*40mm*10pm; Mobile Phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 35%-50%, 6 min) to yield the title compound as a white solid (4 mg, 9.38 pmol, 4.63% yield, 99.766% purity). 1 H NMR (400 MHz, MeOD-d4) d = 8.93-8.88 (m, 1H), 8.49 (d, J = 9.0 Hz, 1H), 8.04-7.84 (m, 4H), 7.79 (dd, J = 1.2, 7.4 Hz, 1H), 7.65-7.52 (m, 1H), 7.28-7.10 (m, 2H), 6.86 (dd, J = 2.4, 9.0 Hz, 1H), 4.63-4.57 (m, 2H), 4.40-4.36 (m, 2H), 4.04-3.95 (m, 2H), 5.22-3.55 (m, 1H), 5.22-3.55 (m, 1H), 2.32-2.23 (m, 3H), 1.39-1.35 (m, 3H).

[0620] Example 2: 2-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]-2-azaspiro[3.3]heptan-6-amine

[0621]

[0622] A mixture of tert-butyl N-[2-[2-[5-[(3-methyloxetan-3-yl) methoxy]benzoimidazol-l-yl]-8-quinolinyl]-2-azaspiro[3.3]heptan-6-yl]carbamate (Intermediate 1, 50 mg, 89.98 pmol, 1 eq) in trifluoroacetic acid (TFA, 1 mL) and DCM (5 mL) was stirred at 20 °C for 16 h. The reaction mixture was concentrated and NH3H2O was added to pH = 7. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 x 30 mm x 10 pm; mobile phase: [water (10 mM NH4HCO3) - ACN]; B%: 40% - 65%, 10 min) to yield the title compound as a yellow solid (14.7 mg, 29.49 pmol, 32.77% yield, 91.393% purity). 1 H NMR (400 MHz, DMSO-d6) d: 1.42 (s, 3H) 1.84 - 1.93 (m, 2H) 2.36 - 2.41 (m, 2H) 3.20 - 3.24 (m, 1H) 4.08 - 4.25 (m, 6H) 4.35 (d, J = 5.75 Hz, 2H) 4.56 (d, J = 5.75 Hz, 2H) 6.65 (br d, J = 6.63 Hz, 1H) 7.11 (br d, J = 8.76 Hz, 1H) 7.32 (d, J = 7.75 Hz, 1H) 7.39 - 7.45 (m, 2H) 7.97 (d, J = 8.88 Hz, 1H) 8.14 (d, J = 9.01 Hz, 1H) 8.49 (d, J = 8.88 Hz, 1H) 8.95 (s, 1H).

[0623] Examples 3-9.

[0624] Examples 3-9 were prepared according to the procedure described in Example 1, starting with the appropriate intermediate compounds described above. NMR data for the compounds of Examples 3 and 6-9 are shown in Table 2B.

[0625] Table 2A.

[0626]

[0627]

[0628] Table 2B.

[0629]

[0630]

[0631] Example 10: 1 -Methyl-9-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1 -yl]-8- quinolinyl]-4-oxa-1,9-diazaspiro[5.5]undecane

[0632]

[0633] To a solution of 9-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1 -yl]-8- quinolinyl]-4-oxa-1,9-diazaspiro[5.5]undecane (Example 4, 85 mg, 170.1 μmol, 1 eq) in MeOH (4 mL) was added AcOH (10.2 mg, 170.1 μmol, 1 eq) until pH was about 5, then HCHO (25.5 mg, 850.7 μmol, 5 eq) was added at 0 °C. The mixture was then stirred at 25 °C for 0.5 h. Next, NaBH3CN (32.1 mg, 510.4 μmol, 3 eq) was added, and the mixture was stirred at 25 °C for 12 h. The reaction mixture was filtered and concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10μm; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 30%-55%, 10 min) to yield the title compound (32.1 mg, 62.3 μmol, 36.6% yield, 99.6% purity) as a light yellow solid. 1 H NMR (400 MHz, DMSO-d6) d: 9.15 (s, 1H), 8.86 (d, J = 8.8 Hz, 1H), 8.53 (d, J = 9.3 Hz, 1H), 8.12 (d, J = 9.0 Hz, 1H), 7.60 (d, J = 7.7 Hz, 1H), 7.48 (t, J = 7.9 Hz, 1H), 7.40 (d, J = 2.2 Hz, 1H), 7.32 (d, J = 8.2 Hz, 1H), 7.07-6.98 (m, 1H), 4.52 (d, J = 5.7 Hz, 2H), 4.32 (d, J = 5.7 Hz, 2H), 4.13 (s, 2H), 3.62 (br d, J = 8.6 Hz, 6H), 2.91 (br t, J = 11.1 Hz, 2H), 2.59 (br s, 2H), 2.40 (s, 3H), 2.25-2.10 (m, 2H), 1.64 (br d, J = 13.0 Hz, 2H), 1.39 (s, 3H).

[0634] Example 11: 8-((1 -Methylazetidin-3-yl)oxy)-2-(5-((3-methyloxetan-3-yl)methoxy)- 1 H-benzo[d]imidazol-1 -yl)quinoline

[0635]

[0636] The title compound was prepared according to the procedure described for Example 10 by substituting 8-(azetidin-3-yloxy)-2-(5-((3-methyloxetan-3-yl)methoxy)-1 H- benzo[d]imidazol-1 -yl)quinoline for 9-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol- 1 -yl]-8-quinolinyl]-4-oxa-1,9-diazaspiro[5.5]undecane. 1 H NMR (400 MHz, MeOD-d4) d: 9.00 (s, 1 H), 8.89 (d, J = 9.0 Hz, 1 H), 8.42 (d, J = 8.9 Hz, 1 H), 7.98 (d, J = 8.9 Hz, 1 H), 7.58 - 7.43 (m, 2 H), 7.32 (d, J = 2.3 Hz, 1 H), 7.17 (dd, J = 2.3, 9.0 Hz, 1 H), 7.02 (d, J = 7.4 Hz, 1 H), 5.09 (br t, J = 5.6 Hz, 1 H), 4.75 (d, J = 5.9 Hz, 2 H), 4.51 (d, J = 5.9 Hz, 2 H), 4.15 (s, 2 H), 4.05 - 3.96 (m, 2 H), 3.49 (br dd, J = 5.1, 9.3 Hz, 2 H), 2.51 (s, 3 H), 1.51 (s, 3 H)

[0637] Example 12: 8-[1 -(2-Methoxyethyl)-1,7-diazaspiro[3.5]nonan-7-yl]-2-[5-[(3- methyloxetan-3-yl)methoxy]benzoimidazol-1 -yl]quinoline

[0638]

[0639] To a solution of 8-(l,7-diazaspiro[3.5]nonan-7-yl)-2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]quinoline (Example 5, 75 mg, 160 pmol, 1 equiv) and l-bromo-2-methoxy-ethane (88.8 mg, 639 pmol, 60.0 uL, 4 equiv) in MeCN (5 mL) at 25 °C was added diisopropylethylamine (DIEA, 61.9 mg, 479 pmol, 83.5 uL, 3 equiv). The reaction mixture was then stirred at 60 °C for 12 h. The mixture was concentrated, and the resulting residue was purified by prep-HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10pm; mobile phase: [water (0.04% NH3H20 + 10 mM NH4HC03) - ACN]; B%: 25%-55%, 10 min) to give the title compound as a yellow solid (20.3 mg, 37.12 pmol, 23.24% yield, 96.481% purity). 1 H NMR (400 MHz, DMSO-d6) d: 1.34-1.45 (m, 3H) 1.81-1.95 (m, 4H) 1.99-2.11 (m, 2H) 2.66-2.75 (m, 4H) 3.14-3.21 (m, 2H) 3.26-3.29 (m, 3H) 3.37-3.39 (m, 2H) 3.68-3.77 (m, 2H) 4.12-4.16 (m, 2H) 4.31-4.36 (m, 2H) 4.51-4.56 (m, 2H) 7.06-7.11 (m, 1H) 7.27-7.32 (m, 1H) 7.37-7.41 (m, 1H) 7.45-7.51 (m, 1H) 7.59-7.64 (m, 1H) 8.13-8.17 (m, 1H) 8.52-8.57 (m, 1H) 8.92-8.97 (m, 1H) 9.14-9.21 (m, 1H).

[0640] Example 13: l-(2-(7-((3-methyloxetan-3-yl)methoxy)imidazo[l,2-a]pyridin-3- yl)quinolin-8-yl)piperidin-4-amine

[0641]

[0642] Step 1: 4-[(3-methyloxetan-3-yl)methoxy]pyridin-2-amine

[0643]

[0644] To a mixture of 4-chloropyridin-2-amine (5 g, 38.9 mmol, 1 eq) and (3- methyloxetan-3-yl)methanol (4.37 g, 42.8 mmol, 4.24 mL, 1.1 eq) in DMSO (150 mL) was added CsF (5.91 g, 38.9 mmol, 1.43 mL, 1 eq) and t-BuOK (8.73 g, 77.8 mmol, 2 eq) at 20 °C. The mixture was then stirred at 85 °C for 12 h, followed by stirring at 90 °C for 12 h. The reaction mixture was added to H2O (100 mL), then extracted with EtOAc (100 mL, 3x). The combined organic phases were washed with H2O (100 mL), saturated aqueous NH4Cl (100 mL), and brine (50 mL), then dried over Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by column chromatography (SiO2, petroleum ether: ethyl acetate = 10:1 to 0:1) to give the title compound (3.19 g, crude) as a brown oil.

[0645] Step 2: 7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridine

[0646]

[0647] To a mixture of 4-[(3-methyloxetan-3-yl)methoxy]pyridin-2-amine (3.19 g, 16.4 mmol, 1 eq) in EtOH (150 mL) was added NaHCO3(5.52 g, 65.7 mmol, 2.56 mL, 4 eq) and 2-chloroacetaldehyde (4.83 g, 24.6 mmol, 3.96 mL, 1.5 eq) at 20 °C. The mixture was then stirred at 80 °C for 3 h. The reaction mixture was concentrated under reduced pressure to remove EtOH, then extracted with EtOAc (100 mL, 3x). The combined organic phases were washed with saturated aqueous NH4Cl (50 mL) and brine (50 mL), then dried over Na2SO4and filtered. The filtrate was concentrated under reduced pressure to give the title compound (3.58 g, crude) as a brown oil.

[0648] Step 3: 8-benzyloxy-2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3- yl]quinoline

[0649]

[0650] To a solution of 7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridine (1 g, 4.58 mmol, 1 equiv), 8-benzyloxy-2-chloro-quinoline (1.36 g, 5.04 mmol, 1.1 equiv) and K2CO3 (1.27 g, 9.16 mmol, 2 equiv) in dioxane (30 mL) was added water (0.5 mL), Pd(OAc)2 (103 mg, 458 pmol, 0.1 equiv) and Pd(PPh3)4 (529 mg, 458 pmol, 0.1 equiv) at 15 °C under N2. The mixture was then stirred at 100 °C for 12 h. The mixture was filtered, concentrated, and the resulting residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate / methanol = 3:1:0 to 0:5:1) to give the title compound as a yellow oil (940 mg, crude).

[0651] Step 4: 2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3-yl]quinolin-8-ol

[0652]

[0653] A mixture of 8-benzyloxy-2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3- yl]quinoline (900 mg, 1.99 mmol, 1 equiv) and Pd / C (900 mg, 10% purity) in MeOH (150 mL) was degassed and purged with H2 (3x), then the mixture was stirred at 40 °C under a H2 atmosphere (15 psi) for 12 h, followed by stirring at 45 °C under a H2 atmosphere (15 psi) for another 4 h. The mixture was filtered and concentrated to give the title compound as a yellow oil (395 mg, crude).

[0654] Step 5: [2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3-yl]-8-quinolinyl] trifluoromethanesulfonate

[0655]

[0656] To a solution of 2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2- a]pyridin-3-yl]quinolin-8-ol (180 mg, 498 pmol, 1 equiv) and Et3N (101 mg, 996 pmol, 139 pL, 2 equiv) in DMF (3 mL) was added l,l,l-trifluoro-N-phenyl-N- (trifluoromethylsulfonyl)methanesulfonamide (196 mg, 548 pmol, 1.1 equiv) at 20 °C and the mixture was stirred at 20 °C for 1 h. The mixture was filtered and the filter cake was dried to yield the title compound (85 mg, crude) as a yellow solid.

[0657] Step 6: N-[l-[2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3-yl]-8- quinolinyl]-4-piperidyl]carbamic acid tert-butyl ester

[0658]

[0659] To a mixture of [2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3-yl]-8- quinolinyl]trifluoromethanesulfonate (85 mg, 172 pmol, 1 equiv), N-(4-piperidyl)carbamic acid tert-butyl ester (40.0 mg, 189 pmol, 1.1 equiv), Cs2CO3(112 mg, 345 pmol, 2 equiv), BINAP (21.5 mg, 34.5 pmol, 0.2 equiv), and Pd2(dba)3(15.8 mg, 17.2 pmol, 0.1 equiv) in toluene (4 mL) was degassed and purged with N2(3x), then the mixture was stirred at 100 °C under N2atmosphere for 16 h. The mixture was filtered, concentrated, and the resulting residue was purified by preparative TLC (ethyl acetate:methanol = 5: 1) to yield the title compound (50 mg, crude) as a yellow oil.

[0660] Step 7: l-[2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3-yl]-8- quinolinyl]piperidin-4-amine

[0661]

[0662] A mixture of tert-butyl N-[1-[2-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[1,2- a]pyridin-3-yl]-8-quinolinyl]-4-piperidyl]carbamate (50 mg, 92.0 pmol, 1 equiv) in DCM (2 mL) and TFA (0.2 mL) was stirred at 20 °C for 5 h. DCM was removed under N2and MeOH (2 mL) was added. NaHCO3was added to the mixture until pH was 7. The mixture was filtered, concentrated, and the resulting residue was purified by prep-HPLC (FA condition; Column: Phenomenex Luna C18 100*30mm*5pm (Phenomenex Luna C18 100*30mm*5pm); Mobile Phase: [water (0.2% FA) - ACN]; B%: 5% - 35%, 10 min) to yield the title compound (4.3 mg, 8.23 pmol, 8.95% yield, 93.715% purity, FA) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) d: 1.41-1.44 (m, 3H) 1.80-1.93 (m, 2H) 2.03-2.12 (m, 2H) 2.72-2.82 (m, 2H) 3.08 (br d, J = 2.81 Hz, 1H) 3.76-3.80 (m, 2H) 4.22-4.26 (m, 2H) 4.33-4.38 (m, 2H) 4.53-4.58 (m, 2H) 7.24-7.31 (m, 3H) 7.42-7.47 (m, 1H) 7.53-7.57 (m, 1H) 8.11-8.14 (m, 1H) 8.28-8.32 (m, 1H) 8.36-8.48 (m, 2H) 8.52-8.56 (m, 1H) 10.39-10.46 (m, 1H).

[0663] Example 14: 3-(((1-(8-(4-aminopiperidin-1-yl)quinoxalin-2-yl)-1H- benzo[d]imidazol-5-yl)oxy)methyl)thietane 1,1-dioxide

[0664]

[0665] Step 1: 3-(dimethoxymethyl)-3-pyrrolidin-1-yl-thietane 1,1-dioxide

[0666]

[0667] A solution of methanesulfonyl chloride (7.36 g, 64.2 mmol, 4.97 mL, 1.1 eq) in diethyl ether (15 mL) was added to a mixture of 1-[1- (dimethoxymethyl)vinyl]pyrrolidine (10 g, 58.4 mmol, 1 eq) and Et3N (6.50 g, 64.2 mmol, 8.94 mL, 1.1 eq) in diethyl ether (30 mL) at 0 °C, the reaction mixture was then stirred at 20 °C for 1 h. The reaction mixture was poured into water (60 mL), and the aqueous layer was extracted with DCM. The combined organic layers were dried over Na2SO4and concentrated to yield the title compound (13 g, crude) as a yellow oil. 1 H NMR (400 MHz, CDC13) δ: 1.82 (br s, 4H) 2.78-2.86 (m, 4H) 3.56 (s, 6H) 4.09 (br d, J = 14.38 Hz, 2H) 4.28 (br d, J = 14.63 Hz, 2H) 4.44-4.55 (m, 1H).

[0668] Step 2: 3-(dimethoxymethyl)-2H-thiacyclobutene 1,1-dioxide

[0669]

[0670] To a solution of methyl triflate (11.3 g, 68.8 mmol, 7.53 mL, 1.1 eq) in DCM (20 mL) was added 3-(dimethoxymethyl)-3-pyrrolidin-1-yl- thiacyclobutane 1,1-dioxide (15.6 g, 62.6 mmol, 1 eq) in DCM (100 mL) at 0 °C, and the reaction mixture was then stirred at 20 °C for 18 h. Et3N (6.96 g, 68.8 mmol, 9.58 mL, 1.1 eq) in DCM (30 mL) was added, and the resulting mixture was stirred at 45 °C for 1 h. The reaction mixture was poured into a mixture of H2O (60 mL) and HC1 (15 mL, 1 N), extracted with DCM (50 mL, 3x), dried over Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by column chromatography (SiO2, petroleum ether: ethyl acetate = 10:1 to 0:1) to yield the title compound (5.7 g, crude) as a yellow solid. 1 H NMR (400 MHz, CDC13) δ: 3.37 (s, 6H) 4.39-4.52 (m, 2H) 5.16 (s, 1H) 6.77 (s, 1H)

[0671] Step 3: 3-(dimethoxymethyl)thiacyclobutane 1,1-dioxide

[0672]

[0673] To a mixture of 3-(dimethoxymethyl)-2H-thiirene 1,1-dioxide (5.6 g, 31.4 mmol, 1 eq) in EtOH (200 mL) was added Pd / C (3 g, 10% purity) and the reaction mixture was stirred at 50 °C under H2atmosphere (50 psi) for 24 h. The mixture was filtered and concentrated to yield the title compound as a yellow oil (4.95 g, crude). 1 H NMR (400 MHz, CDC13) δ: 2.72-2.88 (m, 1H) 3.30-3.48 (m, 6H) 3.95-4.16 (m, 4H) 4.52 (d, J = 6.17 Hz, 1H).

[0674] Step 4: 1,1-Dioxothiolane-3-carbaldehyde

[0675]

[0676] A mixture of 3-(dimethoxymethyl)thiolane 1,1-dioxide (1.37 g, 7.60 mmol, 1 eq) in HCl (20 mL, 1 N) was stirred at 80 °C for 1 h. The reaction mixture was then extracted with EtOAc (50 mL, 3x) and the combined organic phase was dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a yellow oil (434 mg, 3.24 mmol, 42.56% yield).

[0677] Step 5: (1,1-Dioxothiolan-3-yl)methanol

[0678]

[0679] To a mixture of 1,1-dioxothiolane-3-carbaldehyde (150 mg, 1.12 mmol, 1 eq) in MeOH (3 mL) was added NaBH4(63.5 mg, 1.68 mmol, 1.5 eq) at 0 °C and the resulting mixture was stirred at 15 °C for 1 h. H20 (0.5 mL) was added to the mixture which was then concentrated under reduced pressure. DCM was added to the resulting residue which was then filtered and concentrated to yield the title compound as a yellow oil (86 mg, crude). 1 H NMR (400 MHz, CDC13) δ: 2.68-2.81 (m, 1H) 3.82-3.88 (m, 2H) 3.93-4.04 (m, 2H) 4.13-4.24 (m, 2H).

[0680] Step 6: (1,1-dioxothiolan-3-yl)methyl methanesulfonate

[0681]

[0682] To a solution of (1,1-dioxothiolan-3-yl)methanol (86 mg, 631.57 pmol, 1 equiv) and Et3N (128 mg, 1.26 mmol, 176 pL, 2 equiv) in DCM (3 mL) was added MsCI (109 mg, 947 pmol, 73.3 pL, 1.5 equiv) at 0 °C and the mixture was then stirred at 20 °C for 1 h. The reaction mixture was added to H2O (2 mL) and then extracted with DCM (3 mL, 3x). The combined organic phase was washed with brine (2 mL), then dried over Na2S04, filtered and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (petroleum ether / ethyl acetate = 1 :2) to give the title compound (10 mg, crude) as a yellow oil. 1 H NMR (400 MHz, CDC13) δ: 2.95-3.05 (m, 1H) 3.07-3.13 (m, 3H) 3.96-4.04 (m, 2H) 4.23-4.35 (m, 2H) 4.39-4.46 (m, 2H).

[0683] Step 7: tert-butyl N-[1-[3-[5-[(1,1-dioxothiolan-3-yl)methoxy]benzoimidazol-1-yl]quinoxalin-5-yl]-4-piperidyl]carbamate

[0684]

[0685] A mixture of tert-butyl N-[1-[3-(5-hydroxybenzoimidazol-1-yl)quinoxalin-5-yl]-4- piperidyl]carbamate (24 mg, 52.1 pmol, 1 equiv), (1,1-dioxothiolan-3-yl)methyl methanesulfonate (10 mg, 46.7 pmol), Cs2C03(34.0 mg, 104 pmol, 2 equiv) and KI (8.65 mg, 52.1 pmol, 1 equiv) in DMF (2 mL) was stirred at 70 °C for 36 h. The reaction mixture was poured into saturated aqueous NH4CI solution (10 mL) and then extracted with EtOAc (10 mL, 3x). The combined organic phase was washed with brine (10 mL), then dried over Na2S04, filtered and concentrated under reduced pressure to give the title compound (50 mg, crude) as a yellow oil.

[0686] Step 8: 1-[3-[5-[(1,1-dioxothietan-3-yl)methoxy]benzoimidazol-1-yl]quinoxalin-5- yl]piperidin-4-amine

[0687]

[0688] A mixture of tert-butyl N-[1-[3-[5-[(1,1-dioxothietan-3-yl)methoxy]benzoimidazol-1- yl]quinoxalin-5-yl]-4-piperidinyl]carbamate (50 mg, 86.4 pmol, 1 eq) in EtOAc (HCl 2M) (2 mL) was stirred at 20 °C for 1 h. The mixture was concentrated and the resulting residue was purified by preparative HPLC (basic condition, column: Waters Xbridge 150*25mm*5pm; mobile phase: [water (0.04% NH3H20 + 10 mM NH4HCO3) - ACN]; B%: 22%-42%, 10 min) to yield the title compound (4.3 mg, 8.77 pmol, 10.15% yield, 97.629% purity) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) d: 1.65-1.76 (m, 2H) 1.93-2.00 (m, 2H) 2.74-2.94 (m, 4H) 2.97-3.12 (m, 2H) 3.71-3.81 (m, 2H) 4.06-4.15 (m, 2H) 4.24-4.30 (m, 2H) 4.31-4.41 (m, 2H) 7.18-7.24 (m, 1H) 7.32-7.37 (m, 1H) 7.40-7.45 (m, 1H) 7.67-7.73 (m, 2H) 8.74-8.80 (m, 1H) 9.34-9.38 (m, 1H) 9.62-9.65 (m, 1H).

[0689] Example 15: 8-(1-methylazetidin-3-yl)-2-(5-((3-methyloxetan-3-yl)methoxy)-1H- benzo[d]imidazol-1-yl)quinoline

[0690]

[0691] Step 1 : tert-Butyl 3-(2-chloro-8-quinolinyl)azetidine-1-carboxylate

[0692]

[0693] A mixture of 8-bromo-2-chloro-quinoline (100 mg, 412.4 pmol, 1 equiv), 3- iodoazetidine-1 -carboxylic acid tert-butyl ester (175.1 mg, 618.6 pmol, 1.5 equiv), dichloronickel; 1,2-dimethoxyethane (453.0 pg, 2.1 pmol, 0.005 equiv), 4-tert-butyl-2-(4-tert-butyl-2-pyridyl)pyridine (553.4 pg, 2.1 pmol, 0.005 equiv) and bis[3,5-difluoro-2-[5-(trifluoromethyl)-2-pyridyl]phenyl]iridium, 4-tert-butyl-2-(4-tert-butyl-2-pyridyl)pyridine, hexafluorophosphate (4.6 mg, 4.1 pmol, 0.01 equiv), Na2C03(87.4 mg, 824.7 pmol, 2 equiv) and tris(trimethylsilyl)silane (TTMSS, 102.5 mg, 412.4 pmol, 127.2 pi, 1 equiv) in DME (3 mL) was degassed and purged with N2(3x) and the mixture was then stirred at 25 °C under N2atmosphere and 34 W blue LED for 12 h. The reaction mixture was added to water (40 mL) and extracted with EtOAc (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (Si02, petroleum ether: ethyl acetate = 3:1) to yield the title compound (240 mg, crude) as a yellow oil.

[0694] Step 2: 3-[2-[4-[(3-methyloxetan-3-yl)methoxy]-2-nitro-anilino]-8- quinolinyl]azetidine-1 -carboxylic acid tert-butyl ester

[0695]

[0696] A mixture of 4-[(3-methyloxetan-3-yl)methoxy]-2-nitro-aniline (25 mg, 104.9 pmol, 1 equiv), 3-(2-chloro-8-quinolyl)azetidine-1 -carboxylate (46.8 mg, 146.9 pmol, 1.4 equiv), Cs2CO3(68.4 mg, 209.9 pmol, 2 equiv), BINAP (13.1 mg, 20.9 pmol, 0.2 equiv) and Pd2(dba)3(9.6 mg, 10.5 pmol, 0.1 equiv) in dioxane (2 mL) was degassed and purged with N2(3x) and the mixture was then stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was added to water (10 mL) and extracted with EtOAc (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, dried, filtered and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, petroleum ether: ethyl acetate = 1 :1 ) to yield the title compound as a yellow oil (37 mg, crude).

[0697] Step 3: 3-[2-[2-amino-4-[(3-methyloxetan-3-yl)methoxy]anilino]-8- quinolinyl]azetidine-1 -carboxylate

[0698]

[0699] A mixture of 3-[2-[4-[(3-methyloxetan-3-yl)methoxy]-2-nitro-anilino]-8- quinolinyl]azetidine-1 -carboxylate (470.0 mg, 902.9 pmol, 1 equiv) and Pd / C (200 mg, 10% purity) in EtOAc (20 mL) was degassed and purged with H2(3x) and the mixture was then stirred at 25 °C under H2atmosphere (15 psi) for 1 h. The reaction mixture was filtered and concentrated under reduced pressure to yield the title compound as a yellow solid (420 mg, crude).

[0700] Step 4: 3-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1 -yl]-8- quinolinyl]azetidine-1 -carboxylate

[0701]

[0702] To a solution of 3-[2-[2-amino-4-[(3-methyloxetan-3-yl)methoxy]anilino]-8- quinolinyl]azetidine-1 -carboxylate tert-butyl (0.8 g, 1.6 mmol, 1 equiv) in orthoformic acid trimethyl ester (5 mL) was added HCOOH (235.0 mg, 4.9 mmol, 3 equiv) and the mixture was stirred at 100 °C for 2 hours. The reaction mixture was cooled to 25 °C, petroleum ether (50 mL) was added, the mixture was filtered, the filter cake was dried under vacuum to yield the title compound (270 mg, crude) as a yellow solid.

[0703] Step 5: 8-(azetidin-3-yl)-2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1- yl]quinoline

[0704]

[0705] To a solution of 3-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1-yl]-8- quinolinyl]azetidine-1 -carboxylate tert-butyl (30 mg, 59.9 pmol, 1 equiv) in DCM (1.5 mL) was added TFA (92.4 mg, 810.4 pmol, 60.0 pL, 13.5 equiv) at 0 °C and the mixture was stirred at 20 °C for 10 minutes. The reaction mixture was concentrated under reduced pressure and the resulting residue was dissolved in MeOH (2 mL). Diisopropylethylamine was added to the solution until the pH was about 8. The reaction mixture was then concentrated under reduced pressure to yield the title compound (25 mg, crude) as a yellow oil.

[0706] Step 6: 8-(1 -methylazetidin-3-yl)-2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-1- yl]quinoline

[0707]

[0708] To a solution of 8-(azetidin-3-yl)-2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]quinoline (25 mg, 62.4 μmol, 1 eq) in MeOH (1 mL) was added AcOH (3.8 mg, 62.4 μmol, 3.6 μL, 1 eq) until pH was about 5, then HCHO (18.8 mg, 624.3 μmol, 17.2 μL, 10 eq) was added at 0 °C, and the resulting mixture was stirred at 25 °C for 30 min. Next, NaBH3CN (11.8 mg, 187.3 μmol, 3 eq) was added, and the mixture was stirred at 25 °C for 12 h. The reaction mixture was filtered, concentrated under reduced pressure, and the resulting residue was purified by prep-HPLC (basic condition; column: Waters Xbridge Prep OBD C18 150*40mm*10μm; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 20%-50%, 8 min) to give the title compound (4.0 mg, 9.6 μmol, 15.4% yield, 99.3% purity) as a white solid. 1 H NMR (400 MHz, MeOD-d4) d: 8.92 (s, 1H), 8.47 (dd, J = 6.9, 8.7 Hz, 2H), 7.93 (d, J = 8.9 Hz, 1H), 7.85 (d, J = 8.0 Hz, 1H), 7.74 (br d, J = 7.0 Hz, 1H), 7.64-7.56 (m, 1H), 7.33 (d, J = 2.3 Hz, 1H), 7.21 (dd, J = 2.3, 8.9 Hz, 1H), 4.80-4.63 (m, 3H), 4.51 (d, J = 5.9 Hz, 2H), 4.14 (s, 2H), 4.10 (br t, J = 7.9 Hz, 2H), 3.39 (br t, J = 8.3 Hz, 2H), 2.44 (s, 3H), 1.51 (s, 3H).

[0709] Example 16: 2-(5-((3-methyloxetan-3-yl)methoxy)-lH-benzo[d]imidazol-l-yl)-8- (pyrrolidin-3-yl)quinoline

[0710]

[0711] Step 1: tert-Butyl 4-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]-2,3-dihydropyrrole-l-carboxylate

[0712]

[0713] A mixture of [2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]trifluoromethanesulfonate (100 mg, 202.7 μmol, 1 equiv), tert-butyl 4-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-2,3-dihydropyrrole-l-carboxylate (89.7 mg, 303.9 μmol, 1.5 equiv), Na2CO3(42.9 mg, 405.3 μmol, 2 equiv), Pd(dppf)Cl2(14.8 mg, 20.3 μmol, 0.1 equiv) in dioxane (2 mL) and H2O (0.2 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was concentrated, and the resulting residue was purified by column chromatography (SiO2, petroleum ether: ethyl acetate = 50: 1 to 0: 1) to give the title compound as a yellow solid (200 mg, crude).

[0714] Step 2: tert-Butyl 3-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]pyrrolidine-l-carboxylate

[0715]

[0716] A mixture of tert-butyl 4-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]-2,3-dihydropyrrole-l-carboxylate (150 mg, 292.6 μmol, 1 equiv) and Pd / C (20 mg, 97.5 μmol, 10% purity) in EtOAc (10 mL) was degassed and purged with H2(3x), and then the mixture was stirred at 15 °C under H2atmosphere (15 psi) for 3 h. The reaction mixture was filtered and concentrated under reduced pressure to give the title compound as a yellow solid (190 mg, crude).

[0717] Step 3: 2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8-pyrrolidin-3-yl- quinoline

[0718]

[0719] A mixture of tert-butyl 3-[2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]pyrrolidine-e-1-carboxylate (70 mg, 136.0 μmol, 1 equiv) in TFA (0.1 mL) and DCM (1 mL) was stirred at 15 °C for 30 min. The reaction mixture was concentrated under reduced pressure and the resulting residue was dissolved in MeOH (2 mL). Diisopropylethylamine (DIEA) was added to the solution until the pH was about 8. The reaction mixture was then concentrated under reduced pressure and the resulting residue was purified by preparative HPLC (basic condition; column: Waters X bridge Prep OBD C18 150*40mm*10μm; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 30%-60%, 8 min) to yield the title compound (5.3 mg, 12.1 μmol, 8.9% yield, 94.8% purity) as a yellow solid. 1 HNMR (400 MHz, MeOD-d4) δ: 9.00-8.94 (m, 1H), 8.55-8.48 (m, 1H), 8.46-8.39 (m, 1H), 8.03-7.93 (m, 1H), 7.90-7.83 (m, 1H), 7.78 (br d, J = 7.1 Hz, 1H), 7.59 (dt, J = 3.4, 7.7 Hz, 1H), 7.36-7.29 (m, 1H), 7.24-7.15 (m, 1H), 4.71 (dd, J = 2.1, 5.9 Hz, 2H), 4.66-4.56 (m, 1H), 4.48 (dd, J = 1.5, 5.9 Hz, 2H), 4.16-4.07 (m, 2H), 3.65 (br dd, J = 7.9, 10.9 Hz, 1H), 3.37-3.32 (m, 1H), 3.28-3.21 (m, 1H), 3.13-3.01 (m, 1H), 2.56-2.42 (m, 1H), 2.19-2.06 (m, 1H), 1.48 (d, J = 1.8 Hz, 3H)

[0720] Example 17: 2-(5-((3-methyloxetan-3-yl)methoxy)-lH-benzo[d]imidazol-l-yl)-8-(l- methylpyrrolidin-3-yl)quinoline

[0721]

[0722] To a solution of 2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- pyrrolidin-3-yl-quinoline (Example 16, 56 mg, 135.1 μmol, 1 eq) in MeOH (1 mL) was added AcOH (8.1 mg, 135.1 μmol, 1 eq) until the solution reached pH ~5, then HCHO (40.6 mg, 1.4 mmol, 10 eq) was added at 15 °C for 30 min, next, NaBH3CN (25.5 mg, 405.3 μmol, 3 eq) was added and the mixture was stirred at 35 °C for 12 h. The reaction mixture was concentrated and the resulting residue was purified by prep-HPLC (basic condition; column: Phenomenex Gemini-NX C18 75*30mm*3μm; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 65%, 8 min) to give the title compound (3 mg, 6.6 μmol, 14.2% yield, 94.7% purity) as a white solid. 1 H NMR (400 MHz, MeOD-d4) δ: 9.03 (s, 1H), 8.54 (dd, J = 3.1, 8.8 Hz, 2H), 8.02 (d, J = 9.0 Hz, 1H), 7.89 (d, J = 7.6 Hz, 2H), 7.64 (t, J = 7.5 Hz, 1H), 7.39 (s, 1H), 7.25 (br d, J = 8.8 Hz, 1H), 4.77 (d, J = 5.8 Hz, 2H), 4.53 (d, J = 5.9 Hz, 2H), 4.19 (s, 2H), 3.47 - 3.38 (m, 1H), 3.38 (br s, 1H), 3.12 - 3.01 (m, 1H), 2.94 - 2.84 (m, 1H), 2.79 (br t, J = 9.1 Hz, 1H), 2.69 - 2.59 (m, 1H), 2.55 (s, 3H), 2.21 - 2.09 (m, 1H), 1.53 (s, 3H).

[0723] Example 18: 8-(l-methyl-lH-imidazol-4-yl)-2-(5-((3-methyloxetan-3-yl)methoxy)-lH- benzo[d]imidazol-l-yl)quinoline

[0724]

[0725] Step 1: 2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)quinoline

[0726]

[0727] A mixture of [2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]trifluoromethanesulfonate (200 mg, 405.3 pmol, 1 equiv), 4,4,5,5- tetramethyl-2-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-l,3,2-dioxaborolane (113.2 mg, 445.8 pmol, 1.1 equiv), KOAc (119.3 mg, 1.2 mmol, 3 equiv), and Pd(dppf)Cl2(29.7 mg, 40.5 pmol, 0.1 equiv) in dioxane (2 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was concentrated to yield the title compound (190 mg, crude) as a yellow oil.

[0728] Step 2: 8-(l-Methylimidazol-4-yl)-2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l- yl]quinoline

[0729]

[0730] A mixture of [2-[5-[(3-methyloxetan-3-yl)methoxy]benzoimidazol-l-yl]-8- quinolinyl]boronic acid (160 mg, 411.1 pmol, 1 equiv), 4-bromo-l-methyl-imidazole (99.3 mg, 616.6 pmol, 1.5 equiv), Na2CO3(130.7 mg, 1.2 mmol, 3 equiv), 4- di-tert-butylphosphanyl-N,N-dimethylaniline; dichloropalladium (29.1 mg, 41.1 pmol, 0.1 equiv) in dioxane (2 mL) and H2O (0.2 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was added to water (20 mL) and extracted with EtOAc (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered, concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (basic conditions; column: Waters Xbridge Prep OBD C18 150*40mm*10pm; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 20%-45%, 8 min) to yield the title compound (8.5 mg, 19.7 pmol, 4.8% yield, 98.8% purity) as a white solid. 1H NMR (400 MHz, MeOD-d4) δ: 8.95 (s, 1H), 8.56 (d, J = 8.9 Hz, 1H), 8.43-8.34 (m, 2H), 8.19 (s, 1H), 7.97 (d, J = 8.8 Hz, 1H), 7.90 (d, J = 7.3 Hz, 1H), 7.80 (s, 1H), 7.67 (t, J = 7.7 Hz, 1H), 7.38 (d, J = 2.3 Hz, 1H), 7.13 (dd, J = 2.3, 8.9 Hz, 1H), 4.75 (d, J = 5.9 Hz, 2H), 4.51 (d, J = 5.9 Hz, 2H), 4.16 (s, 2H), 3.82 (s, 3H), 1.51 (s, 3H).

[0731] Example 19: 3-(4-Carbonitrilephenyl)-N-[(6-methyl-3-pyridinyl)methyl]imidazo[l,2- a]pyridine-7-carboxamide

[0732]

[0733] Step 1: 3-Bromoimidazo[l,2-a]pyridine-7-carboxylic acid methyl ester

[0734]

[0735] Methyl imidazo[l,2-a]pyridine-7-carboxylate (760 mg, 4.31 mmol, 1 eq) was mixed with NBS (844.60 mg, 4.75 mmol, 1.1 eq) in DMF (10 mL) and then the mixture was stirred at 20 °C for 1 h. The reaction mixture was quenched by adding water (30 mL) and extracted with EtOAc (150 mL). The combined organic layers were washed with brine (50 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a yellow solid (1.1 g, crude).

[0736] Step 2: 3-(4-Carbonitrilephenyl)imidazo[l,2-a]pyridine-7-carboxylic acid methyl ester

[0737]

[0738] A mixture of methyl 3-bromoimidazo[l,2-a]pyridine-7-carboxylate (750 mg, 2.94 mmol, 1 eq), (4-cyano phenyl)boronic acid (518.47 mg, 3.53 mmol, 1.2 eq), Na2C03(623.30 mg, 5.88 mmol, 2 eq), Pd(dppf)Cl2(215.15 mg, 294.04 μmol, 0.1 eq) in dioxane (20 mL) and H20 (2 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 90 °C under N2atmosphere for 12 h. The reaction mixture was then filtered, and the filtrate was concentrated under reduced pressure to yield a residue. The residue was triturated with MeOH (30 mL) at 25 °C for 30 min, filtered, and the filter cake was concentrated under reduced pressure to yield the title compound (300 mg, crude) as a grey solid.

[0739] Step 3: 3-(4-cyano phenyl)imidazo[l,2-a]pyridine-7-carboxylic acid

[0740]

[0741] A mixture of methyl 3-(4-cyano phenyl)imidazo[l,2-a]pyridine-7-carboxylate (280 mg, 1.01 mmol, 1 eq), NaOH (80.79 mg, 2.02 mmol, 2 eq) in MeOH (30 mL), THF (10 mL) and H20 (5 mL) was prepared, and the mixture was stirred at 25 °C for 24 h. The reaction mixture was concentrated under reduced pressure to remove MeOH and THF, then HCl (12 N; 1 mL) was added. The resulting solution was filtered and the filter cake was concentrated under reduced pressure to yield the title compound (300 mg, crude) as a brown solid.

[0742] Step 4: 3-(4-cyano phenyl)-N-[(6-methyl-3-pyridinyl)methyl]imidazo[l,2- a]pyridine-7-carboxamide

[0743]

[0744] A mixture of 3-(4-cyanophenyl)imidazo[l,2-a]pyridine-7-carboxylic acid (70 mg, 265.91 μmol, 1 eq), (6-methyl-3-pyridyl)methanamine (35.73 mg, 292.50 μmol, 1.1 eq) and DIEA (68.73 mg, 531.81 μmol, 92.63 μL, 2 eq) in DMF (3 mL) was prepared, then HATU (151.66 mg, 398.86 μmol, 1.5 eq) was added and the resulting mixture was stirred at 40 °C for 12 h. The reaction mixture was filtered and the resulting residue was purified by preparative HPLC (basic condition; column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 45%, 10 min) to yield the title compound (62.4 mg, 169.52 μmol, 63.75% yield, 99.810% purity) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ: 9.35 (t, J = 5.8 Hz, 1H), 8.77 (d, J = 7.1 Hz, 1H), 8.44 (d, J = 1.9 Hz, 1H), 8.28 (s, 1H), 8.13 (s, 1H), 8.05 - 7.99 (m, 2H), 7.97 - 7.93 (m, 2H), 7.65 (dd, J = 2.2, 7.9 Hz, 1H), 7.46 (dd, J = 1.6, 7.3 Hz, 1H), 7.23 (d, J = 7.9 Hz, 1H), 4.49 (d, J = 5.8 Hz, 2H), 2.45 (s, 3H).

[0745] Examples 20-28.

[0746] Examples 20-28 were prepared according to the procedure described in Example 19 using the appropriately substituted starting materials. NMR data for the compounds of Examples 20-28 are shown in Table 3B.

[0747] Table 3A.

[0748]

[0749]

[0750] Table 3B.

[0751]

[0752]

[0753] Example 29: 3-(4-nitrilephenyl)-N-methyl-N-[(l-methylbenzoimidazol-2-yl)methyl]imidazo[l,2- a]pyridine-7-carboxamide

[0754]

[0755] Step 1: 3-(4-nitrilephenyl)-N-[(l-methylbenzoimidazol-2-yl)methyl]imidazo[l,2- a]pyridine-7-carboxamide

[0756]

[0757] A mixture of 3-(4-nitrilephenyl)imidazo[l,2-a]pyridine-7-carboxylic acid (100 mg, 379.9 pmol, 1 eq), (l-methylbenzoimidazol-2-yl)methanamine (67.4 mg, 417.8 pmol, 1.1 eq) and DIEA (98.2 mg, 759.7 pmol, 132.3 pL, 2 eq) in DMF (2 mL) was prepared, then HATU (216.6 mg, 569.8 pmol, 1.5 eq) was added, and the mixture was stirred at 40 °C for 12 h. The reaction mixture was filtered and the filter cake was concentrated under reduced pressure to yield a residue. The residue was purified by preparative HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: []; B%: 20%-50%, 8 min) to yield the title compound (80 mg, crude) as a white solid.

[0758] Step 2: 3-(4-nitrilephenyl)-N-methyl-N-[(l-methylbenzoimidazol-2-yl)methyl]imidazo[l,2- a]pyridine-7-carboxamide

[0759]

[0760] To a mixture of 3-(4-cyanophenyl)-N-[(l-methylbenzoimidazol-2-yl)methyl]imidazo[l,2- a]pyridine-7-carboxamide (80 mg, 196.8 pmol, 1 eq) in DMF (0.5 mL) was added NaH (7.9 mg, 196.8 pmol, 60% purity, 1 eq) at 0 °C, and then the mixture was stirred at 0 °C for 0.5 h. Methyl iodide (22.3 mg, 157.5 pmol, 9.80 pL, 0.8 eq) in DMF (0.1 mL) was added to the reaction mixture, then the mixture was stirred at 25 °C for 0.5 h. The reaction mixture was quenched by the addition of 0 °C saturated NH4Cl (aq, 15 mL), then extracted with DCM (60 mL). The combined organic layers were washed with brine (50 mL), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (basic condition; column: Waters X bridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.05% NH3H20 10mM NH4HC03)-ACN]; B%: 25%-38%, 8 min) to give the title compound (10 mg, 23.8 pmol, 12.1% yield, 100% purity) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d: 8.82-8.61 (m, 1H), 8.35-7.80 (m, 6H), 7.74-7.59 (m, 1H), 7.59-7.47 (m, 1H), 7.32-7.17 (m, 2H), 7.12 (d, J = 7.1 Hz, 1H), 5.12-4.72 (m, 2H), 3.95-3.56 (m, 3H), 3.10 (br s, 3H).

[0761] Example 30: 3-(4-cyanophenyl)-N-methyl-N-((6-methylpyridin-3-yl)methyl)imidazo[l,2- a]pyridine-7-carboxamide

[0762]

[0763] The title compound was prepared according to the procedure described in Example 29, substituting (6-methylpyridin-3-yl)methanamine for (l-methyl-lH-benzo[d]imidazol-2- yl)methanamine. Yield: 32.3 mg; 100% purity. 1H NMR (400 MHz, DMSO-d6) δ: 8.72 (d, J = 7.1 Hz, 1H), 8.52-8.41 (m, 1H), 8.06 (s, 1H), 8.02-7.97 (m, 2H), 7.96-7.91 (m, 2H), 7.85 (br s, 1H), 7.73-7.56 (m, 1H), 7.27 (br d, J = 8.0 Hz, 1H), 7.08 (br d, J = 6.8 Hz, 1H), 4.67 (br s, 2H), 2.95 (br s, 3H), 2.46 (s, 3H).

[0764] Example 31: 3-(2,5-dimethoxyphenyl)-N-(3-pyridinylmethyl)imidazo[l,2- a]pyridine-7-carboxamide

[0765] pyridine-7-carboxamide

[0766]

[0767] Step 1: 3-bromoimidazo[l,2-a]pyridine-7-carboxylic acid methyl ester

[0768]

[0769] To a mixture of imidazo[l,2-a]pyridine-7-carboxylic acid methyl ester (300 mg, 1.70 mmol, 1 eq) in DMF (5 mL) was added NBS (333.39 mg, 1.87 mmol, 1.1 eq) at 20 °C, then the reaction mixture was stirred at 20 °C for 1 h. The mixture was added to water (30 mL) and extracted with EtOAc (2 mL, 3x). The organic layer was dried over Na2S04and concentrated to give the title compound (450 mg, crude) as a yellow solid.

[0770] Step 2: 3-(2,5-dimethoxyphenyl)imidazo[l,2-a]pyridine-7-carboxylic acid methyl ester

[0771]

[0772] To a mixture of methyl 3-bromoimidazo[l,2-a]pyridine-7-carboxylate (450 mg, 1.76 mmol, 1 eq), (2,5-dimethoxyphenyl)boronic acid (321.06 mg, 1.76 mmol, 1 eq) in dioxane (15 mL) and H2O (1.5 mL) was added Na2CO3(373.98 mg, 3.53 mmol, 2 eq) and Pd(dppf)Cl2(129.09 mg, 176.42 μmol, 0.1 eq) at 20 °C, and the mixture was heated at 100 °C under N2for 12 h. The reaction mixture was then concentrated to yield the crude product, which was purified by column chromatography on silica gel (petroleum ether: ethyl acetate = 10: 1-1: 1) to yield the title compound (240 mg, 768.44 μmol, 43.56% yield) as a yellow solid.

[0773] Step 3: 3-(2,5-dimethoxyphenyl)imidazo[l,2-a]pyridine-7-carboxylic acid

[0774]

[0775] To a mixture of methyl 3-(2,5-dimethoxyphenyl)imidazo[l,2-a]pyridine-7- carboxylate (240 mg, 768.44 μmol, 1 eq) in MeOH (2 mL) / H2O (7 mL) was added NaOH (61.47 mg, 1.54 mmol, 2 eq) at 20 °C, then the reaction mixture was stirred at 20 °C for 12 h. The mixture was concentrated to remove MeOH, then the aqueous layer was acidified with HC1 (6 M) to pH = 3, filtered, and the filter cake was dried under vacuum. The title compound was obtained as a yellow solid (180 mg, crude).

[0776] Step 4: 3-(2,5-dimethoxyphenyl)-N-(3-pyridinylmethyl)imidazo[l,2-a]pyridine-7- carboxamide

[0777]

[0778] To a mixture of 3-(2,5-dimethoxyphenyl)imidazo[l,2-a]pyridine-7-carboxylic acid (80 mg, 268.19 umol, 1 eq) in DMF (2 mL) was added DIEA (69.32 mg, 536.39 umol, 93.43 uL, 2 eq), 3-pyridinylmethanamine (29.00 mg, 268.19 umol, 27.11 uL, 1 eq) and HATU (122.37 mg, 321.83 umol, 1.2 eq), and the reaction mixture was stirred at 40 °C for 12 h. The reaction mixture was then concentrated to yield the crude product, which was purified by prep-HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 45%, 10 min) to yield the title compound (39.5 mg, 100.21 umol, 37.37% yield, 98.544% purity) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d: 3.74 (s, 3H) 3.78 (s, 3H) 4.54 (d, J = 5.75 Hz, 2H) 7.04 (d, J = 3.13 Hz, 1H) 7.07 - 7.12 (m, 1H) 7.16 - 7.20 (m, 1H) 7.36 - 7.41 (m, 2H) 7.77 (br d, J = 7.88 Hz, 1H) 7.81 (s, 1H) 8.03 (d, J = 7.25 Hz, 1H) 8.24 (s, 1H) 8.48 (d, J = 3.50 Hz, 1H) 8.59 (d, J = 1.63 Hz, 1H) 9.30 - 9.37 (m, 1H) 9.33 (br t, J = 5.82 Hz, 1H).

[0779] Example 32: l-(4-cyanophenyl)-N-(3-pyridinylmethyl)benzimidazole-5-carboxamide

[0780]

[0781] Step 1: 4-(4-cyanophenylamino)-3-nitro-benzoic acid methyl ester

[0782]

[0783] To a mixture of methyl 4-fluoro-3-nitrobenzoate (600 mg, 3.01 mmol, 1 eq) and 4-aminobenzonitrile (427.13 mg, 3.62 mmol, 1.2 eq) in DMF (10 mL) was added t-BuOK (676.18 mg, 6.03 mmol, 2 eq) in one portion at 15 °C under N2, and the mixture was stirred at 40 °C for 12 h. The reaction mixture was added to H2O (10 mL), filtered, and the cake was concentrated under reduced pressure to yield the title compound (850 mg, crude) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ: 9.82 (br s, 1H), 8.65-8.59 (m, 1H), 8.08-8.00 (m, 1H), 7.88-7.81 (m, 2H), 7.53-7.44 (m, 3H), 3.90-3.85 (m, 3H).

[0784] Step 2: Methyl 3-amino-4-(4-cyanophenylamino)benzoate

[0785]

[0786] A mixture of methyl 4-(4-cyanophenylamino)-3-nitrobenzoate (850 mg, 2.86 mmol, 1 eq), Fe (798.49 mg, 14.30 mmol, 5 eq) and NH4Cl (1.53 g, 28.59 mmol, 10 eq) in EtOH (10 mL) and H2O (2 mL) was heated at 80 °C and stirred for 30 min, the reaction mixture was filtered and the filtrate was added to H2O (20 mL), diluted with ethyl acetate (20 mL) and extracted with ethyl acetate (20 mL, 2x). The combined organic layers were washed with brine (30 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to yield the title compound (690 mg, crude) as a light yellow solid.

[0787] Step 3: Methyl l-(4-cyanophenyl)benzoimidazole-5-carboxylate

[0788]

[0789] A mixture of methyl 3-amino-4-(4-cyanophenylamino)benzoate (690 mg, 2.58 mmol, 1 eq) and HCOOH (372.06 mg, 7.74 mmol, 3 eq) in trimethoxymethane (5 mL) was heated at 100 °C and stirred for 1 h. The reaction mixture was filtered and the cake was concentrated under reduced pressure to yield the title compound (550 mg, crude) as a light yellow solid.

[0790] Step 4: 1-(4-cyanophenyl)benzoimidazole-5-carboxylic acid

[0791]

[0792] A mixture of methyl 1-(4-cyanophenyl)benzoimidazole-5-carboxylate (200 mg, 721.30 pmol, 1 eq) and NaOH (57.70 mg, 1.44 mmol, 2 eq) in MeOH (1 mL) and H2O (1 mL) was stirred at 70 °C for 1 h. The reaction mixture was then concentrated to remove MeOH, HCl (12 N, 3 mL) was added, the mixture was filtered, and the cake was concentrated under reduced pressure to yield the title compound (120 mg, crude) as a white solid.

[0793] Step 5: 1-(4-cyanophenyl)-N-(3-pyridinylmethyl)benzoimidazole-5-carboxamide

[0794]

[0795] To a mixture of 1-(4-cyanophenyl)benzoimidazole-5-carboxylic acid (120 mg, 455.84 pmol, 1 eq), DIEA (88.37 mg, 683.76 pmol, 119.10 pL, 1.5 eq) and 3-pyridinylmethanamine (54.22 mg, 501.42 pmol, 50.68 pL, 1.1 eq) in DMF (2 mL) was added HATU (207.99 mg, 547.01 pmol, 1.2 eq) in one portion at 15 °C under N2, and the mixture was heated to 40 °C and stirred for 12 h. The reaction mixture was filtered and the resulting residue was purified by prep-HPLC (FA condition: Column: Phenomenex Luna C18 200*40 mm*10 um; Mobile Phase: [Water (0.225% FA)-ACN]; B%: 1%-40%, 12 min) to yield the title compound (76.2 mg, 189.51 pmol, 41.57% yield, 99.331% purity, FA) as a white solid. LCMS m / z 390.1 (M+1). 1 H NMR (400 MHz, DMSO-d6) d: 9.28-9.15 (m, 1H), 8.83-8.77 (m, 1H), 8.66-8.60 (m, 1H), 8.54-8.48 (m, 1H), 8.42-8.38 (m, 1H), 8.19-8.11 (m, 2H), 8.03-7.92 (m, 3H), 7.88-7.78 (m, 2H), 7.49-7.39 (m, 1H), 4.60-4.53 (m, 2H).

[0796] Examples 33-34.

[0797] Examples 33-34 were prepared according to the procedure described for Example 32 using appropriately substituted starting materials. NMR data for the compounds of Examples 20-28 are shown in Table 4B.

[0798] Table 4A.

[0799]

[0800] Table 4B.

[0801]

[0802] Example 35: 3-(4-cyanophenyl)-N-(3H-imidazo[4,5-b]pyridin-2-ylmethyl)pyrrolo[l,5- a]pyridine-6-carboxamide

[0803]

[0804] Step 1: Methyl pyrrolo[l,5-a]pyridine-6-carboxylate

[0805]

[0806] To a solution of 6-bromopyrrolo[l,5-a]pyridine (0.5 g, 2.54 mmol, 1 eq) and Et3N (1.28 g, 12.69 mmol, 1.77 mL, 5 eq) in MeOH (20 mL) was added Pd(dppf)Cl2(185.68 mg, 253.77 μmol, 0.1 eq) under N2. The suspension was degassed under vacuum and purged with CO several times. The mixture was stirred at 70 °C under CO (50 psi) for 12 h. The reaction mixture was then filtered and concentrated under reduced pressure to yield the title compound as a brown solid (1 g, crude).

[0807] Step 2: Methyl 3-iodopyrrolo[l,5-a]pyridine-6-carboxylate

[0808]

[0809] A mixture of methyl pyrrolo[l,5-a]pyridine-6-carboxylate (100 mg, 567.63 pmol, 1 eq) and NIS (140.48 mg, 624.39 pmol, 1.1 eq) in DMF (2 mL) was stirred at 20 °C for 1 h. The reaction was quenched by the addition of water (10 mL) and extracted with EtOAc (30 mL). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a yellow solid (180 mg, crude).

[0810] Step 3: Methyl 3-(4-nitrilephenyl)pyrrolo[l,5-a]pyridine-6-carboxylate

[0811]

[0812] A mixture of methyl 3-iodopyrrolo[l,5-a]pyridine-6-carboxylate (180 mg, 595.89 pmol, 1 eq), (4-nitrilephenyl)boronic acid (105.07 mg, 715.07 pmol, 1.2 eq), Na2C03(126.32 mg, 1.19 mmol, 2 eq), Pd(dppf)Cl2(43.60 mg, 59.59 pmol, 0.1 eq) in dioxane (5 mL) and H20 (0.5 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 90 °C under N2atmosphere for 12 h. The reaction mixture was filtered and concentrated under reduced pressure to yield a residue. The reaction mixture was concentrated under reduced pressure to remove dioxane, then diluted with water (10 mL) and extracted with EtOAc (80 mL). The combined organic layers were washed with brine (30 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a grey solid (150 mg, crude).

[0813] Step 4: 3-(4-nitrilephenyl)pyrrolo[l,5-a]pyridine-6-carboxylic acid

[0814]

[0815] A mixture of methyl 3-(4-cyanophenyl)pyrrolo[1,5-a]pyridine-6-carboxylate (130 mg, 468.85 pmol, 1 eq), NaOH (37.51 mg, 937.69 pmol, 2 eq) in MeOH (30 mL), H2O (2 mL) and THF (10 mL) was stirred at 25 °C for 14 h. The reaction mixture was concentrated under reduced pressure to remove MeOH, then HCl (12 N, 1 mL) was added. The solution was filtered and the filter cake was concentrated under reduced pressure to yield the title compound (80 mg, crude) as a grey solid.

[0816] Step 5: 3-(4-cyanophenyl)-N-(3H-imidazo[4,5-b]pyridin-2-ylmethyl)pyrrolo[1,5- a]pyridine-6-carboxamide

[0817]

[0818] To a solution of 3-(4-cyanophenyl)pyrrolo[1,5-a]pyridine-6-carboxylic acid (70 mg, 265.91 pmol, 1 eq), 3H-imidazo[4,5-b]pyridin-2-ylmethanamine (43.34 mg, 292.50 pmol, 1.1 eq) and DIEA (68.73 mg, 531.81 pmol, 92.63 pL, 2 eq) in DMF (2.5 mL) was added HATU (151.66 mg, 398.86 pmol, 1.5 eq) and the resulting mixture was stirred at 40 °C for 12 h. The reaction mixture was filtered to yield a residue which was purified by preparative HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 45%, 8 min) to yield the title compound (19.9 mg, 50.39 pmol, 18.95% yield, 99.618% purity) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d: 9.42 (s, 2H), 8.74 (s, 1H), 8.27 (br s, 1H), 8.19 (d, J = 9.4 Hz, 1H), 8.22-8.14 (m, 1H), 8.01-7.96 (m, 2H), 7.95-7.85 (m, 4H), 7.20 (dd, J = 4.7, 7.9 Hz, 1H), 4.78 (br s, 2H).

[0819] Example 36: 3-(4-cyanophenyl)-N-(3-pyridinylmethyl)imidazo[1,2-a]pyrimidine-7- carboxamide

[0820]

[0821] Step 1: Imidazo[l,2-a]pyrimidine-7-carboxylic acid ethyl ester

[0822]

[0823] A solution of 2-bromo-l,l-diethoxyethane (1.03 g, 5.22 mmol, 786 μL, 8 eq) and HBr (330 mg, 1.96 mmol, 222 μL, 48% purity, 3 eq) in EtOH (3 mL) was heated at 90 °C for 2 h. The solution was cooled to 25 °C and solid NaHC03(274 mg, 3.27 mmol, 5 eq) was added in small portions followed by methyl 2-aminopyrimidine-4-carboxylate (100 mg, 653 μmol, 1 eq). The mixture was then stirred at 70 °C for 12 h, then the mixture was stirred at 90 °C for 12 h. Nine batches were worked together, the reaction mixture was added to saturated NaHC03(aq, 100 mL) then extracted with EtOAc (100 mL, 3x). The combined organic phases were washed with brine (50 mL), then dried over Na2S04, filtered and the filtrate was concentrated under reduced pressure to give a residue which was purified by preparative TLC (ethyl acetate:methanol = 5: 1) to give the title compound as a yellow solid (75 mg, crude). 1 H NMR (400 MHz, DMSO-d6) δ: 1.37 (t, J = 7.17 Hz, 3H) 4.39 (q, J = 7.06 Hz, 2H) 7.60 (d, J = 7.06 Hz, 1H) 7.99 (d, J = 1.32 Hz, 1H) 8.15 (d, J = 1.32 Hz, 1H) 9.15 (d, J = 7.06 Hz, 1H).

[0824] Step 2: 3-Bromoimidazo[l,2-a]pyrimidine-7-carboxylic acid ethyl ester

[0825]

[0826] To a solution of ethyl imidazo[l,2-a]pyrimidine-7-carboxylate (45 mg, 235 mΐ, 1 equiv) in DMF (3 mL) was added NBS (41.9 mg, 235 mΐ, 1 equiv) in one portion at 0 °C and the resulting mixture was stirred at 0 °C for 1 h. The reaction mixture was added to H2O (30 mL) then extracted with EtOAc (30 mL, 3x). The combined organic phase was washed with brine (30 mL), then dried over Na2S04, filtered and the filtrate was concentrated under reduced pressure to yield the title compound as a yellow solid (68 mg, crude).

[0827] Step 3: 3-(4-cyanophenyl)imidazo[l,2-a]pyrimidine-7-carboxylic acid

[0828]

[0829] A mixture of ethyl 3-bromoimidazo[l,2-a]pyrimidine-7-carboxylate (68 mg, 251.78 mΐ, 1 equiv), (4-cyanophenyl)boronic acid (44.4 mg, 302 mΐ, 1.2 equiv), Na2C03(53.4 mg, 504 mΐ, 2 equiv), Pd(dppf)Cl2(18.4 mg, 25.2 mΐ, 0.1 equiv) in dioxane (4 mL) and H20 (0.4 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 90 °C under N2atmosphere for 5 h. The reaction mixture was added to H20 (20 mL) then extracted with EtOAc (20 mL, 2x). The combined organic phase was washed with H20 (20 mL), then HCl (3 N) was added to the aqueous phase until pH = 5, then extracted with EtOAc (20 mL, 2x), dried over Na2S04, filtered and the filtrate was concentrated under reduced pressure to yield the title compound as a yellow solid (67 mg, crude).

[0830] Step 4: 3-(4-cyanophenyl)-N-(3-pyridinylmethyl)imidazo[l,2-a]pyrimidine-7- carboxamide

[0831]

[0832] To a solution of 3-(4-cyanophenyl)imidazo[l,2-a]pyrimidine-7-carboxylic acid (57 mg, 216 μmol, 1 eq) and 3-pyridinylmethanamine (25.7 mg, 237 μmol, 24 μL, 1.1 eq) in DMF (2 mL) at 25 °C was added DIEA (83.6 mg, 647 μmol, 113 μL, 3 eq) and HATU (164 mg, 431 μmol, 2 eq) in one portion and the resulting mixture was stirred at 40 °C for 3 h. The mixture was filtered and the filtrate was concentrated to give the crude product which was purified by prep-HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 40%, 8 min) to give the title compound (5.9 mg, 16.25 μmol, 7.53% yield, 97.578% purity) as a white solid. 1 H NMR (400 MHz, DMSO-d6) d: 4.54 (d, J = 6.39 Hz, 2H) 7.36 (dd, J = 7.61, 4.52 Hz, 1H) 7.68 (d, J = 7.06 Hz, 1H) 7.73 - 7.80 (m, 1H) 7.94 - 8.08 (m, 4H) 8.36 (s, 1H) 8.46 (dd, J = 4.74, 1.43 Hz, 1H) 8.58 (d, J = 1.54 Hz, 1H) 9.28 (d, J = 7.06 Hz, 1H) 9.71 - 9.86 (m, 1H).

[0833] Example 37: 3-(4-cyanophenyl)-N-(3-pyridinylmethyl)pyrrolo[l,5-a]pyridine-6- carboxamide

[0834]

[0835] Step 1: N-(3-pyridinylmethyl)pyrrolo[l,5-a]pyridine-6-carboxamide

[0836]

[0837] A mixture of pyrrolo[l,5-a]pyridine-6-carboxylic acid (0.1 g, 616.73 μmol, 1 eq), 3- pyridinylmethanamine (73.36 mg, 678.40 μmol, 68.56 μL, 1.1 eq), DIEA (159.42 mg, 1.23 mmol, 214.85 μL, 2 eq) and HATU (351.75 mg, 925.10 μmol, 1.5 eq) in DMF (3 mL) was stirred at 40 °C for 12 h. The reaction was quenched by the addition of water (30 mL) and then extracted with EtOAc (200 mL). The combined organic layers were washed with brine (50 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a brown oil (160 mg, crude).

[0838] Step 2: 3-lodo-N-(3-pyridinylmethyl)pyrrolo[l,5-a]pyridine-6-carboxamide

[0839]

[0840] A mixture of N-(3-pyridinylmethyl)pyrrolo[l,5-a]pyridine-6-carboxamide (160 mg, 634.24 μmol, 1 eq) and NIS (156.96 mg, 697.66 μmol, 1.1 eq) in DMF (5 mL) was stirred at 20 °C for 1 h. The reaction mixture was quenched by the addition of water (25 mL) and extracted with EtOAc (160 mL). The combined organic layers were washed with brine (90 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a yellow solid (240 mg, crude).

[0841] Step 3: 3-(4-cyanophenyl)-N-(3-pyridinylmethyl)pyrrolo[l,5-a]pyridine-6-carboxamide

[0842]

[0843] A mixture of 3-iodo-N-(3-pyridinylmethyl)pyrrolo[l,5-a]pyridine-6-carboxamide (210 mg, 555.31 pmol, 1 eq), (4-cyano phenyl)boronic acid (97.92 mg, 666.37 pmol, 1.2 eq), Na2C03(117.71 mg, 1.11 mmol, 2 eq), Pd(dppf)Cl2(40.63 mg, 55.53 pmol, 0.1. eq) in dioxane (5 mL) and H20 (0.5 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 90 °C under N2atmosphere for 12 h. The reaction mixture was filtered and concentrated under reduced pressure to give a residue, which was purified by prep-HPLC (basic condition, column: Waters Xbridge 150*25mm*5um; mobile phase: [water (0.04% NH3H20 + 10 mM NH4HC03) - ACN]; B%: 27%-57%, 10 min) to give the title compound as a light yellow solid (90.3 mg, 252.33 pmol, 45.44% yield, 98.746% purity). 1 H NMR (400 MHz, DMSO-d6) d: 9.35 (s, 1H), 8.72 (s, 1H), 8.60 (d, J = 1.4 Hz, 1H), 8.48 (d, J = 3.6 Hz, 1H), 8.16 (d, J = 9.4 Hz, 1H), 7.98-7.94 (m, 2H), 7.93-7.88 (m, 2H), 7.85 (dd, J = 1.1, 9.4 Hz, 1H), 7.78 (br d, J = 7.9 Hz, 1H), 7.38 (dd, J = 4.9, 7.8 Hz, 1H), 7.21 (br s, 1H), 4.55 (d, J = 5.6 Hz, 2H).

[0844] Example 38: 4-[7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridin-3- yl]benzonitrile

[0845]

[0846] A mixture of 7-[(3-methyloxetan-3-yl)methoxy]imidazo[l,2-a]pyridine (0.1 g, 458.2 μmol, 1 eq), 4-bromobenzonitrile (100.1 mg, 549.8 μmol, 1.2 eq), Cs2CO3(447.9 mg, 1.4 mmol, 3 eq), [2-(2-aminophenyl)phenyl]chloro palladium; bis(l-adamantyl)butylphosphane (30.6 mg, 45.8 μmol, 0.1 eq) in DMF (3 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was filtered and concentrated under reduced pressure to yield a residue which was purified by preparative HPLC (basic condition; column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 25%-55%, 8 min) to yield the title compound as a yellow solid (8.7 mg, 25.2 μmol, 5.5% yield, 92.3% purity) which was confirmed by 1 H-NMR and QC LCMS. 1 H NMR (400 MHz, DMSO-d6) δ: 8.58 (d, J = 7.5 Hz, 1H), 8.02-7.92 (m, 2H), 7.91-7.81 (m, 3H), 7.16 (d, J = 2.4 Hz, 1H), 6.78 (dd, J = 2.5, 7.6 Hz, 1H), 4.53 (d, J = 5.9 Hz, 2H), 4.35 (d, J = 5.9 Hz, 2H), 4.20 (s, 2H), 1.41 (s, 3H).

[0847] Examples 39-40.

[0848] Examples 39-40 were prepared according to the procedure described for Example 38 using appropriately substituted starting materials. NMR data for the compounds of Examples 39-40 are shown in Table 5B.

[0849] Table 5A.

[0850]

[0851] Table 5B.

[0852]

[0853] Example 41: 4-[7-[2-(6-methyl-3-pyridinyl)ethoxy]imidazo[l,2-a]pyridin-3- yl]benzonitrile

[0854]

[0855] Step 1: 2-(6-methyl-3-pyridyl)propanedioic acid diethyl ester

[0856]

[0857] A mixture of 5-bromo-2-methylpyridine (5 g, 29.1 mmol, 1 eq), propanedioic acid diethyl ester (11.6 g, 72.7 mmol, 11.0 mL, 2.5 eq), Pd(OAc)2(653 mg, 2.91 mmol, 0.1 eq), K3PO4(18.5 g, 87.2 mmol, 3 eq) and di-tert-butyl-(2-phenylphenyl)phosphane (867 mg, 2.91 mmol, 0.1 eq) in toluene (30 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 100 °C under N2atmosphere for 48 h. The reaction mixture was filtered and concentrated under reduced pressure to yield a residue which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 8 / 1) to yield the title compound (5 g, crude) as a yellow oil.

[0858] Step 2: 2-(6-methyl-3-pyridyl)acetic acid

[0859]

[0860] A mixture of 2-(6-methyl-3-pyridyl)propanedioic acid diethyl ester (5 g, 19.9 mmol, 1 eq) in HCl (6 N, 30 mL) was stirred at 100 °C for 4 h. The mixture was concentrated to yield a crude product which was added to H2O (20 mL), then extracted with EtOAc (30 mL, 2x) and the aqueous phase was lyophilized to yield the title compound (3.7 g, crude) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) d: 2.75 (s, 3H) 3.90 (s, 2H) 7.89 (d, J = 8.25 Hz, 1H) 8.39 (dd, J = 8.25, 1.75 Hz, 1H) 8.70 (d, J = 1.38 Hz, 1H).

[0861] Step 3: 2-(6-methyl-3-pyridyl)ethanol

[0862]

[0863] To a solution of 2-(6-methyl-3-pyridyl)acetic acid (2 g, 13.2 mmol, 1 eq) in THF (30 mL) was added BH3THF (1 M, 46.3 mL, 3.5 eq) dropwise at 0 °C and the resulting mixture was stirred at 0 °C for 30 min, then at 25 °C for 2 h. The reaction was quenched with methanol (50 mL) at 0 °C, then the mixture was stirred at 25 °C for 12 h. The mixture was filtered and the filtrate was concentrated to give the crude product, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 :0 to 1 :4, 5% TEA) to give the title compound as a yellow oil (1.17 g, crude).

[0864] Step 4: 4-[2-(6-methyl-3-pyridyl)ethoxy]pyridin-2-amine

[0865]

[0866] To a solution of 2-aminopyridin-4-ol (0.6 g, 5.45 mmol, 1 eq), 2-(6-methyl-3- pyridyl)ethanol (449 mg, 3.27 mmol, 0.6 eq) and PPh3 (1.43 g, 5.45 mmol, 1 eq) in DCM (60 mL) was added DIAD (1.10 g, 5.45 mmol, 1.06 mL, 1 eq) at 0 °C under N2and the resulting mixture was stirred at 25 °C under N2for 12 h. The mixture was filtered and the filtrate was concentrated to give the crude product, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate / methanol = 1 :0:0 to 0:10:1, 5% TEA) to give the title compound as a yellow solid (390 mg, crude).

[0867] Step 5: 7-[2-(6-methyl-3-pyridyl)ethoxy]imidazo[l,2-a]pyridine

[0868]

[0869] To a mixture of 4-[2-(6-methyl-3-pyridyl)ethoxy]pyridin-2-amine (97 mg, 423 pmol, 1 equiv) in EtOH (4 mL) at 25 °C was added NaHC03(142 mg, 1.69 mmol, 65.8 pL, 4 equiv) and 2-chloroacetaldehyde (415 mg, 2.12 mmol, 340 pL, 5 equiv) in one portion and the resulting mixture was stirred at 70 °C for 2 h. Four batches were worked together and concentrated under reduced pressure to remove EtOH, then extracted with EtOAc (50 mL, 2x). The combined organic phase was washed with saturated NH4CI (aq, 50 mL) and brine (50 mL), then dried over Na2S04, filtered, and the filtrate concentrated under reduced pressure to give a residue which was purified by column (Si02, petroleum ether / ethyl acetate / methanol = 1:0:0 to 0:10:1, 5% TEA) to give the title compound (380 mg, crude) as a yellow oil.

[0870] Step 6: 4-[7-[2-(6-methyl-3-pyridyl)ethoxy]imidazo[l,2-a]pyridin-3-yl]benzonitrile

[0871]

[0872] To a solution of 4-bromobenzonitrile (201 mg, 1.11 mmol, 1.4 eq), 7-[2-(6-methyl-3-pyridinyl)ethoxy]imidazo[l,2-a]pyridine (200 mg, 790 pmol, 1 eq) and Cs2CO3(772 mg, 2.37 mmol, 3 eq) in DMAC (5 mL) was added Pd(dppf)Cl2CH2Cl2(32.2 mg, 39.5 pmol, 0.05 eq) in one portion at 25 °C under N2, and the resulting mixture was stirred at 100 °C for 12 h. The reaction mixture was added to saturated NH4Cl (aq., 50 mL), then extracted with EtOAc (50 mL, 2x). The combined organic phase was washed with brine (50 mL), then dried over Na2SO4, filtered, and the filtrate was concentrated under reduced pressure to give a residue, which was purified by prep-TLC (ethyl acetate:methanol:NH3.H2O = 100:10:4) to give a crude product. The crude product was purified by prep-HPLC (basic condition, column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 30%-60%, 8 min) to give the title compound as a grey solid (73.8 mg, 207.72 pmol, 26.31% yield, 99.753% purity). 1 H NMR (400 MHz, DMSO-d6) d: 2.43 (s, 3H) 3.06 (t, J = 6.44 Hz, 2H) 4.32 (t, J = 6.50 Hz, 2H) 6.68 (dd, J = 7.63, 2.50 Hz, 1H) 7.10 (d, J = 2.50 Hz, 1H) 7.19 (d, J = 7.88 Hz, 1H) 7.65 (dd, J = 7.94, 2.31 Hz, 1H) 7.78 - 7.87 (m, 3H) 7.90 - 7.97 (m, 2H) 8.41 (d, J = 2.00 Hz, 1H) 8.52 (d, J = 7.63 Hz, 1H).

[0873] Example 42: 2-[2,6-dimethoxy-4-[7-[(6-methyl-3-pyridinyl)methoxy]imidazo[l,2- a]pyridin-3-yl]phenyl]-5-ethyl-l,3,4-oxadiazole

[0874]

[0875] Step 1: 4-[(6-methyl-3-pyridinyl)methoxy]pyridin-2-amine

[0876]

[0877] To a solution of 2-amino pyridin-4-ol (3 g, 27.24 mmol, 1 eq), (6-methyl-3- pyridyl)methanol (2.01 g, 16.35 mmol, 0.6 eq) and PPh3 (7.15 g, 27.24 mmol, 1 eq) in DCM (50 mL) was added DIAD (5.51 g, 27.24 mmol, 5.30 mL, 1 eq) at 0 °C under N2, and the resulting mixture was stirred at 20 °C for 12 h. The mixture was filtered and the filtrate was concentrated to yield a crude product which was purified by column chromatography (SiO2, Petroleum ether / Ethyl acetate / Methanol = 50:1:0 to 0:10:1) to yield the title compound as a light yellow solid (1.8 g, 8.36 mmol, 30.69% yield).

[0878] Step 2: 7-[(6-methyl-3-pyridyl)methoxy]imidazo[l,2-a]pyridine

[0879]

[0880] To a mixture of 4-[(6-methyl-3-pyridyl)methoxy]pyridin-2-amine (500 mg, 2.32 mmol, 1 eq) in EtOH (5 mL) was added NaHCO3 (779.58 mg, 9.28 mmol, 360.92 μL, 4 eq) and 2-chloroacetaldehyde (910.57 mg, 11.60 mmol, 746.37 μL, 5 eq) at 20 °C, and the resulting mixture was stirred at 70 °C for 4 h. The reaction mixture was concentrated under reduced pressure to remove EtOH and then extracted with EtOAc (50 mL, 2x). The combined organic phase was washed with saturated NH4Cl (aqueous, 15 mL) and brine (50 mL), then dried over Na2SO4, filtered, and the filtrate was concentrated under reduced pressure to yield the title compound as a yellow solid (500 mg, crude).

[0881] Step 3: 2-[2,6-dimethoxy-4-[7-[(6-methyl-3-pyridyl)methoxy]imidazo[l,2- a]pyridin-3-yl]phenyl]-5-ethyl-l,3,4-oxadiazole

[0882]

[0883] To a solution of 7-[(6-methyl-3-pyridinyl)methoxy]imidazo[l,2- a]pyridine (300 mg, 1.25 mmol, 1 eq), 2-(4-bromo-2,6-dimethoxy-phenyl)-5- ethyl- 1,3,4-oxadiazole (392.62 mg, 1.25 mmol, 1 eq) and Cs2C03(817.03 mg, 2.51 mmol, 2 eq) in DMA (1 mL) was added Pd(dppf)Cl2-CH2Cl2(102.39 mg, 125.38 μmol, 0.1 eq) under N2and the resulting mixture was stirred at 100 °C for 3 h. The reaction mixture was then concentrated to yield the crude product which was purified by preparative HPLC (basic condition; column: Phenomenex Gemini-NX C18 75*30 mm*3 um; mobile phase: [water (0.05% NH3H20 + 10 mM NH4HC03) - ACN]; B%: 20% - 50%, 8 min) to yield the title compound as a pink solid (43.4 mg, 88.99 μmol, 7.10% yield, 96.681% purity). 1 H NMR (400 MHz, DMSO-d6) d: 8.68 (d, J = 7.6 Hz, 1H), 8.61 (s, 1H), 7.82 (s, 2H), 7.33 (d, J = 7.9 Hz, 1H), 7.22 (br d, J = 1.3 Hz, 1H), 7.02 (s, 2H), 6.77 (dd, J = 1.9, 7.4 Hz, 1H), 5.26 (s, 2H), 3.86 (s, 6H), 2.94 (q, J = 7.5 Hz, 2H), 2.50 (br s, 3H), 1.32 (t, J = 7.5 Hz, 3H).

[0884] Example 43: 4-[5-(l-ethylpyrazol-4-yl)benzoimidazol-l-yl]benzonitrile

[0885]

[0886] Step 1: 4-(4-bromo-2-nitroanilino)benzonitrile

[0887]

[0888] To a solution of 4-bromo-1-fluoro-2-nitrobenzene (300 mg, 1.4 mmol, 167.6 μL, 1 equiv) and t-BuOK (306.0 mg, 2.7 mmol, 2 equiv) in DMSO (3 mL) was added 4- aminobenzonitrile (161.1 mg, 1.4 mmol, 1 equiv) and the resulting mixture was stirred at 80 °C for 2 h. The mixture was then partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound (400 mg, crude) as a brown oil.

[0889] Step 2: 4-(2-amino-4-bromoanilino)benzonitrile

[0890]

[0891] To a solution of 4-(4-bromo-2-nitroanilino)benzonitrile (300 mg, 943.0 μmol, 1 equiv) and NH4CI (252.2 mg, 4.7 mmol, 5 equiv) in EtOH (4 mL) and H20 (0.5 mL) was added Fe (263.3 mg, 4.7 mmol, 5 equiv) and the resulting mixture was stirred at 80 °C for 2 h. The reaction mixture was filtered and the filtrate was concentrated to yield the title compound (200 mg, 694.1 μmol, 73.6% yield) as a pink solid.

[0892] Step 3: 4-(5-bromobenzimidazol-1-yl)benzonitrile

[0893]

[0894] To a solution of 4-(2-amino-4-bromoanilino)benzonitrile (200 mg, 694.1 μmol, 1 equiv) in trimethyl orthoformate (2 mL) was added HCOOH (100.0 mg, 2.1 mmol, 3 equiv) and the resulting mixture was stirred at 100 °C for 2 h. The reaction mixture was concentrated under reduced pressure to yield a residue which was purified by preparative TLC (Si02, petroleum ether / ethyl acetate = 1 : 1) to yield the title compound (40 mg, 134.2 μmol, 19.3% yield) as a pink solid.

[0895] Step 4: 4-[5-(1-ethylpyrazol-4-yl)benzimidazol-1-yl]benzonitrile

[0896]

[0897] To a solution of 4-(5-bromobenzimidazol-l-yl)benzonitrile (40 mg, 134.2 pmol, 1 equiv), l-ethyl-4-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazole (32.8 mg, 147.6 pmol, 1.1 equiv) and Na2C03(28.4 mg, 268.3 pmol, 2 equiv) in dioxane (1 mL) and H20 (0.2 mL) was added Pd(dppf)C12 (9.8 mg, 13.4 pmol, 0.1 equiv) under N2and the resulting mixture was stirred at 100 °C for 12 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2S04, filtered and concentrated under reduced pressure to give the crude product which was purified by preparative HPLC (basic condition, column: Phenomenex Gemini-NX CI 8 75*30 mm*3 um; mobile phase: [water (0.05% NH3H20 + 10 mM NH4HC03) - ACN]; B%: 15% - 45%, 8 min) to give the title compound (12.4 mg, 39.2 pmol, 29.2% yield, 99.1% purity) as a white solid. 1 H NMR (400 MHz, MeOD-d4) d: 8.55 (s, 1H), 8.08 (s, 1H), 8.02 (d, J = 8.5 Hz, 2H), 7.94 (s, 1H), 7.92-7.87 (m, 3H), 7.77-7.59 (m, 2H), 4.25 (q, J = 7.3 Hz, 2H), 1.53 (t, J = 7.3 Hz, 3H).

[0898] Example 44: 4-(5-(l-cyclopropyl-lH-pyrazol-4-yl)-lH-benzo[d]imidazol-l- yl)benzonitrile

[0899]

[0900] The title compound was prepared according to the procedure described in Example 43 using appropriately substituted starting materials. Yield: 19.3 mg; 95.5% purity. 1 H NMR (400 MHz, DMSO-d6) d: 8.69 (s, 1H), 8.33 (s, 1H), 8.14 (br d, J = 7.9 Hz, 2H), 8.04 (br s, 1H), 7.98 (br d, J = 9.5 Hz, 3H), 7.72 (br d, J = 8.3 Hz, 1H), 7.63 (br d, J = 8.3 Hz, 1H), 3.76 (br s, 1H), 1.19-0.89 (m, 4H).

[0901] Example 45: 4-[7-(1-ethylpyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl]benzonitrile

[0902]

[0903] Step 1: 7-(1-ethylpyrazol-4-yl)imidazo[1,2-a]pyridine

[0904]

[0905] A mixture of 7-bromoimidazo[1,2-a]pyridine (150 mg, 761.3 μmol, 1 eq), 1- ethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (169.1 mg, 761.3 μmol, 1 eq), Na2CO3(161.4 mg, 1.5 mmol, 2 eq), Pd(dppf)Cl2(55.7 mg, 76.1 μmol, 0.1 eq) in dioxane (5 mL) and H2O (0.5 mL) was degassed and purged with N2(3x), then the mixture was stirred at 90 °C under N2atmosphere for 12 h. The reaction mixture was diluted with water (30 mL) and extracted with EtOAc (150 mL). The combined organic layers were washed with brine (50 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give the title compound (160 mg, crude) as a brown oil.

[0906] Step 2: 4-[7-(1-ethylpyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl]benzonitrile

[0907]

[0908] To a solution of 7-(1-ethylpyrazol-4-yl)imidazo[1,2-a]pyridine (160 mg, 753.8 μmol, 1 eq), 4-bromobenzonitrile (164.7 mg, 904.6 μmol, 1.2 eq) and Cs2CO3(736.8 mg, 2.3 mmol, 3 eq) in DMA (5 mL) was added Pd(dppf)Cl2CH2Cl2(30.8 mg, 37.7 μmol, 0.05 eq) and the resulting mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered and concentrated under reduced pressure to give a residue which was triturated with EtOAc (15 mL) at 25 °C for 20 min to give the title compound (60.6 mg, 191.7 μmol, 25.4% yield, 99.1% purity) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ: 8.63 (d, J = 7.3 Hz, 1H), 8.41 (s, 1H), 8.07 (s, 1H), 7.97 - 7.85 (m, 6H), 7.25 (dd, J = 1.5, 7.1 Hz, 1H), 4.14 (q, J = 7.3 Hz, 2H), 1.39 (t, J = 7.3 Hz, 3H).

[0909] Examples 46-47.

[0910] Examples 46-47 were prepared according to the procedure described in Example 45 using appropriately substituted starting materials. NMR data for the compounds of Examples 46-47 are shown in Table 6B.

[0911] Table 6A.

[0912]

[0913] Table 6B.

[0914]

[0915] Example 48: 4-[7-(4-cyclopropylimidazol-l-yl)imidazo[l,2-a]pyridin-3- yl]benzonitrile

[0916]

[0917] Step 1: 7-bromoimidazo[l,2-a]pyridine

[0918]

[0919] A mixture of 4-bromopyridin-2-amine (25 g, 144.5 mmol, 1 equiv), 2- chloroacetaldehyde (70.9 g, 361.3 mmol, 58.1 mL, 40% purity, 2.5 equiv), and NaHC03(24.3 g, 289.0 mmol, 11.2 mL, 2 equiv) in EtOH (500 mL) was stirred at 80 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove EtOH, and the resulting residue was purified by column chromatography (Si02, petroleum ether: ethyl acetate = 1:0 to 0:1) to give the title compound (33 g, crude) as a brown oil.

[0920] Step 2: 7-(4-cyclopropylimidazol-l-yl)imidazo[l,2-a]pyridine

[0921]

[0922] To a solution of 7-bromoimidazo[l,2-a]pyridine (120 mg, 609.0 μmol, 1 equiv), 4- cyclopropyl-lH-imidazole (65.9 mg, 609.0 μmol, 1 equiv) and Cs2CO3(396.9 mg, 1.2 mmol, 2 equiv) in DMF (1 mL) was added Cul (11.6 mg, 60.9 μmol, 0.1 equiv). The sealed tube was heated at 150 °C for 3 h in a microwave oven. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to yield the crude product which was purified by preparative TLC (SiO2, ethyl acetate:MeOH = 10:1) to yield the title compound (80 mg, 356.7 μmol, 58.6% yield) as a yellow solid.

[0923] Step 3: 4-[7-(4-cyclopropylimidazol-l-yl)imidazo[l,2-a]pyridin-3-yl]benzonitrile

[0924]

[0925] To a solution of 7-(4-cyclopropylimidazol-l-yl)imidazo[l,2-a]pyridine (80 mg, 356.7 μmol, 1 equiv), 4-bromobenzonitrile (64.9 mg, 356.7 μmol, 1 equiv) and Cs2CO3(348.7 mg, 1.1 mmol, 3 equiv) in DMA (2 mL) was added Pd(dppf)Cl2CH2Cl2(29.1 mg, 35.7 μmol, 0.1 equiv) under N2and the resulting mixture was stirred at 100 °C for 12 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to yield the crude product which was purified by preparative HPLC (basic condition, column: Phenomenex Gemini-NX C18 75*30 mm*3 um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15%-45%, 8 min) to yield the title compound (9.1 mg, 25.7 μmol, 7.2% yield, 91.9% purity) as a brown solid. 1H NMR (400 MHz, DMSO-d6) δ: 8.82-8.73 (m, 1H), 8.41-8.34 (m, 1H), 8.06-7.97 (m, 4H), 7.96-7.90 (m, 2H), 7.78-7.73 (m, 1H), 7.49-7.43 (m, 1H), 1.93-1.80 (m, 1H), 0.89-0.78 (m, 2H), 0.78-0.67 (m, 2H).

[0926] Examples 49-50.

[0927] Examples 49-50 were prepared according to the procedure described in Example 48 using appropriately substituted starting materials. NMR data for the compounds of Examples 49-50 are shown in Table 7B.

[0928] Table 7A.

[0929]

[0930]

[0931] Table 7B.

[0932]

[0933] Example 51 : 2-[2,6-Dimethoxy-4-[7-(1 -methylpyrazol-4-yl)imidazo[1,2- a]pyridin-3-yl]phenyl]-5-ethyl-1,3,4-oxadiazole

[0934]

[0935] Step 1 : Methyl 2,6-dimethoxy-4-[7-(1 -methylpyrazol-4-yl)imidazo[1,2- a]pyridin-3-yl]benzoate

[0936]

[0937] To a solution of 7-(1 -methylpyrazol-4-yl)imidazo[1,2-a]pyridine (920 mg, 4.6 mmol, 1 equiv), 4-bromo-2,6-dimethoxy-benzoic acid methyl ester (1.5 g, 5.6 mmol, 1.2 equiv) and Cs2CO3(4.5 g, 13.9 mmol, 3 equiv) in DMA (30 mL) at 25 °C under N2was added Pd(dppf)Cl2CH2Cl2(189.5 mg, 232.1 μmol, 0.05 equiv) in one portion and the resulting mixture was stirred at 100 °C for 12 h. The reaction mixture was added to saturated NH4CI (aq. 50 mL) then extracted with EtOAc (50 mL, 3x). The combined organic phases were washed with brine (50 mL), then dried over Na2SO4, filtered and the filtrate concentrated under reduced pressure to yield a residue which was purified by column chromatography (SiO2, petroleum ether: ethyl acetate:methanol = 10:1 :0 to 0:10:1 ) to yield the title compound as a brown solid (1.4 g, crude).

[0938] Step 2: 2,6-dimethoxy-4-(7-(1 -methyl-1 H-pyrazol-4-yl)imidazo[1,2-a]pyridin-3- yl)benzoic acid

[0939]

[0940] A mixture of 2,6-dimethoxy-4-[7-(1 -methylpyrazol-4-yl)imidazo[1,2-a]pyridin-3- yl]benzoic acid methyl ester (380 mg, 968.4 μmol, 1 equiv), NaOH (2 M, 2.9 mL, 6 equiv) in MeOH (4 mL) was stirred at 70 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove MeOH, then HCI (3 N) was added to the solution until pH = 5. The mixture was filtered and the filter cake was concentrated under reduced pressure to yield the title compound as a yellow solid (360 mg, crude).

[0941] Step 3: 2,6-dimethoxy-4-[7-(1 -methylpyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl]-N'- propylformohydrazide

[0942]

[0943] To a solution of 2,6-dimethoxy-4-[7-(1-methylpyrazol-4-yl)imidazo[1,2- a]pyridin-3-yl]benzoic acid (200 mg, 528.6 pmol, 1 eq), propionylhydrazide (186.3 mg, 2.1 mmol, 4 eq) and DIEA (204.9 mg, 1.6 mmol, 276.2 pL, 3 eq) in DMF (5 mL) was added HATU (301.5 mg, 792.8 pmol, 1.5 eq) in one portion at 20 °C and the resulting mixture was stirred at 40 °C for 12 h. The reaction mixture was added to saturated NH4CI (aq. 50 mL) and then extracted with EtOAc (50 mL, 3x). The combined organic phases were washed with brine (50 mL), then dried over Na2S04, filtered and the filtrate was concentrated under reduced pressure to yield the title compound (180 mg, crude) as a yellow oil.

[0944] Step 4: 2-[2,6-dimethoxy-4-[7-(1-methylpyrazol-4-yl)imidazo[1,2-a]pyridin-3- yl]phenyl]-5-ethyl-1,3,4-oxadiazole

[0945]

[0946] A mixture of 2,6-dimethoxy-4-[7-(1-methylpyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl]- N'-propylaminobenzohydrazide (100 mg, 222.9 pmol, 1 eq) and 1-methoxy-N- triethylaminomethanimidamide sulfonate (79.7 mg, 334.5 pmol, 1.5 eq) in THF (4 mL) was stirred at 70 °C for 2 h. The mixture was concentrated to yield crude product which was purified by preparative HPLC (basic condition, column: Waters X bridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.05% NH3H20 + 10 mM NH4HCO3) - ACN]; B%: 25%-38%, 8 min) to yield the title compound (10.6 mg, 24.6 pmol, 11.0% yield, 100% purity) as a white solid. 1 H NMR (400 MHz, MeOD-d4) d: 1.42 (t, J = 7.57 Hz, 3H) 2.98 (d, J = 7.51 Hz, 2H) 3.90 (s, 6H) 3.97 (s, 3H) 6.92 - 7.09 (m, 2H) 7.23 - 7.36 (m, 1H) 7.70 - 7.94 (m, 1H) 7.97 - 8.10 (m, 1H) 8.19 (br s, 1H) 8.52 - 9.06 (m, 1H).

[0947] Example 52: 4-[6-(l-ethylpyrazol-4-yl)pyrrolo[l,5-a]pyridin-3-yl]benzonitrile

[0948]

[0949] Step 1: 6-(l-ethylpyrazol-4-yl)pyrrolo[l,5-a]pyridine

[0950]

[0951] A mixture of 6-bromopyrrolo[l,5-a]pyridine (0.2 g, 1.0 mmol, 55.9 μL, 1 equiv), l-ethyl-4-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)pyrazole (270.5 mg, 1.2 mmol, 1.2 equiv), Na2C03(215.2 mg, 2.0 mmol, 2 equiv), Pd(dppf)Cl2(74.3 mg, 101.5 μmol, 0.1 equiv) in dioxane (3 mL) and H20 (0.3 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 90 °C under N2atmosphere for 12 h. The reaction mixture was filtered and the filtrate was concentrated under reduced pressure to give the title compound as a brown oil (0.2 g, crude).

[0952] Step 2: 6-(l-ethylpyrazol-4-yl)-3-iodo-pyrrolo[l,5-a]pyridine

[0953]

[0954] A mixture of 6-(l-ethylpyrazol-4-yl)pyrrolo[l,5-a]pyridine (160 mg, 753.8 μmol, 1 equiv) and NIS (186.6 mg, 829.2 μmol, 1.1 equiv) in DMF (3 mL) was stirred at 25 °C for 1 h. The reaction was quenched by addition of water (20 mL) and then extracted with EtOAc (90 mL). The combined organic layers were washed with brine (50 mL), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue which was purified by column chromatography (Si02, petroleum ether: ethyl acetate = 1:0 to 4: 1) to give the title compound as a yellow solid (0.2 g, crude).

[0955] Step 3: 4-[6-(l-ethylpyrazol-4-yl)pyrrolo[l,5-a]pyridin-3-yl]benzonitrile

[0956]

[0957] A mixture of 6-(l-ethylpyrazol-4-yl)-3-iodo-pyrrolo[l,5-a]pyridine (0.1 g, 295.7 μmol, 1 eq), (4-nitrilephenyl)boronic acid (52.2 mg, 354.9 μmol, 1.2 eq), Na2CO3(62.7 mg, 591.5 μmol, 2 eq), Pd(dppf)Cl2(21.6 mg, 29.6 μmol, 0.1 eq) in dioxane (3 mL) and H2O (0.3 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 90 °C under N2atmosphere for 12 h. The reaction mixture was filtered and concentrated under reduced pressure to give a residue, which was purified by prep-HPLC (FA condition, column: Phenomenex Luna C18 100*30 mm*5 um; mobile phase: [water (0.2% FA) - ACN]; B%: 30%-60%, 9 min) to give the title compound as a yellow solid (17 mg, 51.7 μmol, 17.5% yield, 95.3% purity). 1 H NMR (400 MHz, DMSO-d6) δ: 9.14 (s, 1H), 8.57 (s, 1H), 8.41 (s, 1H), 8.17-8.03 (m, 2H), 8.01-7.83 (m, 4H), 7.72 (br d, J = 9.1 Hz, 1H), 4.18 (q, J = 7.3 Hz, 2H), 1.44 (t, J = 7.3 Hz, 3H).

[0958] Examples 53-54.

[0959] Examples 53-54 were prepared according to the procedure described in Example 52 using the appropriately substituted starting materials. NMR data for the compounds of Examples 53-54 are shown in Table 8B.

[0960] Table 8A.

[0961]

[0962] Table 8B.

[0963]

[0964]

[0965] Example 55: 2-[4-[7-(l-cyclopropylpyrazol-4-yl)imidazo[l,2-a]pyridin-3-yl]-2,6- dimethoxy-phenyl]-5-ethyl-l,3,4-oxadiazole

[0966]

[0967] Step 1: Methyl 4-bromo-2,6-dimethoxybenzoate

[0968]

[0969] To a solution of methyl 4-bromo-2,6-difluorobenzoate (2 g, 7.9 mmol, 1 eq) in MeOH (20 mL) was added sodium methoxide (3.2 g, 17.5 mmol, 30% purity, 2.2 eq) and the resulting mixture was stirred at 80 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove MeOH, then the reaction mixture was added to water (20 mL) and extracted with EtOAc (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a white solid (1.5 g, crude).

[0970] Step 2: 4-Bromo-2,6-dimethoxybenzoic acid

[0971]

[0972] A mixture of methyl 4-bromo-2,6-dimethoxybenzoate (200 mg, 727.0 μmol, 1 eq), NaOH (58.2 mg, 1.5 mmol, 2 eq) in MeOH (20 mL) and H20 (5 mL) was stirred at 70 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove MeOH, then HC1 (12 N, 0.5 mL) was added to the solution. The mixture was filtered and the filter cake was concentrated under reduced pressure to yield the title compound as a white solid (100 mg, crude).

[0973] Step 3: 4-Bromo-2,6-dimethoxy-N'-propylidenebenzohydrazide

[0974]

[0975] To a solution of 4-bromo-2,6-dimethoxybenzoic acid (1 g, 3.8 mmol, 1 eq) and propionylhydrazide (371.2 mg, 4.2 mmol, 1.1 eq) and 4-bromo-2,6-dimethoxy-benzoic acid (1 g, 3.8 mmol, 1 eq) in DMF (20 mL) was added HATU (2.2 g, 5.8 mmol, 1.5 eq) and DIEA (990.1 mg, 7.7 mmol, 1.3 mL, 2 eq) and the resulting mixture was stirred at 40 °C for 12 h. The reaction mixture was added to water (20 mL) and extracted with EtOAc (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound (280 mg, crude) as a white solid.

[0976] Step 4: 2-(4-bromo-2,6-difluorophenyl)-5-ethyl-1,3,4-oxadiazole

[0977]

[0978] To a solution of 4-bromo-2,6-difluoro-N'-propylol-benzohydrazide (300 mg, 976.9 pmol, 1 eq) in THF (3 mL) was added methoxycarbonyl(triethylammonium)sulfonamide zinc (Burgess reagent, 698.4 mg, 2.9 mmol, 3 eq) and the resulting mixture was stirred at 70 °C for 12 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound (200 mg, crude) as a yellow oil.

[0979] Step 5: 2-[4-[7-(1-cyclopropylpyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl]-2,6- dimethoxyphenyl]-5-ethyl-1,3,4-oxadiazole

[0980]

[0981] A mixture of 2-(4-bromo-2,6-dimethoxyphenyl)-5-ethyl-1,3,4-oxadiazole (70 mg, 223.5 μmol, 1 equiv), 7-(1-cyclopropylpyrazol-4-yl)imidazo[1,2-a]pyridine (50.1 mg, 223.5 μmol, 1 equiv), Cs2CO3(218.5 mg, 670.6 μmol, 3 equiv) and Pd(dppf)Cl2.CH2Cl2(18.3 mg, 22.4 μmol, 0.1 equiv) in DMA (1 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The resulting residue was purified by preparative HPLC (basic conditions; column: Phenomenex Gemini-NX C18 75*30 mm*3um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 20%-50%, 8 min) to yield the title compound (16.2 mg, 35.5 μmol, 15.9% yield, 100% purity) as a pink solid. 1 H NMR (400 MHz, Methanol-d4) d: 8.65 (br d, J = 7.0 Hz, 1H), 8.29 (s, 1H), 8.01 (s, 1H), 7.82 (br d, J = 16.8 Hz, 2H), 7.32 (br d, J = 7.3 Hz, 1H), 7.05 (s, 2H), 3.92 (s, 6H), 3.81-3.70 (m, 1H), 3.00 (q, J = 7.6 Hz, 2H), 1.44 (t, J = 7.6 Hz, 3H), 1.23-1.07 (m, 4H).

[0982] Example 55A: 4-(7-(1-cyclopropyl-1H-pyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl)-2,6- dimethoxybenzohydrazide

[0983]

[0984] The title compound was prepared according to similar methods and procedures to those described in Example 55. Test results are provided in Table 9B. Figure 17

[0985] Examples 56-60.

[0986] Examples 56-60 were prepared according to the procedure described in Example 55 using appropriately substituted starting materials. NMR data for the compounds of Examples 56-60 are shown in Table 9B.

[0987] Table 9A.

[0988] ​

[0989] Table 9B.

[0990]

[0991] Example 61: 3-[2,6-Dimethoxy-4-[7-(1-methylpyrazol-4-yl)imidazo[1,2- a]pyridin-3-yl]phenyl]-5-ethyl-1,2,4-oxadiazole

[0992]

[0993] Step 1: 4-Bromo-2,6-dimethoxybenzonitrile

[0994]

[0995] A mixture of 4-bromo-2,6-difluorobenzonitrile (1 g, 4.6 mmol, 1 equiv) and NaOMe (1 g, 18.5 mmol, 4.0 equiv) in MeOH (10 mL) was stirred at 25 °C for 2 h. The reaction mixture was filtered and concentrated under reduced pressure to yield the title compound (1 g, crude) as a white solid.

[0996] Step 2: 4-Bromo-N'-hydroxy-2,6-dimethoxybenzamidine

[0997]

[0998] A mixture of 4-bromo-2,6-dimethoxybenzonitrile (0.8 g, 3.3 mmol, 1 equiv), NH2OH HCI (298.6 mg, 4.3 mmol, 1.3 equiv), and NaHCO3 (416.4 mg, 4.9 mmol, 192.8 pL, 1.5 equiv) in EtOH (3 mL) was stirred at 80 °C for 12 h. The mixture was filtered and the filtrate was concentrated to yield the title compound (1 g, crude) as a white solid.

[0999] Step 3: 3-(4-Bromo-2,6-dimethoxyphenyl)-5-ethyl-1,2,4-oxadiazole

[1000]

[1001] A mixture of 4-bromo-N'-hydroxy-2,6-dimethoxybenzamidine (900 mg, 3.3 mmol, 1 eq), ethyl propanoate (501.2 mg, 4.9 mmol, 563.1 μL, 1.5 eq) and NaOH (196.3 mg, 4.9 mmol, 1.5 eq) in DMSO (15 mL) was stirred at 30 °C for 2 h. The mixture was filtered and the filter cake was dried to give the title compound (900 mg, crude) as a white solid.

[1002] Step 4: 3-[2,6-Dimethoxy-4-[7-(1-methylpyrazol-4-yl)imidazo[1,2-a]pyridin-3- yl]phenyl]-5-ethyl-1,2,4-oxadiazole

[1003]

[1004] To a solution of 7-(1-methylpyrazol-4-yl)imidazo[1,2-a]pyridine (100 mg, 504.5 μmol, 1 eq), 3-(4-bromo-2,6-dimethoxyphenyl)-5-ethyl-1,2,4-oxadiazole (165.9 mg, 529.7 μmol, 1.0 eq) and Pd(dppf)Cl2CH2Cl2(20.6 mg, 25.2 μmol, 0.05 eq) in DMA (5 mL) was added Cs2CO3(493.1 mg, 1.5 mmol, 3 eq) in portions at 20 °C under N2and the resulting mixture was stirred at 100 °C for 12 h. The reaction mixture was added to saturated NH4Cl (aq, 50 mL) then extracted with EtOAc (50 mL, 3 mL). The combined organic phase was washed with brine (50 mL), then dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue which was purified by prep-HPLC (basic condition, column: Phenomenex Gemini-NX C18 75*30 mm*3 um; mobile phase: [water (0.04% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 40%, 10 min) to give the title compound (31.7 mg, 73.4 μmol, 14.6% yield, 99.6% purity) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ: 1.33 (t, J = 7.61 Hz, 3H) 3.02 (q, J = 7.50 Hz, 2H) 3.82 (s, 6H) 3.89 (s, 3H) 7.04 (s, 2H) 7.25 (dd, J = 7.17, 1.21 Hz, 1H) 7.88 (s, 2H) 8.09 (s, 1H) 8.36 (s, 1H) 8.73 (d, J = 7.28 Hz, 1H).

[1005] Example 62: 3-(4-(7-(1-ethyl-1H-pyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl)phenyl)-5- methyl-1,2,4-oxadiazole

[1006]

[1007] The title compound was prepared according to the procedure described in Example 61 using appropriately substituted starting materials. Yield: 29.1 mg; 92.3% purity. 1 H NMR (400 MHz, DMSO-d6) δ: 8.67 (d, J = 7.2 Hz, 1H), 8.44 (s, 1H), 8.21 - 8.06 (m, 3H), 7.90 (d, J = 8.8 Hz, 4H), 7.28 (br d, J = 6.1 Hz, 1H), 4.19 (q, J = 7.2 Hz, 2H), 2.70 (s, 3H), 1.44 (t, J = 7.3 Hz, 3H).

[1008] Example 63: 4-[6-(1-ethylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidin-3-yl]benzonitrile

[1009]

[1010] Step 1: 6-(1-ethylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidine

[1011]

[1012] A mixture of 6-bromopyrrolo[1,5-a]pyrimidine (400 mg, 2.0 mmol, 1 equiv), 1- ethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (448.6 mg, 2.0 mmol, 1 equiv), Pd(dppf)Cl2(147.8 mg, 202.0 μmol, 0.1 equiv), Na2CO3(428.2 mg, 4.0 mmol, 2 equiv) in dioxane (3 mL) and H2O (0.3 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was added to water (50 mL) and extracted with EtOAc (20 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether: ethyl acetate = 50:1 to 0:1) to yield the title compound (250 mg, crude) as a yellow solid.

[1013] Step 2: 3-bromo-6-(1-ethylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidine

[1014]

[1015] To a solution of 6-(1-ethylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidine (240 mg, 1.1 mmol, 1 equiv) in DCM (2 mL) was added NBS (210.3 mg, 1.2 mmol, 1.0 equiv) at 0 °C, and the resulting mixture was stirred at 0 °C for 1 h. The reaction mixture was added to water (20 mL) and extracted with DCM (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to yield the title compound (320 mg, crude) as a yellow solid.

[1016] Step 3: 4-[6-(1-ethylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidin-3-yl]benzonitrile

[1017]

[1018] A mixture of 3-bromo-6-(l-ethylpyrazol-4-yl)pyrrolo[l,5-a]pyrimidine (100 mg, 342.3 pmol, 1 equiv), (4-nitrilephenyl)boronic acid (55.3 mg, 376.5 pmol, 1.1 equiv), Pd(dppf)Cl2(25.1 mg, 34.2 pmol, 0.1 equiv), Na2CO3(108.8 mg, 1.0 mmol, 3 equiv) in dioxane (2 mL) and H2O (0.2 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 3 h. The reaction mixture was concentrated to give the crude product, which was purified by prep-HPLC (basic condition; column: Phenomenex Gemini-NX C18 75*30 mm*3um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 25%-55%, 8 min) to give the title compound as a green solid (12.2 mg, 36.7 pmol, 10.7% yield, 94.4% purity). 1 H NMR (400 MHz, DMSO-d6) d: 9.53 (d, J = 2.1 Hz, 1H), 9.07 (d, J = 2.1 Hz, 1H), 8.90 (s, 1H), 8.46 (s, 1H), 8.39 (d, J = 8.4 Hz, 2H), 8.14 (s, 1H), 7.91 (d, J = 8.5 Hz, 2H), 4.21 (q, J = 7.3 Hz, 2H), 1.44 (t, J = 7.3 Hz, 3H).

[1019] Example 64: 4-[6-(l-cyclopropylpyrazol-4-yl)pyrrolo[l,5-a]pyrimidin-3- yl]benzonitrile

[1020]

[1021] Step 1: 6-(l-cyclopropylpyrazol-4-yl)pyrrolo[l,5-a]pyrimidine

[1022]

[1023] To a solution of 6-bromopyrrolo[1,5-a]pyrimidine (200 mg, 1.0 mmol, 1 equiv), 1 - cyclopropyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (260.1 mg, 1.1 mmol, 1.1 equiv) and Na2C03(321.2 mg, 3.0 mmol, 3 equiv) in dioxane (2 mL) and H20 (0.4 mL) was added Pd(dppf)C12(73.9 mg, 101.0 μmol, 0.1 equiv) under N2and the resulting mixture was stirred at 100 °C for 12 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the crude product which was purified by preparative TLC (Si02, petroleum ether: ethyl acetate = 0:1 ) to yield the title compound as a yellow solid (120 mg, 532.74 μmol, 52.75% yield).

[1024] Step 2: 6-(1 -cyclopropylpyrazol-4-yl)-3-iodo-pyrrolo[1,5-a]pyrimidine

[1025]

[1026] To a solution of 6-(1 -cyclopropylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidine (120 mg, 532.7 μmol, 1 equiv) in DMF (2 mL) was added NIS (239.7 mg, 1.1 mmol, 2 equiv) and the resulting mixture was stirred at 20 °C for 1 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a yellow solid (180 mg, crude).

[1027] Step 3: 4-[6-(1 -cyclopropylpyrazol-4-yl)pyrrolo[1,5-a]pyrimidin-3-yl]benzonitrile

[1028]

[1029] To a solution of 6-(l-cyclopropylpyrazol-4-yl)-3-iodo-pyrrolo[l,5-a]pyrimidine (180 mg, 512.6 pmol, 1 eq), (4-nitrilephenyl)boronic acid (75.3 mg, 512.6 pmol, 1 eq) and Na2C03 (162.9 mg, 1.5 mmol, 3 eq) in dioxane (2 mL) and H20 (0.4 mL) was added Pd(dppf)C12 (37.5 mg, 51.3 pmol, 0.1 eq) under N2 and the resulting mixture was stirred at 100 °C for 12 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the crude product which was purified by preparative HPLC (basic conditions; column: Phenomenex Gemini-NX C18 75*30 mm*3um; mobile phase: [water (0.05% NH3H20 + 10 mM NH4HC03) - ACN]; B%: 20% - 50%, 8 min) to yield the title compound as a yellow solid (3.9 mg, 11.2 pmol, 2.18% yield, 93.3% purity). 1 H NMR (400 MHz, DMSO-d6) d: 9.55-9.49 (m, 1H), 9.52 (d, J = 2.0 Hz, 1H), 9.08 (d, J = 2.0 Hz, 1H), 8.90 (s, 1H), 8.51 (s, 1H), 8.38 (d, J = 8.4 Hz, 2H), 8.13 (s, 1H), 7.91 (d, J = 8.4 Hz, 2H), 3.87-3.70 (m, 1H), 1.11-1.01 (m, 4H).

[1030] Example 65: 6-(l-cyclopropylpyrazol-4-yl)-3-[4-(l-ethyltriazol-4-yl)-3,5- dimethoxy-phenyl]pyrrolo[l,5-a]pyridine

[1031]

[1032] Step 1: 5-bromo-2-ethynyl-l,3-dimethoxybenzene

[1033]

[1034] To a solution of 4-bromo-2,6-dimethoxybenzaldehyde (4 g, 16.32 mmol, 1 eq) in MeOH (10 mL) was added K2CO3(6.77 g, 48.97 mmol, 3 eq) and 1-diazo-1-dimethoxyphosphorylpropan-2-one (4.70 g, 24.48 mmol, 1.5 eq) and the resulting mixture was stirred at 20 °C for 12 h. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 1 to 20 / 1) to give the title compound (2.5 g, crude) as a white solid.

[1035] Step 2: 4-(4-bromo-2,6-dimethoxyphenyl)-1-ethyltriazole

[1036]

[1037] To a solution of 5-bromo-2-ethynyl-1,3-dimethoxybenzene (1 g, 4.15 mmol, 1 eq) in H2O (10 mL) was added NaN3(539.32 mg, 8.30 mmol, 2 eq) and CuI (158.00 mg, 829.60 pmol, 0.2 eq), (2R)-2-[(2R)-3,4-dihydroxy-5-oxo-2H-furan-2-yl]-2-hydroxyethanol sodium (821.74 mg, 4.15 mmol, 1 eq) and iodoethane (323.47 mg, 2.07 mmol, 165.88 pL, 0.5 eq) and the resulting mixture was stirred at 80 °C for 0.5 h. The reaction mixture was added to water (20 mL) and extracted with EtOAc (10 mL, 3x). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 50 / 1 to 0 / 1) to give the title compound (150 mg, crude) as a white solid.

[1038] Step 3: 4-[2,6-dimethoxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1- ethyltriazole

[1039]

[1040] A mixture of 4-(4-bromo-2,6-dimethoxyphenyl)-1 -ethyltriazole (150 mg, 480.52 pmol, 1 equiv), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2- dioxaborolane (146.43 mg, 576.62 pmol, 1.2 equiv), KOAc (94.32 mg, 961.04 pmol, 2 equiv) and Pd(dppf)Cl2(35.16 mg, 48.05 pmol, 0.1 equiv) in dioxane (1 mL) was degassed and purged with N2(3x) and then the mixture was stirred at 90 °C for 3 h. The reaction mixture was concentrated to yield the title compound (170 mg, crude) as a black oil, used in the next step without further purification.

[1041] Step 4: 6-(1 -cyclopropylpyrazol-4-yl)-3-[4-(1 -ethyltriazol-4-yl)-3,5- dimethoxyphenyl]pyrrolo[1,5-a]pyridine

[1042]

[1043] To a solution of 4-[2,6-dimethoxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2- yl)phenyl]-1 -ethyltriazole (150 mg, 417.56 pmol, 1 equiv), 6-(1 -cyclopropylpyrazol-4- yl)-3-iodopyrrolo[1,5-a]pyridine (160.83 mg, 459.32 pmol, 1.1 equiv) and Pd(dppf)Cl2(30.55 mg, 41.76 pmol, 0.1 equiv) in dioxane (2 mL) and H2O (0.2 mL) was added Na2CO3(88.51 mg, 835.13 pmol, 2 equiv) under N2and the resulting mixture was stirred at 90 °C for 4 h. The reaction mixture was concentrated to yield the crude product which was purified by preparative HPLC (basic condition; column: Phenomenex Gemini-NX C18 75*30 mm*3um; mobile phase: [water (0.05% NH3H2O) - ACN]; B%: 25%-55%, 12 min) to yield the title compound (2.1 mg, 4.61 pmol, 2.91 % yield, 100% purity) as a grey solid. 1H NMR (400 MHz, DMSO-d6) δ: 9.11 (s, 1H), 8.48 (s, 1H), 8.43 (s, 1H), 8.09-8.05 (m, 2H), 7.65 (br d, J = 9.3 Hz, 2H), 7.00 (s, 2H), 4.48-4.40 (m, 2H), 3.83 (s, 6H), 3.78 (br d, J = 3.8 Hz, 1H), 1.51 (t, J = 7.3 Hz, 3H), 1.13-1.08 (m, 2H), 1.03 (br d, J = 5.0 Hz, 2H).

[1044] Example 66: 4-[7-(1-cyclopropyltriazol-4-yl)imidazo[1,2-a]pyridin-3-yl]benzonitrile

[1045]

[1046] Step 1: 2-imidazo[1,2-a]pyridin-7-ylethynyl(trimethyl)silane

[1047]

[1048] To a solution of 7-bromoimidazo[1,2-a]pyridine (2 g, 10.15 mmol, 1 eq), ethynyl(trimethyl)silane (2.99 g, 30.45 mmol, 4.22 mL, 3 eq) and TEA (4.11 g, 40.60 mmol, 5.65 mL, 4 eq) in DMF (40 mL) was added Pd(PPh3)2Cl2 (712.47 mg, 1.02 mmol, 0.1 eq) and Cul (193.32 mg, 1.02 mmol, 0.1 eq) under N2and the resulting mixture was stirred at 70 °C for 12 h. The mixture was partitioned between water (50 mL) and ethyl acetate (50 mL, 3x). The organic phase was separated, washed with brine (100 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to yield crude product which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1:0 to 2:1) to yield the title compound (1.4 g, 6.53 mmol, 64.35% yield) as a brown oil.

[1049] Step 2: 7-ethynylimidazo[1,2-a]pyridine

[1050]

[1051] To a solution of 2-imidazo[l,2-a]pyridin-7-yl ethynyl(trimethyl)silane (800 mg, 3.73 mmol, 1 eq) in MeOH (10 mL) was added K2CO3(1.55 g, 11.20 mmol, 3 eq) and the resulting mixture was stirred at 20 °C for 0.5 h. The reaction mixture was concentrated under reduced pressure to give a residue, which was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give the title compound (200 mg, crude) as a yellow solid.

[1052] Step 3: 7-(lH-Triazol-4-yl)imidazo[l,2-a]pyridine

[1053]

[1054] To a solution of 7-ethynylimidazo[l,2-a]pyridine (170 mg, 1.20 mmol, 1 eq) and TMSN3(275.55 mg, 2.39 mmol, 314.55 pL, 2 eq) in DMF (1.8 mL) and MeOH (0.2 mL) was added Cul (11.39 mg, 59.79 pmol, 0.05 eq) under N2and the resulting mixture was stirred at 100 °C for 12 h. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by reverse phase HPLC (column: C18 20-35 pm 40 g; mobile phase: [water-ACN]; B%: 0%-20%, 30 mL / min) to give the title compound (150 mg, 810.00 pmol, 67.73% yield) as a yellow solid.

[1055] Step 4: 7-(l-Cyclopropyltriazol-4-yl)imidazo[l,2-a]pyridine

[1056]

[1057] To a solution of 7-(1H-triazol-4-yl)imidazo[1,2-a]pyridine (120 mg, 648.00 µmol, 1 eq) and cyclopropylboronic acid (278.31 mg, 3.24 mmol, 6.49 µL, 5 eq) in pyridine (512.57 mg, 6.48 mmol, 523.03 µL, 10 eq) was added Cu(OAc)2 (353.10 mg, 1.94 mmol, 3 eq) and DIEA (837.50 mg, 6.48 mmol, 1.13 mL, 10 eq) and the resulting mixture was stirred at 100 °C for 6 h. The mixture was partitioned between water (5 mL) and ethyl acetate (5 mL, 3x). The organic phase was separated, washed with brine (5 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to yield crude product which was purified by preparative HPLC (basic conditions; column: Waters Xbridge Prep OBD C18 150*40mm*10um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15% - 45%, 8 min) to yield the title compound (15 mg, 66.59 µmol, 10.28% yield) as a grey solid.

[1058] Step 5: 4-[7-(1-cyclopropyltriazol-4-yl)imidazo[1,2-a]pyridin-3-yl]benzonitrile

[1059]

[1060] To a solution of 7-(1-cyclopropyltriazol-4-yl)imidazo[1,2-a]pyridine (15 mg, 66.59 µmol, 1 eq), 4-bromobenzonitrile (12.12 mg, 66.59 µmol, 1 eq) and Cs2CO3 (43.39 mg, 133.19 µmol, 2 eq) in DMA (0.5 mL) was added Pd(dppf)Cl2·CH2Cl2 (5.44 mg, 6.66 µmol, 0.1 eq) under N2and the resulting mixture was stirred at 100 °C for 4 h. The reaction mixture was concentrated to yield crude product which was purified by preparative HPLC (basic conditions; column: Phenomenex Gemini-NX C18 75*30mm*3um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 28% - 58%, 8 min) to yield the title compound (9 mg, 27.17 µmol, 40.80% yield, 98.526% purity) as a grey solid. 1H NMR (400 MHz, DMSO-d6) δ: 8.76 (d, J = 7.1 Hz, 1H), 8.49 (s, 1H), 8.19 (s, 1H), 8.06-7.98 (m, 3H), 7.98-7.91 (m, 2H), 7.48 (br d, J = 7.3 Hz, 1H), 4.21 (td, J = 3.7, 7.4 Hz, 1H), 1.28 (br d, J = 3.1 Hz, 2H), 1.20-1.08 (m, 2H).

[1061] Example 67: 4-[7-(2-ethyltetrazol-5-yl)imidazo[l,2-a]pyridin-3-yl]benzonitrile

[1062]

[1063] Step 1: Imidazo[l,2-a]pyridine-7-carbonitrile

[1064]

[1065] A mixture of 2-aminopyridine-4-carbonitrile (5 g, 41.9 mmol, 1 equiv), 2- chloroacetaldehyde (20.6 g, 104.9 mmol, 16.9 mL, 40% purity, 2.5 equiv), and NaHC03(7.1 g, 83.9 mmol, 3.3 mL, 2 equiv) in EtOH (60 mL) was stirred at 80 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove EtOH, and the resulting residue was purified by column chromatography (Si02, petroleum ether: ethyl acetate = 1:0 to 0:1) to give the title compound as a brown oil (7 g, crude).

[1066] Step 2: 7-(2H-tetrazol-5-yl)imidazo[l,2-a]pyridine

[1067]

[1068] A mixture of imidazo[l,2-a]pyridine-7-carbonitrile (1 g, 6.9 mmol, 1 equiv), sodium azide (454.2 mg, 6.9 mmol, 1 equiv), and NH4C1 (411.1 mg, 7.7 mmol, 1.1 equiv) in DMF (5 mL) was stirred at 80 °C for 12 h to give crude product as a black oil (1.3 g, crude), which was used in the next step without further purification.

[1069] Step 3: 7-(2-ethyltetrazol-5-yl)imidazo[l,2-a]pyridine

[1070]

[1071] To a solution of 7-(2-ethyltetrazol-5-yl)imidazo[l,2-a]pyridine (170 mg, 793.6 pmol, 1 eq) in DMA (2 mL) was added 4-bromobenzonitrile (144.4 mg, 793.6 pmol, 1 eq), Cs2CO3(517.1 mg, 1.6 mmol, 2 eq) and Pd(dppf)Cl2CH2Cl2(64.8 mg, 79.4 pmol, 0.1 eq). The mixture was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was concentrated to give crude product, which was purified by prep-HPLC (basic condition; Column: Waters X bridge Prep OBD C18 150*40mm*10um; Mobile Phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 30%-60%, 8 min) to give the title compound as a brown solid (16.4 mg, 52.0 pmol, 6.6% yield, 100% purity).

[1072] Step 4: 4-[7-(2-ethyltetrazol-5-yl)imidazo[l,2-a]pyridin-3-yl]benzonitrile

[1073]

[1074] A mixture of 7-(2-ethyltetrazol-5-yl)imidazo[l,2-a]pyridine (170 mg, 793.6 pmol, 1 eq), 4-bromobenzonitrile (144.4 mg, 793.6 pmol, 1 eq), Cs2CO3(517.1 mg, 1.6 mmol, 2 eq) and Pd(dppf)Cl2CH2Cl2(64.8 mg, 79.4 pmol, 0.1 eq) in DMA (2 mL) was degassed and purged with N2(3x), and then the mixture was stirred at 100 °C under N2atmosphere for 12 h. The reaction mixture was concentrated to give crude product, which was purified by prep-HPLC (basic condition; Column: Waters X bridge Prep OBD C18 150*40mm*10um; Mobile Phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 30%-60%, 8 min) to give the title compound as a brown solid (16.4 mg, 52.0 pmol, 6.6% yield, 100% purity). 1 H NMR (400 MHz, DMSO-d6) d: 8.88 (br d, J = 7.1 Hz, 1H), 8.32 (s, 1H), 8.14 (br s, 1H), 8.08-8.02 (m, 2H), 8.02-7.95 (m, 2H), 7.62 (br d, J = 7.3 Hz, 1H), 4.83 (q, J = 7.3 Hz, 2H), 1.69-1.55 (m, 3H).

[1075] Example 68: 3-[3,5-Dimethoxy-4-(2,2,2-trifluoroethylcarbamoyl)phenyl]-N-[(6- methyl-3-pyridinyl)methyl]imidazo[l,2-a]pyridine-7-carboxamide

[1076]

[1077] Step 1: Methyl 4-bromo-2,6-dimethoxybenzoate

[1078]

[1079] A mixture of methyl 4-bromo-2,6-difluorobenzoate (5 g, 19.92 mmol, 1 eq) and NaOMe (5.38 g, 99.59 mmol, 5 eq) in MeOH (80 mL) was stirred at 80 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove MeOH, then diluted with water (100 mL) and extracted with EtOAc (300 mL). The combined organic layers were washed with brine (50 mL), dried over Na2S04, filtered and concentrated under reduced pressure to yield the title compound as a white solid (8 g, crude).

[1080] Step 2: 4-Bromo-2,6-dimethoxybenzoic acid

[1081]

[1082] A mixture of methyl 4-bromo-2,6-dimethoxybenzoate (2 g, 7.27 mmol, 1 eq), NaOH (872.42 mg, 21.81 mmol, 3 eq) in MeOH (50 mL), THF (20 mL) and H20 (10 mL) was stirred at 70 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove MeOH and THF, then HCl (12 N, 0.5 mL) was added. The mixture was filtered and the filter cake was concentrated under reduced pressure to yield the title compound as a white solid (1.8 g, crude).

[1083] Step 3: 4-Bromo-2,6-dimethoxy-N-(2,2,2-trifluoroethyl)benzamide

[1084]

[1085] To a solution of 4-bromo-2,6-dimethoxybenzoic acid (0.8 g, 3.06 mmol, 1 eq), 2,2,2-trifluoroethylamine (333.89 mg, 3.37 mmol, 264.99 μL, 1.1 eq) in DMF (15 mL) was added DIEA (792.07 mg, 6.13 mmol, 1.07 mL, 2 eq) and HATU (1.75 g, 4.60 mmol, 1.5 eq) and the resulting mixture was stirred at 25 °C for 12 h. The reaction mixture was diluted with water (50 mL) and extracted with EtOAc (200 mL). The combined organic layers were washed with brine (50 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 8 / 1) to give the title compound (0.4 g, crude) as a white solid.

[1086] Step 4: Methyl 3-[3,5-dimethoxy-4-(2,2,2-trifluoroethylcarbamoyl)phenyl]- imidazo-[l,2-a]pyridine-7-carboxylate

[1087]

[1088] To a solution of methyl imidazo[l,2-a]pyridine-7-carboxylate (0.20 g, 1.14 mmol, 1 eq), 4-bromo-2,6-dimethoxy-N-(2,2,2-trifluoroethyl)benzamide (388.38 mg, 1.14 mmol, 1 eq) and Cs2CO3(1.11 g, 3.41 mmol, 3 eq) in DMAC (6 mL) was added Pd(dppf)Cl2(46.35 mg, 56.76 μmol, 0.05 eq) and the resulting mixture was stirred at 100 °C for 12 h. The reaction mixture was diluted with water (60 mL) and extracted with EtOAc (200 mL). The combined organic layers were washed with brine (100 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue which was purified by preparative TLC (SiO2, ethyl acetate:methanol = 10:1) to give the title compound (350 mg, crude) as a yellow solid.

[1089] Step 6: 3-[3,5-Dimethoxy-4-(2,2,2-trifluoroethylcarbamoyl)phenyl]imidazo-[l,2- a]pyridine-7-carboxylic acid

[1090]

[1091] A mixture of methyl 3-[3,5-dimethoxy-4-(2,2,2-trifluoroethylcarbamoyl)phenyl]imidazo- [1,2-a]pyridine-7-carboxylate (350 mg, 800.24 pmol, 1 eq), NaOH (64.02 mg, 1.60 mmol, 2 eq) in MeOH (15 mL) and H2O (5 mL) was stirred at 50 °C for 2 h. The reaction mixture was concentrated under reduced pressure to remove MeOH, then HCl (12 N, 0.2 mL) was added to the solution. The mixture was filtered and the filter cake was concentrated under reduced pressure to yield the title compound as a brown solid (150 mg, crude).

[1092] Step 7: 3-[3,5-Dimethoxy-4-(2,2,2-trifluoroethylcarbamoyl)phenyl]-N-[(6-methyl-3- pyridinyl)methyl]imidazo[1,2-a]pyridine-7-carboxamide

[1093]

[1094] To a solution of 3-[3,5-dimethoxy-4-(2,2,2-trifluoroethylcarbamoyl)phenyl]imidazo[1,2- a]pyridine-7-carboxylic acid (80 mg, 188.97 pmol, 1 eq), (6-methyl-3-pyridinyl)methanamine (23.09 mg, 188.97 pmol, 1 eq) and DIEA (48.85 mg, 377.95 pmol, 65.83 pL, 2 eq) in DMF (2 mL) was added HATU (93.41 mg, 245.66 pmol, 1.3 eq) and the resulting mixture was stirred at 40 °C for 12 h. The reaction mixture was filtered to yield a residue which was purified by preparative HPLC (column: Waters Xbridge Prep OBD CI 8 150*40mm*10um; mobile phase: [water (0.05% NH3H2O + 10 mM NH4HCO3) - ACN]; B%: 15%-45%, 8 min) to yield the title compound as a white solid (62.7 mg, 118.26 pmol, 62.58% yield, 99.496% purity). 1H NMR (400 MHz, MeOD-d4) δ: 8.66 (d, J = 7.1 Hz, 1H), 8.71-8.59 (m, 1H), 8.47 (s, 1H), 8.18 (s, 1H), 7.92 (s, 1H), 7.79 (dd, J = 2.1, 8.1 Hz, 1H), 7.47 (dd, J = 1.5, 7.3 Hz, 1H), 7.32 (d, J = 7.9 Hz, 1H), 6.96 (s, 2H), 4.63 (s, 2H), 4.08 (q, J = 9.3 Hz, 2H), 3.91 (s, 6H), 2.54 (s, 3H).

[1095] Bioassay

[1096] The following general materials and methods were used in Examples A-D.

[1097] Gene Expression Analysis

[1098] Single cell subclones of Ocy454 cells (Wein et al., Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 2015, 30(3):400-11) were used for all experiments. Cells were passaged in a-MEM supplemented with heat-inactivated 10% fetal bovine serum and 1% antibiotic-antimycotic (Gibco TM ) at 33 °C in 5% CO2. Cells were seeded at 50,000 cells / mL and allowed to reach confluence in 2-3 days at 33 °C. Cells were then transferred from 33 °C to 37 °C to inactivate the temperature-sensitive T-antigen and promote osteocyte differentiation. Cells were then treated with compounds from 10 mM DMSO stocks at the indicated doses for four hours with experimental replicates. QIAshredder (QIAGEN) and PureLink RNA Mini Kit (Invitrogen TMTotal RNA was collected from the cultured cells following the manufacturer's instructions. Lysis buffer with 2-mercaptoethanol was added to the cells washed in cold PBS and collected into a QIAshredder and centrifuged at 15,000 g for 3 minutes. The flow-through was collected into a new tube and RNA isolation was performed with the PureLink RNA Mini Kit. For qRT-PCR, cDNA was prepared with 750 ng of RNA using the Primescript RT Kit (Takara Inc.) and analyzed with Green ROX (Quanta bio) in StepOnePlus TM Real-Time PCR System (Applied Biosystems) using specific primers designed for each targeted gene. Relative expression was calculated using 2 -ΔΔCT Methods by normalizing to the expression of the beta-actin housekeeping gene and relative expression was presented as fold increase relative to beta-actin. The primers used were beta-actin (CCTCTATGCCAACACAGTGC (SEQ ID NO. 1) and ACATCTGCTGGAAGGTGGAC (SEQ ID NO. 2)), SOST (GCCTCATCTGCCTACTTGTG (SEQ ID NO. 3) and CTGTGGCATCATTCCTGAAG (SEQ ID NO. 4)) and RANKL (GCTGGGCCAAGATCTCTAAC (SEQ ID NO. 5) and GTAGGTACGCTTCCCGATGT (SEQ ID NO. 6)). Data is presented as maximum RANKL induction fold over DMSO (vehicle) control.

[1099] Western Blot

[1100] Immunoblotting was performed as previously described (see, e.g., Wein et al., Nature Communications, 2016, 7: 13176; and Sato et al., Nature Communications, 2020, 11(1): 3282). Whole cell lysates were prepared using TNT (Tris-NaCl-Tween buffer, 20 mM Tris-HCl pH 8, 200 mM NaCl, 0.5% Triton X-100 with protease inhibitors (PI), 1 mM NaF, 1 mM DTT, 1 mM vanadate). Adherent cells were washed with ice-cold PBS and then scraped into TNT buffer on ice. The material was then transferred to an Eppendorf tube kept on ice, vortexed at maximum speed for 30 seconds, and then centrifuged at maximum speed for 6 minutes at 4°C. For subcellular fractionation, cells were initially resuspended in hypotonic lysis buffer (20 mM HEPES, 10 mM KCl, 1 mM MgCl2, 0.1% Triton X-100, 5% glycerol supplemented with DTT, protease inhibitors, and phosphatase inhibitors) on ice for 5 minutes. Nuclear pellets were spun at 5,000 rpm for 5 minutes, and the supernatant was saved as cytoplasmic lysate. Afterwards, nuclear pellets were washed once in 1 mL of hypotonic lysis buffer. Nuclear pellets were then resuspended in hypertonic lysis buffer (20 mM HEPES, 400 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 5% glycerol supplemented with DTT, protease inhibitors, and phosphatase inhibitors) and then vortexed twice for 30 seconds. Debris was spun at 14,000 rpm for 5 minutes, and the supernatant was saved as nuclear lysate. For immunoblotting, lysates or immunoprecipitates were separated by SDS-PAGE, and proteins were transferred to nitrocellulose. Membranes were blocked with tris-buffered saline with 5% milk plus 0.05% Tween-20 (TBST) and incubated with primary antibodies overnight at 4°C. The next day, membranes were washed, incubated with appropriate HRP-conjugated secondary antibodies, and signal was detected with ECL Western Blotting Substrate (Pierce), ECL Plus Western Blotting Substrate (Pierce), or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo scientific). Primary antibodies phospho-HDAC4 / 5 / 7 (S246 / S259 / S155) (Cell Signaling Technology, 3443) and total HDAC5 (Assay Biotech, C0225).

[1101] Example A: In vitro SIK2 kinase assay

[1102] Assays were performed in alkaline reaction buffer (20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.02% Brij35, 0.02 mg / mL BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO). Compounds were dissolved in 10 mM stock containing 100% DMSO. Serial dilutions were performed in DMSO by Integra Viaflo Assist. Recombinant SIK2 was used at a concentration of 2.5 nM. The substrate used was pAMARA at a concentration of 0.2 mg / mL. Kinase assay was performed with 2 mM Mn 2+ supplemented, and 1 mM ATP was added. The assay was performed at room temperature for 20 minutes, after which 33 P-ATP (10 μCi / μL), followed by an additional 120 minutes incubation at room temperature. After that, the incorporation of radioactivity into the pEY peptide substrate was detected by filter binding method. Kinase activity data was expressed as the percentage of the remaining kinase activity in the test sample compared to the DMSO reaction. IC 50 values and curve fitting were obtained using Prism (GraphPad software).

[1103] Example B: NanoBRET cell-based target engagement assay

[1104] Assays were performed in HEK293 cells from ATCC in 384-well plate format at Reaction Biology Corporation (Malvern, PA) using the NanoBRET TE intracellular kinase assay platform from Promega. HEK293 cells transiently expressing the NanoLuc-SIK2 fusion vector were seeded into 384-well plates. Cells were pre-treated with NanoBRET tracer K-4 and then treated with compounds in a 10-point dose response format for 60 minutes. BRET signal was measured on an Envision 2104 multi-label reader. IC50 values were calculated and IC 50 curves were plotted using the GraphPad Prism 4 program with a sigmoidal dose response equation.

[1105] Example C: CRTC2 nuclear translocation

[1106] Nuclear translocation cell lines were engineered to co-express two fusion proteins: a) an enzyme donor (ED) tagged target protein; b) an enzyme acceptor (EA) tagged TAZ domain derived from the CBP / P300 transcription factor localized to the nucleus. Activation of the signaling pathway induces translocation of the ED-tagged target protein into the nucleus, which will force complementation of the two enzyme fragments and cause the formation of a functional enzyme that will hydrolyze the substrate and generate a chemiluminescent signal. U2OS CRTC2 (TORC2) translocation assays were performed in 384-well plates from Eurofins DiscoverX (Freemont, CA). Cells were treated with compounds for 90 minutes in a 5-point dose response format (4-fold serial dilution with a maximum dose of 10 mM) with experimental replicates, followed by colorimetric readout on an Envision 2104 multi-label reader. Forskolin was used as a positive control in all experiments, and the maximum CRTC2 nuclear translocation induced by each compound was expressed as a percentage of the signal stimulated by forskolin.

[1107] Compounds provided herein were tested in one or more of the assays described in Examples A-C, and representative data is shown in Table A.

[1108] Table A.

[1109]

[1110]

[1111] NA = not available

[1112] NI = no inhibition

[1113] Example D: Representative cellular data

[1114] U2OS CRTC2 (TORC2) PathHunter cells were treated with the indicated doses of the compound of Example 51 for 90 minutes, after which nuclear CRTC2 translocation was measured. Representative data is shown in Figure 4A and is presented as a percentage of the signal of the positive control (forskolin).

[1115] Ocy454 cells were treated with the indicated doses of the compound of Example 51 for 4 hours, after which RNA was isolated and SOST and RANKL expression was measured by RT-qPCR (normalized to the housekeeping gene b-actin). As shown in Figure 4B treatment with the compound of Example 51 reduced SOST and stimulated RANKL expression.

[1116] Ocy454 cells were treated with the indicated doses of the compound of Example 51 for 2 hours, after which protein isolation and immunoblotting was performed. As shown in Figure 4C Figure 17, treatment with the compound of Example 51 reduced the level of HDAC4 / 5 phosphorylation without affecting total HDAC5 protein levels. These data demonstrate the PTH-like effect of the small molecule SIK2 / 3 inhibitor, 2-[2,6-dimethoxy-4-[7-(1 -methylpyrazol-4-yl)imidazo[1,2-a]pyridin-3-yl]phenyl]-5- ethyl-1,3,4-oxadiazole (Example 51 ), in a physiologically relevant osteocyte culture model.

[1117] Example E: Cell-based data

[1118] A cell-based assay was performed to assess the effect of compound 51 in a physiologically relevant osteocyte culture model. As shown in Figure 5A Figure 18, treatment of Ocy454 cells with compound 51 dose-dependently reduced phosphorylation of HDAC4 / 5, a known SIK2 / 3 substrate. Changes in SIK substrate phosphorylation lead to changes in downstream gene expression. As shown in Figure 5B Figure 19, treatment of Ocy454 cells with compound 51 resulted in induction of RANKL and inhibition of SOST expression.

[1119] Additional cell-based assays were performed with a third-party contract research organization to confirm the cellular effects of compound 51 and its analogs. As shown in Figure 6A and 6B Figure 20, nanoBRET target engagement assays in HEK293T cells demonstrated the selective SIK2 / SIK3 engagement of compound 51 and compound 55 in this assay. In these assays, the IC 50 for compound 51 was calculated to be 1.13 nM for SIK2, 0.51 nM for SIK3, and 32.2 nM for SIK1. The IC 50 for compound 55 was calculated to be 12.2 nM for SIK2, 4.48 nM for SIK3, and 2.1 μΜ for SIK1. In addition to direct target engagement, the ability of compound 51 to promote nuclear translocation of CRTC2 (known as TORC2) was measured. This assay was performed because SIK2 and SIK3 phosphorylate CRTC2 and promote its cytoplasmic retention. Thus, SIK2 / SIK3 inhibition should result in reduced CRTC2 phosphorylation and nuclear translocation of this protein. Indeed, CRTC2 caused robust nuclear translocation in response to increasing doses of compound 51 Figure 6C , with an EC 50147 nM). These results show that compound 51 potently inhibits SIK2 and SIK3 in cells. These data prompted testing of compound 51 on bone mass in vivo.

[1120] Example F: In vivo data

[1121] Based on initial mouse pharmacokinetic studies, oral availability of compound 51 was excellent after a single dose of 10 mg / kg, with a maximum serum concentration of 11 μΜ. Here (as shown in Figure 7 eight-week-old, eugonadal male mice (n=10 / group) were treated with three different doses of SK-124 by once daily (7 days / week) oral gavage for 3 weeks. In addition, one group of mice was treated with oral vehicle solution (negative control) and another group of mice was treated with once daily subcutaneous hPTH(l-34) injections (80 μg / kg) (positive control group). As shown in Figure 8A mice tolerated compound 51 treatment well with no apparent health concerns or weight loss. Serum was collected 2 hours after oral gavage on treatment day 13 to measure compound 51 drug levels Figure 8B ). Serum compound 51 was detectable in all treatment groups, and in the three treatment groups, compound 51 serum levels increased in a dose-dependent manner.

[1122] Serum mineral metabolism parameters were measured in mice from all 5 treatment groups after 21 days of treatment (serum collected 2 hours after the final treatment dose). As shown in Figure 9, in vivo compound 51 treatment elicited a PTH-like effect, including increased calcium, elevated 1,25-vitamin D levels, and decreased serum PTH levels. In contrast, compound 51 treatment did not change serum levels of phosphorous or BUN. Taken together, these mineral metabolism changes demonstrate a PTH-like effect of compound 51 treatment and support further investigation of the skeletal effects of this compound. Serum bone turnover markers (P1NP, a marker of bone formation; CTX, a marker of bone resorption) were next assayed on samples collected after 21 days of treatment. As shown in Figure 10, oral compound 51 (40 mg / kg) treatment increased P1NP and CTX in a manner similar to once daily subcutaneous PTH treatment, compared to vehicle.

[1123] Next, the effect of three weeks of compound 51 treatment on bone mass in the femur was evaluated using micro-CT. As shown in Figure 11A and 11B compound 51 (40 mg / kg) treatment increased primary spongiosa bone mass fraction (BV / TV) and bone mineral density (BMD) in a manner similar to subcutaneous PTH injections. Compound 51 treatment also increased cortical bone tissue mineral density (TMD), asFigure 7 The positive effects of compound 51 treatment on bone mass facilitated additional exploration of the underlying cellular and molecular mechanisms responsible. As shown in Figure 12 FIG. 13, decalcified paraffin-embedded sections from tibiae indicated that trabecular bone mass was increased, osteoblasts were increased, and TRAP-positive osteoclasts were increased in mice treated with compound 51 (40 mg / kg). Undecalcified plastic-embedded sections of femurs were obtained and analyzed by static and dynamic histomorphometry of trabecular bone in the distal metaphysis to quantify the effects of compound 51 on bone cell composition and activity levels. Compound 51 treatment increased trabecular bone mass, osteoclast number, osteoblast number, and bone formation rate (FIGS. 13 and 14).

[1124] Having established that oral compound 51 treatment increases bone mass and bone formation, the molecular relevance of these cellular changes was evaluated. To this end, cortical bone RNA isolated from mice after three weeks of compound 51 treatment was analyzed and RT-qPCR was performed on well-established osteocyte marker genes. Consistent with the histology and histomorphometry results, compound 51 treatment increased expression of Spp1 and Ctsk (FIG. 15). Previous studies have shown that SIK2 and SIK3 play a key role in regulating the expression of sclerostin, an inhibitor of bone formation derived from osteocytes. Therefore, the expression of sclerostin (encoded by the Sost gene) in bone in response to compound 51 treatment was evaluated by RT-qPCR and immunohistochemistry. Consistent with previous studies with non-specific pan-SIK inhibitors and SIK2 / SIK3 genetic deletion, compound 51 treatment decreased sclerostin gene expression Figure 16A ) and protein levels Figure 16B , C) in vivo. Compound 55A Figure 17 CLAIM OF PRIORITY FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT Figure 1A Figure 1B Figure 3 Figure 17 Gene Expression Analysis Western Blot Figure 4A Figure 4B Figure 4C Figure 5A Figure 5B Figure 6A Figure 6C Figure 7 Figure 8A Figure 8B Figure 11A Figure 7 Figure 12 Figure 16A Figure 16B Figure 17 CLAIM OF PRIORITY FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT Figure 1A Figure 1B Figure 3 Figure 17 Gene Expression Analysis Western Blot Figure 4A Figure 4B Figure 4C Figure 5A Figure 5B Figure 6A Figure 6C Figure 7 Figure 8A Figure 8B ) was also identified. Initial in vitro testing of this compound showed potent SIK2 inhibition (IC 50 <100 pM).

[1125] In summary, oral administration of the potent / selective SIK2 / 3 inhibitor compound 51 increased bone formation and bone mass without significant toxicity. These in vivo efficacy data support the use of the compound within the present claims, for example, for the treatment of osteoporosis and related musculoskeletal indications.

[1126] Other embodiments

[1127] It is to be understood that while the application has been described in conjunction with the specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the application. The scope of the application is defined by the scope of the appended claims. Other aspects, advantages and modifications within the scope of the claims are within the knowledge of persons of ordinary skill in the art to which the application pertains. It is understood that any of the features of the application described in relation to any particular aspect and / or embodiment of the application herein can be combined with any of the other features of any other aspect and / or embodiment of the application described herein, with modifications as appropriate to ensure compatibility of the combinations. Such combinations are seen to be part of the present disclosure.

Claims

1. A compound of formula I: Or its pharmaceutically acceptable salt, wherein: (i) V, X, and Z are each C, and W and Y are each N; or (ii) V, Y, and Z are each C, and W and X are each N; and Rings including V, W, X, Y, and Z form heteroaromatic rings; U is CR 3 ; U' is CR 5 ; U" is CR 6 ; R 1 Selected from 5-6 quinone heteroaryl and OR a1 The 5-6 heteroaryl group is optionally separated by one, two or three independently selected R groups. 1A Substituent substitution; R a1 Selected from (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl group, wherein the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one, two, three or four independently chosen R groups. 1A Substituent substitution; Each R 1A Selected independently from C 1-6 Alkyl and C 3-10 cycloalkyl, wherein the C 1-6 Alkyl groups are optionally C 1-4 Alkyl substitution; R 2 For H; R 3 Selected from H, halogen, C 1-6 Alkyl and C 1-6 Alkoxy; R 4 Selected from 5-6-membered heteroaryl groups, wherein the 5-6-membered heteroaryl group is optionally composed of one, two, or three independently selected R groups. 4A Substituent substitution; Each R 4A Selected independently from C 1-6 alkyl; R 5 Selected from H, halogen, C 1-6 Alkyl and C 1-6 alkoxy groups; and R 6 For H.

2. The compound according to claim 1, wherein R 4 It is a 5-6 membered heteroaryl group, wherein the 5-6 membered heteroaryl group is optionally composed of one or two independently selected R groups. 4A Substituent substitution.

3. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R 1 Selected from 5-6 quinone heteroaryl or OR a1 The 5-6 heteroaryl group is optionally separated by one or two independently selected R groups. 1A Substituent substitution.

4. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R a1 Selected from (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl group, wherein the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one or two independently chosen R groups. 1A Substituent substitution.

5. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R a1 The R-molecules are selected from pyridylmethyl, pyridylethyl, imidazo[1,2-a]pyridylmethyl, benzimidazolylmethyl, imidazo[4,5-c]pyridylmethyl, benzoxazolylmethyl, oxazolylmethyl, oxazolylethyl, and thiocyclobutane-(1,1-dioxide)methyl, wherein the pyridylmethyl, the pyridylethyl, the imidazo[1,2-a]pyridylmethyl, the benzimidazolylmethyl, the imidazo[4,5-c]pyridylmethyl, the benzoxazolylmethyl, the oxazolylmethyl, the oxazolylethyl, and the thiocyclobutane-(1,1-dioxide)methyl are each optionally selected independently by one or two of the R-molecules. 1A Substituent substitution.

6. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein each R 1A It is independently selected from methyl, ethyl, methoxymethyl and cyclopropyl.

7. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R 3 Selected from H, halogen and C 1-6 Alkyl group.

8. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R 3 Selected from H, fluorine, chlorine and methoxy groups.

9. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R 4 It is a 5-membered heteroaryl group, wherein the 5-membered heteroaryl group is optionally composed of one or two independently selected R groups. 4A Substituent substitution.

10. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R 4 Selected from oxadiazolyl, wherein the oxadiazolyl group is optionally surrounded by one or two R groups. 4A Substituent substitution.

11. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein each R 4A It is an ethyl group.

12. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R 5 Selected from H, fluorine, chlorine, methyl, and methoxy groups.

13. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein: R 1 Selected from 5-6 quinone heteroaryl and OR a1 The 5-6 heteroaryl group is optionally separated by one, two or three independently selected R groups. 1A Substituent substitution; R a1 Selected from (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl group, wherein the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one or two independently chosen R groups. 1A Substituent substitution; and Each R 1A Selected independently from C 1-6 Alkyl and C 3-10 cycloalkyl, wherein each C 1-6 Alkyl groups are optionally C 1-4 Alkyl substitution; R 2 For H; R 3 Selected from H, halogen and C 1-6 Alkyl group.

14. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein: R 1 Selected from 5-6 quinone heteroaryl and OR a1 The 5-6 heteroaryl group is optionally separated by one or two independently selected R groups. 1A Substituent substitution; R a1 Selected from (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl and (5-10-membered heteroaryl)-C 1-6 Alkyl group, wherein the (4-10 membered heterocyclic alkyl)-C 1-6 Alkyl groups and the (5-10 membered heteroaryl)-C 1-6 Each alkyl group is optionally selected by one or two independently chosen R groups. 1A Substituent substitution; Each R 1A Selected independently from C 1-6 Alkyl and C 3-6 cycloalkyl, wherein each C 1-6 Alkyl groups are optionally C 1-4 Alkyl substitution; R 2 For H; R 3 Selected from H, halogen and C 1-6 Alkoxy; R 4 Selected from 5-6-membered heteroaryl groups, wherein the 5-6-membered heteroaryl group is optionally selected by one or two independently chosen R groups. 4A Substituent substitution; Each R 4A C chosen independently 1-6 Alkyl groups; and R 5 Selected from H, halogen, C 1-6 Alkyl and C 1-6 Alkyl group.

15. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein: R 1 Selected from 5-6 quinone heteroaryl and OR a1 The 5-6 heteroaryl group is optionally separated by one or two independently selected R groups. 1A Substituent substitution; R a1 The R-molecules are selected from pyridylmethyl, pyridylethyl, imidazo[1,2-a]pyridylmethyl, benzimidazolylmethyl, imidazo[4,5-c]pyridylmethyl, benzoxazolylmethyl, oxazolylmethyl, oxazolylethyl, and thiocyclobutane-(1,1-dioxide)methyl, wherein the pyridylmethyl, the pyridylethyl, the imidazo[1,2-a]pyridylmethyl, the benzimidazolylmethyl, the imidazo[4,5-c]pyridylmethyl, the benzoxazolylmethyl, the oxazolylmethyl, the oxazolylethyl, and the thiocyclobutane-(1,1-dioxide)methyl are each optionally selected independently by one or two of the R-molecules. 1A Substituent substitution; Each R 1A Independently selected from methyl, ethyl, and methoxymethyl; R 2 For H; R 3 Selected from H, halogen and C 1-6 Alkoxy; R 4 Selected from 5-6-membered heteroaryl groups, wherein the 5-6-membered heteroaryl group is optionally selected by one or two independently chosen R groups. 4A Substituent substitution; Each R 4A C chosen independently 1-6 Alkyl groups; and R 5 Selected from H, halogen, C 1-6 Alkyl and C 1-6 Alkyl group.

16. The compound according to claim 1 or 2, wherein the compound of formula I is a compound of formula III: Or its pharmaceutically acceptable salt.

17. The compound according to claim 1 or 2, wherein the compound of formula I is a compound of formula IV: Or its pharmaceutically acceptable salt.

18. A compound selected from the group consisting of: Or its pharmaceutically acceptable salt.

19. A pharmaceutical composition comprising a compound according to any one of claims 1 to 18 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

20. Use of the compound of any one of claims 1 to 18 or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition for treating a patient with a disease, wherein the disease is osteoporosis, the method comprising administering to the patient a therapeutically effective amount of the compound of any one of claims 1 to 18 or a pharmaceutically acceptable salt thereof.

21. The use according to claim 20, wherein the treatment comprises one or more of increasing bone formation in the patient, increasing bone anabolism in the patient, and increasing bone mass in the patient.

Images